|
|
||||||||
Animal: RNA Viruses |
Robert Koch-Institut, Nordufer 20, D-13353 Berlin, Germany1
Paul-Ehrlich-Institut, Paul-Ehrlich-Strasse 51-59, D-63225 Langen, Germany2
Author for correspondence: Joachim Denner at Robert Koch-Institut. Fax +49 30 4547 2801. e-mail dennerj{at}rki.de
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In this paper we report on our attempts to infect cells of different species with PERV. In addition to permanent cell lines, we have used primary cells to simulate, as closely as possible, the situation during xenotransplantation. We demonstrate the infection of different permanent animal and human cell lines and primary cells with PERV. Furthermore, we have tried to establish a small animal model using naive and immunosuppressed rats as well as naive guinea pigs. Under our experiment conditions, no signs of PERV infection were observed.
| Methods |
|---|
|
|
|---|
PERV producer cells.
Cell lines used for infection.
Feline CRFK (ATCC CCL-94) and PG4 (ECACC 94102703) cells, and human THP-1 (ATCC TIB-202), WIL2.NS.6TG (ECACC 93031001) and C8166 (ECACC 88051601) cells were grown in different culture medium, as indicated by either ATCC or ECACC, respectively.
Preparation of primary cells.
Primary cells from different organs were isolated as described by Freshney (1987)
. Kidneys and embryos were removed aseptically, minced and treated with 1 ml 0·25% trypsin in PBS per 5 mg tissue using a magnetic stirrer at 37 °C. Single cell suspensions were cultivated in DMEM containing 4·5% sucrose and 10% FCS. Spleens were resuspended using a steel mesh. Spleen cells were cultivated in RPMI-1640 with 10% FCS and stimulated with 72 µg/ml PHA for 3 days, followed by stimulation with 100 IU/ml IL-2 every second day.
Electron microscopy.
Cells were fixed at room temperature for 45 min with freshly mixed glutaraldehyde (2·5%) in warm medium. Fixed cells were scraped off the culture plate, suspended in warm liquid agarose and immediately chilled on ice. After cutting the agarose into small cubes, cells were re-fixed in 1% OsