J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ohba, H.
Right arrow Articles by Chiba, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohba, H.
Right arrow Articles by Chiba, J.
Agricola
Right arrow Articles by Ohba, H.
Right arrow Articles by Chiba, J.
Journal of General Virology (2001), 82, 813-820.
© 2001 Society for General Microbiology


Animal: RNA Viruses

An immunodominant neutralization epitope on the ‘thumb’ subdomain of human immunodeficiency virus type 1 reverse transcriptase revealed by phage display antibodies

Hiroyoshi Ohba1, Takatoshi Soga1, Takanori Tomozawa1, Yoshifumi Nishikawa1, Atsushi Yasuda2, Asato Kojima2, Takeshi Kurata2 and Joe Chiba1

Department of Biological Science and Technology, Science University of Tokyo, 2641 Yamazaki, Noda, Chiba 278-8510, Japan1
Department of Pathology, National Institute for Infectious Diseases, Tokyo 162-8640, Japan2

Author for correspondence: Joe Chiba. Fax +81 471 25 1841. e-mail chibaj{at}rs.noda.sut.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
An antibody phage display library was produced from the splenocytes of mice immunized with an infectious vaccinia virus recombinant (WRRT) expressing the reverse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1). The library was panned against HIV-1 RT. Two clones, 5F and 5G, which produced Fab fragments specific for RT, were isolated. Surprisingly, both 5F and 5G Fab fragments were capable of strongly inhibiting the RNA-dependent DNA polymerase activity of HIV-1 RT. A hybridoma cell line that produces the monoclonal antibody 7C4, which strongly inhibits RT activity, was established previously using splenocytes from mice immunized with WRRT by the same immunization protocol. The epitope recognized by 7C4 exists in the region of the template primer-binding sites (or the ‘helix clump’) of RT. By epitope mapping and competitive ELISA analysis, it was shown that the 5F and 5G Fab fragments were directed against the same, or a very closely related, epitope that is recognized by 7C4. The neutralizing activities of the 5F, 5G and 7C4 Fab fragments correlated with their affinities for HIV-1 RT. DNA sequencing indicated that the immunoglobulin genes of the heavy chains of 5G and 7C4, as well as those of the light chains of 5F and 5G, had the same origin. These results suggest that the neutralizing epitope, which is recognized by these antibodies, becomes immunodominant after repeated immunization of mice with WRRT. This unique epitope, HIV-1 RT-specific and immunodominant neutralizing epitope (HRSINE), is a logical target for new types of HIV-1 RT inhibitors and gene therapy.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
During replication of human immunodeficiency virus type 1 (HIV-1), virus-encoded reverse transcriptase (RT) catalyses the conversion of the single-stranded RNA genome to a double-stranded DNA genome. HIV-1 RT functions as a heterodimer, comprising a 66 and a 51 kDa subunit (p66 and p51, respectively). The p66 subunit folds into two distinct domains: a typical polymerase domain and a connected RNase H domain. The second subunit, p51, is a copy of p66 in which the 15 kDa RNase H carboxy-terminal segment has been cleaved by the HIV-1 protease and which lacks a functional nucleic acid-binding cleft. The polymerase domain, p66, consists of four subdomains, which are, by analogy with parts of a right hand, referred to as ‘fingers’, ‘palm’, ‘thumb’ or ‘connection’. These subdomains constitute the functional nucleic acid-binding cleft (Kohlstaedt et al., 1992Down ).

Residues 259 to 284 in the thumb subdomain exhibit sequence homology with other nucleic acid polymerases and have been termed the ‘helix clump’. This amino acid motif has been identified in the crystal structure model as an element of the enzyme’s nucleic acid-binding apparatus (Hermann et al., 1994Down ). Analyses using RT mutants containing alanine substitutions in the helix clump suggest that the alpha H core (residues Gln258, Gly262 and Trp266) interacts with the template primer (Beard et al., 1994Down ). Interactions between specific amino acids and the primer stem at positions well removed from the active site are critical determinants of processivity and fidelity (Bebenek et al., 1995Down ). Recently, residues in the thumb subdomain and the minor groove-binding track, in particular, have been reported to be crucial for unique interactions between RT and the polypurine tract, which is required for correct positioning and precise RNase H cleavage (Powell et al., 1999Down ).

Our previous study revealed the existence of a specific neutralizing epitope that is recognized by a murine monoclonal antibody (MAb), 7C4, at a position close to, or forming part of, this highly conserved region of HIV-1 RT. MAb 7C4 interferes with the interaction between RT and the template primer and strongly inhibits the RNA-dependent polymerase activity of HIV-1 RT (Chiba et al., 1996Down ). Among the various retrovirus polymerases, 7C4 seems to be specific for HIV-1 RT: 7C4 inhibited the RT activity of three strains of HIV-1 (IIIB, Bru and IMS-1), but did not inhibit the RT activity of two strains of either HIV-2 (GH-1 and LAV-2) or simian immunodeficiency virus (MAC and MND) (Chiba et al., 1997Down ). If additional MAbs similar to this unique antibody were available they might provide information about the function of the helix clump of HIV-1 RT and assist in the analyses of RT mutants containing alanine substitutions in the helix clump.

This study was initially aimed at developing a panel of recombinant MAbs that are reactive with various epitopes on HIV-1 RT using a phage display library method. In the course of this study, we have succeeded in producing two additional MAbs reactive with an epitope which is probably the same as, or located close to, the 7C4 epitope and is specific for HIV-1 RT among various DNA polymerases. We designate this epitope ‘HRSINE’ by capitalizing the first letters of HIV-1 RT-specific immunodominant and neutralization epitope. HRSINE is a logical target for the development of new types of HIV-1 RT inhibitors. Moreover, these recombinant antibody fragments, 5F, 5G and 7C4, may themselves serve as strong and specific inhibitors of HIV-1 replication when expressed intracellularly in human cells as ‘intrabodies’ or intracellular antibodies. Here, we describe highly efficient cloning of cDNA encoding Fab fragments that react with HRSINE by combining the phage display library method with an immunization method that uses an infectious vaccinia virus recombinant.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Immunization of mice.
The construction of a vaccinia virus recombinant (WRRT) expressing HIV-1 RT has been described previously (Hoshikawa et al., 1991Down ). Female BALB/c mice were immunized with WRRT and maintained under specific-pathogen-free conditions at containment level P3, as described previously (Chiba et al., 1997Down ). Briefly, five mice were anaesthetized by intraperitoneal injection with sodium amobarbital (0·25 ml, 1 µg/ml). Both hind footpads of each mouse were then injected with 1·5x107 p.f.u. of WRRT. Mice were subsequently injected intravenously with the same amount of WRRT at 2, 4 and 7 weeks after the first immunization. Two weeks after the final injection, mice were sacrificed with chloroform and spleen cells were prepared.

{blacksquare} Construction of the phage display library.
We constructed a phage display library of immunoglobulin cDNA from the spleen cells of immunized mice using a pComb3 vector system (Barbas & Lerner, 1991Down ; Burton et al., 1991Down ) with slight modification as follows. The phagemid expression vector for the library was pComb3H (Rader & Barbas, 1997Down ). Synthetic DNA encoding a histidine hexamer followed by a termination codon was cloned into pComb3H between the NheI and NotI sites to enable purification of expressed recombinant Fab fragments. The conditions for amplification of immunoglobulin cDNA with each combination of the PCR primers were optimized by varying pH from 8·5 to 10·0 and MgCl2 concentrations from 1·5 to 3·5 mM. Prior to infection of Escherichia coli XL1-Blue cells with the helper phage VCS-M13, cells were grown in SB medium containing 10 µg/ml tetracycline and 5 mM glucose to abort expression of the Fab fragments. Glucose, tetracycline and uninfected helper phage were removed from the culture by centrifugation 2 h after incubation with helper phage. Cells were then suspended in SB medium containing 20 µg/ml ampicillin and 70 µg/ml kanamycin and incubated at 30 °C overnight. The recombinant phage, precipitated with polyethylene glycol 8000, was resuspended in Dulbecco’s PBS containing 10% Block Ace (Dainippon Pharmaceuticals).

{blacksquare} Screening for RT-specific Fab fragments.
The recombinant phage library was subjected to affinity selection with immobilized RT (Research Institute for Microbial Diseases, Osaka, Japan). Microtitre plates (Costar 3690) were coated overnight with 50 µl RT per well (20 µg/ml solution in PBS) at 4 °C and blocked with 25% Block Ace in PBS at room temperature for 3 h. Affinity selection followed by amplification of the selected phage was repeated in four rounds. Aliquots of 50 µl phage suspension per well were incubated at 37 °C for 2 h. Wells were then washed with PBS containing 0·5% Tween-20 (PBS–Tween) once, five and ten times in the first, second and third to fourth rounds of selection, respectively. After four rounds of panning, 20 phage clones were picked to test their antigen-binding activity and for nucleic acid sequencing.

{blacksquare} Expression and purification of recombinant Fab fragments.
E. coli cells transformed with the phagemid DNA were cultured at 30 °C overnight in 2 l of SB medium containing 1 mM IPTG. Cells were collected by centrifugation at 1000 g, suspended in 30 ml of ice-cold osmotic solution (30 mM Tris–HCl, pH 7·4, containing 20% sucrose) and placed on ice for 1 h. Cells were shocked by the addition of 200 ml of ice-cold water (Sawyer & Blattner, 1991Down ). The cell extract was recovered by centrifugation at 10000 g and the salt concentration was adjusted to 500 mM NaCl. The sample was then applied to a column containing 2 ml of Ni-NTA agarose (Qiagen), which had been pre-equilibrated with wash buffer (50 mM Tris–HCl, pH 8·0, containing 500 mM NaCl). The column was washed with 9 ml of wash buffer containing 30 mM imidazole and then the bound proteins were eluted with 4 ml of elution buffer (100 mM imidazole–HCl, pH 8·0, containing 500 mM NaCl). The eluted solution was dialysed against 20 mM Tris–HCl (pH 8·5) and applied to an anion-exchange column (DEAE-5PW, TOSOH). The column was then washed with 10 ml of the same buffer. Bound protein was eluted with a linear gradient (0–1 M) of NaCl. Anti-RT antibody activity in each fraction was monitored by ELISA and the active fractions were pooled and dialysed against PBS. Fab fragments were concentrated with Centricon 30 (Amicon) and protein concentration was determined with a BCA protein assay kit (Pierce).

{blacksquare} Expression and purification of soluble Fab fragments of MAb 7C4 in E. coli.
The 5' end sequences of the heavy and light chain cDNA from 7C4 hybridoma cells were determined by rapid amplification of the cDNA ends (Frohman et al., 1988Down ) using an Fd 3' primer, IgG1 (5' AGGCTTACTAGTACAATCCCTGGGCACAAT 3'), and a {kappa} light chain 3' primer (5' GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA 3') (Kang et al., 1991Down ) as internal primers. DNA sequences encoding the heavy and light chains of MAb 7C4 were then cloned by PCR amplification. Primers for the heavy chain were modified heavy chain variable 5' primer Hc1 (Kang et al., 1991Down ) with the correct 5' end sequence of the 7C4 heavy chain cDNA (5' AACCAGCCATGGCCGAGGTGCAGCTGGTCGAGTCTGGAGGA 3') and the 3' primer IgG1. Primers for the light chain were modified light chain 5' primer Lc3 (Kang et al., 1991Down ) with the correct 5' end sequence of the 7C4 light chain cDNA (5' GACGACGGCCCAGGCGGCCCAAATTGTTCTCACCCAGTCT 3') and the {kappa} light chain 3' primer. The heavy chain Fd and light chain genes of 7C4 were then successively cloned into the pComb3H vector (Rader & Barbas, 1997Down ). 7C4 Fab fragments were produced in E. coli cells and purified as described above.

{blacksquare} Preparation of recombinant Fab fragments specific for haemocyanin.
We also constructed a phage display library of immunoglobulin cDNA from the spleen cells of a mouse immunized with keyhole limpet haemocyanin (KLH). Fab fragments specific for KLH were prepared as described above.

{blacksquare} RT enzymatic activity assay.
RNA-dependent DNA polymerase activity of RT was assayed essentially as described by Hoffman et al. (1985)Down with slight modification (Chiba et al., 1996Down ). For determining the inhibitory activity of Fab fragments on RT, 0·25 µg/ml RT was incubated with different concentrations of Fab fragments in 50 mM Tris–HCl, pH 7·4, containing 100 mM NaCl, 5 mM EDTA and 0·5 mg/ml BSA at room temperature for 40 min prior to the polymerase reaction.

{blacksquare} Epitope mapping of Fab fragments.
To map the epitope recognized by the Fab fragments, their reactivity with various segments of the p66 subunit of HIV-1 RT were determined by Western blotting. The plasmids pRN2161, pRN1161, pRN2022 and pRN4891 (kind gifts from A. Saito and H. Shinagawa, Osaka University, Japan) expressed p66 subunit peptides 52–98, 52–335, 145–428 and 155–250, respectively. These peptide segments were expressed in a fused form with {beta}-galactosidase in E. coli. Cell lysate prepared with lysozyme was separated by 7·5% SDS–PAGE. Proteins were electrophoretically transferred from the gel to a PVDF membrane filter (Millipore), which was subsequently blocked with PBS containing 25% Block Ace and cut into strips. Each strip was incubated for 1 h with 1 ml of 1 µg/ml Fab fragments in PBS–Tween containing 10% Block Ace. After washing with PBS–Tween, the strips were incubated with alkaline phosphatase-conjugated goat anti-mouse IgG F(ab')2 (Pierce) diluted to 1/2000 in PBS–Tween. After three washes, the bands of reactive fusion protein were visualized by incubation with BCIP/NBT substrate (100 mM Tris–HCl, pH 9·8, containing 100 mM NaCl, 1·5 mM MgCl2, 0·016% 5-bromo-4-chloro-3-indolyl phosphate, 0·033% nitro blue tetrazolium and 1·46% dimethyl formamide).

{blacksquare} Competition ELISA.
Each well of an ELISA plate (Costar 3690) was coated with 50 µl of 1 µg/ml recombinant RT in 50 mM carbonate buffer, pH 9·6, for 3 h. Wells were blocked with PBS containing 25% Block Ace for 1 h. Different concentrations of 50 µl aliquots of competitor Fab fragments diluted with PBS–Tween containing 10% Block Ace were incubated in the washed wells for 1 h. After washing, 50 µl of 2 µg/ml biotinylated 7C4 IgG or biotinylated 6B9 IgG was added to each well and incubated for 1 h. MAb 6B9 binds to HIV-1 RT without any effect on enzyme activity (Chiba et al., 1996Down ) and the 6B9 epitope exists on the palm subdomain (see Fig. 6Down). After another wash, 50 µl alkaline phosphatase-labelled streptavidin (GIBCO) diluted to 1/5000 in PBS–Tween was added to each well and incubated for 1 h. Substrate solution (100 µl) of 1 mg/ml p-nitrophenyl phosphate dissolved in 9·7% diethanolamine, pH 9·8, containing 0·01% MgCl2 and 0·02% NaN3 was added to each well and the amount of bound antibody fragment was measured by absorbance at 405 nm. The background absorbance at 630 nm was subtracted from the A405 values. All procedures were performed at room temperature.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 6. Aligned amino acid sequences of the light and heavy chains of 5F, 5G, and 7C4 Fab fragments. Sequences are deduced from Fab fragment cDNA. Sequences of 5F and 5G Fab fragments are compared with that of 7C4 Fab. Shared amino acids of the Fab fragments as compared with 7C4 Fab (top line) are indicated by dashes. Colons indicate gaps that were introduced for better sequence alignment. Three complementarity-determining regions (CDR) are boxed. Four framework (FR) and two constant (CH1, CL) regions are marked above the sequence.

 
{blacksquare} Measurement of affinity constants.
We measured the affinity of the Fab fragments for RT using surface plasmon resonance (BIAcore). Recombinant RT was fixed to the dextran matrix on the sensor chip by standard amine chemistry, according to the manufacturer’s instructions. The chip was blocked with 1 M ethanolamine–HCl, pH 8·5. The resonance unit from the chip incubated with different concentrations of Fab fragments after washing with HBS buffer (10 mM HEPES, pH 7·4, containing 150 mM NaCl, 3·4 mM EDTA and 0·005% Tween-20) was recorded. At each interval between measurements, the chip was regenerated with 10 mM glycine–HCl, pH 3·5, containing 2 M NaCl and HBS buffer. The concentration of each of the Fab fragments was 0·25, 0·5, 1·0 and 2·0 µM. Kinetic values were calculated with BIA evaluation software (BIAcore).

{blacksquare} Sequencing of antibody cDNA.
Nucleic acid sequencing was carried out using the Thermo Sequenase II dye terminator cycle sequencing kit (Amersham–Pharmacia).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Recombinant Fab fragments directed against RT
We prepared a phage display library of immunoglobulin cDNA from spleen cells obtained from mice that had been repeatedly immunized with WRRT. A library of 4·6x1012 (4·2x106 for light chain and 1·1x106 for heavy chain) clones of phage-displayed Fab fragments was screened for specific binding to HIV-1 RT. After four rounds of panning, 20 randomly picked clones yielded 20 binding clones. Nucleotide sequencing revealed that these clones were derived from two independent clones. Both clones, named 5F and 5G, produced Fab fragments that were reactive with HIV-1 RT. The molecular mass of the purified 5F and 5G Fab fragments was 45 kDa, as deduced from the nucleotide sequences (Fig. 1ADown). Under reduced conditions with SDS–PAGE, the heavy and light chains of 5F and 5G Fab fragments showed slower mobility than expected (Fig. 1ADown). Both 5F and 5G Fab fragments were reactive with the p66 and p51 subunits of HIV-1 RT, indicating that they bound to the polymerase domain of the enzyme (Fig. 1BDown).



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 1. Purification of recombinant Fab fragments and their reactivity to recombinant HIV-1 RT. (A) SDS–PAGE analysis shows homogeneously purified recombinant Fab fragments, 5F and 5G. Fab fragments were expressed in the periplasm of E. coli cells and purified by affinity chromatography on an Ni-NTA agarose column and, subsequently, by anion exchange chromatography. Samples were electrophoresed under either reducing (+2ME) or nonreducing (-2ME) conditions and the gel was then silver-stained. (B) Western blot analysis shows the reactivity of the recombinant Fab fragments to both the p66 and p51 subunits of HIV-1 RT.

 
Inhibition of RNA-dependent DNA polymerase activity of HIV-1 RT by the recombinant Fab fragments
Although the 5F or 5G clones were randomly selected from the RT-binding clones, to our surprise, pre-incubation of RT with either the 5F or the 5G Fab fragments resulted in dose-dependent inhibition of RNA-dependent DNA polymerase activity (Fig. 2Down). This inhibition was similar to that observed when inhibitory activity was tested using the enzymatically prepared Fab form of 7C4 (Chiba et al., 1996Down ). No inhibition of activity was observed when control anti-KLH Fab fragments were tested. Enzyme activity of RT was completely inhibited by 5F and 5G Fab fragments at concentrations greater than 40 nM. 7C4 Fab fragments induced 95% inhibition of RT activity at 400 nM. The concentrations of the recombinant Fab fragments required for 50% inhibition of enzyme activity were about 11, 21 and 42 nM for 5F, 5G and 7C4 Fab fragments, respectively. Inhibition of RT activity by the 5F and 5G fragments thus seemed to be about four and two times stronger, respectively, than that for the 7C4 Fab fragments.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Inhibition of the RNA-dependent DNA polymerase activity of RT by recombinant Fab fragments. HIV-1 RT was incubated with various concentrations of the purified Fab fragments ({bullet}, 5F; {blacktriangleup}, 5G; {blacksquare}, 7C4; x, anti-KLH) and the inhibitory activity was determined, as described in Methods.

 
Epitope mapping of Fab fragments
Both 5F and 5G Fab fragments were reactive with the polymerase domain of HIV-1 RT, as shown in Fig. 1(B)Up. To locate the epitope recognized by 5F and 5G Fab fragments in the polymerase domain, various peptide segments of the domain were expressed in E. coli cells as fusion proteins with {beta}-galactosidase and tested for their reactivity with both Fab fragments by Western blotting analysis. Fig. 3Down summarizes the location of the segments tested and their reactivity with the Fab fragments. Both the epitopes of 5F and 5G were found to be located within the region spanning amino acids 252–335 in the HIV-1 RT sequence, which contains the sequence of the thumb subdomain. The same was observed for the recombinant 7C4 Fab fragments. Another anti-RT, MAb 6B9, which does not inhibit RT activity (Chiba et al., 1996Down ), bound to the region spanning amino acids 155–250, which contains the palm subdomain. Thus, the 5F and 5G Fab fragments seem to be directed against the epitope on the thumb subdomain of HIV-1 RT, in which the 7C4 epitope also exists.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3. Determination of the epitope recognized by recombinant Fab fragments on HIV-1 RT. Reactivity of the recombinant Fab fragments with segments of the p66 subunit of HIV-1 RT was tested by Western blotting, as described in Methods. Peptide segments of the polymerase domain in the p66 subunit were expressed in E. coli as fusion proteins with {beta}-galactosidase (1–4: peptides 52–98, 52–335, 145–428, 155–250, respectively). The approximate locations of the subdomains in the linear sequence of RT are indicated above: F, finger; P, palm; T, thumb; C, connection. Note the similar reactive patterns of 5F and 5G Fab fragments with the fusion proteins to those of the 7C4 Fab fragments. 6B9 is an anti-RT monoclonal IgG which binds to RT without any effect on the enzyme activity (Chiba et al., 1996Down ).

 
Competition ELISA with 7C4 IgG
The potency of the inhibitory activity of the 5F, 5G and 7C4 Fab fragments on HIV-1 RT and the results of the epitope mapping on the enzyme suggest the possibility that the epitopes for 5F, 5G and 7C4 are close to each other on the enzyme. To test this possibility, competition ELISA with 7C4 IgG was carried out. Binding of biotinylated 7C4 IgG to RT was inhibited more effectively by the 5F and 5G Fab fragments than by 7C4 itself (Fig. 4ADown). The concentrations of Fab fragments required for 50% inhibition of 7C4 binding were 0·3, 1·0 and 5·1 µg/ml for 5F, 5G and 7C4 Fab fragments, respectively. Complete inhibition by these fragments was observed at higher concentrations of each antibody. In the control experiment, no obvious inhibition was observed with 5F, 5G and 7C4 Fab fragments in binding biotinylated 6B9 IgG to HIV-1 RT (Fig. 4BDown). These results indicate that the epitopes for 5F, 5G and 7C4 are very close to each other on HIV-1 RT.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Epitope specificity of Fab fragments analysed by competitive-binding assay. Various concentrations of each competitor Fab fragment ({bullet}, 5F; {blacktriangleup}, 5G; {blacksquare}, 7C4) were added to RT-coated wells of ELISA plates, followed by the addition of biotinylated 7C4 IgG (A) or 6B9 IgG (B). Binding of biotinylated IgG to RT was determined with alkaline phosphatase-conjugated streptavidin. Inhibition (%)=(Ap-Aa)/Aax100% where A is the absorbance at 410 nm in the absence (Aa) or presence (Ap) of competitor Fab fragments.

 
Affinity constants of the Fab fragments to RT
To test the possibility that the efficient inhibition of RT by the 5F and 5G Fab fragments is dependent on their higher affinity for RT as compared with that of 7C4, we determined the binding kinetics of the Fab fragments to RT using a biosensor (Fig. 5Down). The affinity constants (KA) of 5F and 5G Fab fragments were ten times greater than that of 7C4. This difference in their KA values was mainly due to the lower dissociation constants (kDISS) of 5F and 5G Fab fragments, although the 7C4 Fab fragments showed the highest association constant (kASS). These results indicate that the difference in the efficiency of competition between the 7C4 Fab fragments and the 5F and 5G Fab fragments depends mainly on their affinity for RT.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 5. Affinity measurements of Fab fragments by a surface plasmon resonance assay. HIV-1 RT was immobilized on a sensor chip. Different concentrations (0·25, 0·5, 1·0 and 2·0 µM) of recombinant Fab fragments were injected onto the sensor chip for 175 s to record the association kinetics. Dissociation kinetics were recorded by washing the sensor chip with HBS buffer. The kinetic constants, kASS M-1s-1, kDISS s-1 and KA M-1, were calculated from the sensorgrams using the BIA evaluation software (BIAcore).

 
Specificity of the 5F and 5G Fab fragments
5F and 5G Fab fragment specificity was tested by ELISA using a panel of retroviral RT and bacterial DNA polymerases. Both Fab fragments were highly specific for HIV-1 RT, as reported previously for 7C4 IgG (Chiba et al., 1996Down ). RT from avian myeloblastosis and Molony murine leukaemia viruses, as well as DNA polymerases from E. coli (type I) and Thermus aquaticus (Taq), were not reactive with the 5F and 5G Fab fragments (data not shown).

Comparison of amino acid sequences
5F and 5G Fab fragment amino acid sequences were compared with those of the 7C4 Fab fragments (Fig. 6Up). Interestingly, although the amino acid sequences of the VL region of 5F and 5G Fab were different from that of the same region of the 7C4 Fab, 5F and 5G Fab fragments were almost the same: only one amino acid difference, which was located in the CDR3 region, existed. While the amino acid sequences of the CL region of 5F and 5G Fab fragments were slightly different from that of the 7C4 Fab, 5F and 5G Fab fragments were exactly the same. These results indicate that the cDNAs encoding the light chains of 5F and 5G were probably cloned from B cell clones of the same origin. Surprisingly, the amino acid sequence of the VH region of 5G Fab was nearly the same as that of the 7C4 Fab: only one amino acid difference was seen in the FR3 region but the length and sequence of their CDR3 regions were exactly the same. The amino acid sequence of the VH region of 5F Fab was different from that of the 5G and 7C4 Fab fragments; many amino acids differed throughout this region and a marked difference in the length and sequence in the CDR3 region was noted. These results indicate that the cDNAs encoding the heavy chains of 5F and 5G Fab fragments were cloned from different anti-RT antibody producing B cell clones.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In a previous report (Chiba et al., 1996Down ), we have extensively characterized a murine MAb, 7C4, which strongly inhibits the RNA-dependent DNA polymerase activity of HIV-1 RT. The epitope recognized by 7C4 was demonstrated to exist in a region of the template primer-binding sites (or helix clump) of the thumb subdomain of RT. In the present study, while developing a panel of MAbs that were reactive with the various epitopes on HIV-1 RT using the phage display library method, we found that the neutralizing epitope on the thumb subdomain that is recognized by the 7C4 antibody could also become an immunodominant epitope in the mouse following repeated immunization with WRRT. This conclusion is based on the following three reasons: (1) 5F and 5G Fab fragments were cloned from a phage display library prepared from mice immunized with WRRT expressing RT in vivo using a similar immunization protocol as that for establishing the 7C4 hybridoma cell line; (2) all of the 5F, 5G and 7C4 fragments had strong neutralizing activity on HIV-1 RT and were directed against the same, or a very closely related, epitope on the thumb subdomain and seemed to be highly specific for HIV-1 RT among the various polymerases of retroviral or bacterial origin; and (3) the phage clones of 5F, 5G and 7C4 shared the cDNA sequences that encode the light or heavy chains. Based on these three reasons, we designate the epitope that is recognized by these antibodies HRSINE, which is a capitalization of the first letter of HIV-1 RT-specific and immunodominant neutralizing epitope.

We have succeeded in preparing high affinity and enzyme-neutralizing Fab fragments (5F and 5G) directed against HIV-1 RT by the phage display method. The KA values of the 5F and 5G Fab fragments were in the 10-8 M range and are about ten times greater than those of the 7C4 Fab fragments expressed in E. coli (Fig. 6Up) or those prepared by papain digestion of the 7C4 hybridoma cell-produced protein (data not shown). The 5G and 7C4 Fab fragments showed similar association kinetics and had almost identical amino acid sequences of their heavy chains (Fig. 6Up). However, the 7C4 Fab showed lower dissociation kinetics than 5G Fab. Thus, the higher affinity of 5G Fab to that of the 7C4 Fab may be due to the light chain partner of 5G Fab. On the other hand, 5F and 5G Fab fragments showed similar dissociation kinetics and had very similar light chains, although they were combined with different heavy chains. Such different combinations of almost identical heavy and light chains support the idea that each of the 7C4, 5F and 5G Fab fragments recognizes the same epitope with different affinities. Correlation of the neutralizing activity of the 5F, 5G and 7C4 Fab fragments (Fig. 2Up) with their affinity for HIV-1 RT (Fig. 6Up) and their highly restricted reactivity to the RT of HIV-1 among various other polymerases adds further support to the idea above. Isolation of the 5F and 5G clones from the library might have been a result of random chain shuffling of the cDNA from expanded rare B cell clones encoding light and heavy chains and this might have caused an increase in their affinity.

From the results of amino acid sequence comparison of the 5F, 5G and 7C4 Fab fragments, it was ascertained that expansion of rare B cell clones occurs in mice repeatedly immunized with WRRT. These rare B cell clones probably have immunoglobulin genes encoding the heavy chains of either the 7C4- or the 5F-type and light chains of either the 7C4- or the 5F- and 5G-type or one of the combinations thereof.

To date, it has been difficult to produce enzyme-neutralizing MAbs by the conventional immunization protocol. In both this study and our previous study using mice immunized with WRRT, we report or reported the very efficient production of such MAbs using the phage display method and hybridoma techniques, respectively. Since immunization of mice with WRRT seems to induce the clonal expansion of rare B cells in vivo, we conclude that it is not difficult to induce enzyme-neutralizing antibodies in vivo using vaccinia virus recombinants for immunization. In addition, the immunodominant neutralizing epitope revealed by the immunization of mice with WRRT may be of significance in vivo and may provide an important basis for genetic immunization in humans. In cases where enzyme-neutralizing antibodies are expected to be effective in preventing microbial infection in humans, this immunization method using the vaccinia virus recombinant could be effectively applied. It is quite interesting to determine whether immunization of humans with WRRT results in the production of antibody to HRSINE. Two human recombinant Fab fragments that are reactive with HIV-1 RT and completely neutralize RT activity have been selected from a synthetic Fab phage display library (Gargano et al., 1996Down ). The human Fab fragments, however, recognize a structural fold that is common to the different DNA polymerase and is necessary for their activity (Gargano et al., 1996Down ). This epitope is apparently closely located to, but different from, HRSINE, since the latter is specific for HIV-1 RT among various DNA polymerases. By immunization with WRRT and thus by expanding human B cell clones that recognize HRSINE, the resultant Fab fragments isolated may be useful for exploring alternative therapeutic strategies based on either gene therapy (Cattaneo & Biocca, 1999Down ) or recombinant proteins. It should be noted, however, that the immunization protocol employed in this study, namely repeated intravenous immunization, is not practical in humans. Recent success in the development of an expression vector using highly attenuated vaccinia viruses (Moss, 1996Down ; Sugimoto & Yamanouchi, 1994Down ) and vectors for plasmid immunization (Ledley, 1995Down ) encourage us to attempt the establishment of an immunization method to induce enzyme-neutralizing antibodies in humans. It is still unclear why the immunization of mice with the vaccinia virus recombinant is so effective at inducing the clonal expansion of rare B cell clones that produce enzyme-neutralizing antibodies. Further work is required to elucidate the mechanism underlying this efficient clonal expansion.

This unique epitope, named HRSINE, which is functionally significant for RT activity, is an excellent target for the development of new types of HIV-1 RT inhibitors. Moreover, these recombinant antibody fragments may themselves serve as strong and specific inhibitors against HIV-1 replication when expressed within human cells as either intrabodies or intracellular antibodies (Cattaneo & Biocca, 1999Down ; Rondon & Marasco, 1997Down ).


   Acknowledgments
 
This research was supported in part by a grant from the Japan Health Sciences Foundation to J.C.


   Footnotes
 
The DDBJ accession numbers of the sequences reported in this paper are: AB048522 (7C4 LC), AB048523 (7C4 HC), AB0458524 (5F LC), AB0458525 (5F HC), AB0458526 (5G LC) and AB0458527 (5G HC).


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Barbas, C. F. & Lerner, R. A. (1991). Combinatorial immunoglobulin libraries on surface phage (phabs): rapid selection of antigen-specific Fabs. Comparative Methods in Enzymology 2, 119-124.

Beard, W. A., Stahl, S. J., Kim, H. R., Bebenek, K., Kumar, A., Strub, M. P., Becerra, S. P., Kunkel, T. A. & Wilson, S. H. (1994). Structure/function studies of human immunodeficiency virus type 1 reverse transcriptase. Alanine scanning mutagenesis of an alpha helix in the thumb subdomain. Journal of Biological Chemistry 269, 28091-28097.[Abstract/Free Full Text]

Bebenek, K., Beard, W. A., Casas-Finet, J. R., Kim, H. R., Darden, T. A., Wilson, S. H. & Kunkel, T. A. (1995). Reduced frameshift fidelity and processivity of HIV-1 reverse transcriptase mutants containing alanine substitutions in helix H of the thumb subdomain. Journal of Biological Chemistry 270, 19516-19523.[Abstract/Free Full Text]

Burton, D. R., Barbas, C. F., Persson, M. A., Koenig, S., Chanock, R. M. & Lerner, R. A. (1991). A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals. Proceedings of the National Academy of Sciences, USA 88, 10134-10137.[Abstract/Free Full Text]

Cattaneo, A. & Biocca, S. (1999). The selection of intracellular antibodies. Trends in Biotechnology 17, 115-121.[Medline]

Chiba, J., Yamaguchi, A., Suzuki, Y., Nakano, M., Zhu, W., Ohba, H., Saito, A., Shinagawa, H., Yamakawa, Y., Kobayashi, T. & Kurata, T. (1996). A novel neutralization epitope on the ‘thumb’ subdomain of human immunodeficiency virus type 1 reverse transcriptase revealed by a monoclonal antibody. Journal of General Virology 77, 2921-2929.[Abstract/Free Full Text]

Chiba, J., Nakano, M., Suzuki, Y., Aoyama, K., Ohba, H., Kobayashi, T., Yasuda, A., Kojima, A. & Kurata, T. (1997). Generation of neutralizing antibody to the reverse transcriptase of human immunodeficiency virus type 1 by immunizing of mice with an infectious vaccinia virus recombinant. Journal of Immunological Methods 207, 53-60.[Medline]

Frohman, M. A., Dush, M. K. & Martin, G. R. (1988). Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences, USA 85, 8998-9002.[Abstract/Free Full Text]

Gargano, N., Biocca, S., Bradbury, A. & Cattaneo, A. (1996). Human recombinant antibody fragments neutralizing human immunodeficiency virus type 1 reverse transcriptase provide an experimental basis for the structural classification of the DNA polymerase family. Journal of Virology 70, 7706-7712.[Abstract]

Hermann, T., Meier, T., Gotte, M. & Heumann, H. (1994). The ‘helix clump’ in HIV-1 reverse transcriptase: a new nucleic acid-binding motif common in nucleic acid polymerases. Nucleic Acids Research 22, 4625-4633.[Abstract/Free Full Text]

Hoffman, A. D., Banapour, B. & Levy, J. A. (1985). Characterization of the AIDS-associated retrovirus reverse transcriptase and optimal conditions for its detection in virions. Virology 147, 326-335.[Medline]

Hoshikawa, N., Kojima, A., Yasuda, A., Takayashiki, E., Masuko, S., Chiba, J., Sata, T. & Kurata, T. (1991). Role of the gag and pol genes of human immunodeficiency virus in the morphogenesis and maturation of retrovirus-like particles expressed by recombinant vaccinia virus: an ultrastructural study. Journal of General Virology 72, 2509-2517.[Abstract/Free Full Text]

Kang, A. S., Barbas, C. F., Janda, K. D., Benkovic, S. J. & Lerner, R. A. (1991). Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proceedings of the National Academy of Sciences, USA 88, 4363-4366.[Abstract/Free Full Text]

Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A. & Steitz, T. A. (1992). Crystal structure at 3·5 resolution of HIV-1 reverse transcriptase complexed with an inhibitor. Science 256, 1783-1790.[Abstract/Free Full Text]

Ledley, F. D. (1995). Nonviral gene therapy: the promise of genes as pharmaceutical products. Human Gene Therapy 6, 1129-1144.[Medline]

Moss, B. (1996). Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety. Proceedings of the National Academy of Sciences, USA 93, 11341-11348.[Abstract/Free Full Text]

Powell, M. D., Beard, W. A., Bebenek, K., Howard, K. J., Le Grice, S. F., Darden, T. A., Kunkel, T. A., Wilson, S. H. & Levin, J. G. (1999). Residues in the alphaH and alphaI helices of the HIV-1 reverse transcriptase thumb subdomain required for the specificity of RNase H-catalyzed removal of the polypurine tract primer. Journal of Biological Chemistry 274, 19885-19893.[Abstract/Free Full Text]

Rader, C. & Barbas, C. F.III (1997). Phage display of combinatorial antibody libraries. Current Opinion in Biotechnology 8, 503-508.[Medline]

Rondon, I. J. & Marasco, W. A. (1997). Intracellular antibodies (intrabodies) for gene therapy of infectious diseases. Annual Review of Microbiology 51, 257-283.[Medline]

Sawyer, J. R. & Blattner, F. R. (1991). Rapid detection of antigen binding by antibody fragments expressed in the periplasm of Escherichia coli. Protein Engineering 4, 947-953.[Abstract/Free Full Text]

Sugimoto, M. & Yamanouchi, K. (1994). Characteristics of an attenuated vaccinia virus strain, LC16m0, and its recombinant virus vaccines. Vaccine 12, 675-681.[Medline]

Received 15 September 2000; accepted 15 December 2000.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ohba, H.
Right arrow Articles by Chiba, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohba, H.
Right arrow Articles by Chiba, J.
Agricola
Right arrow Articles by Ohba, H.
Right arrow Articles by Chiba, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS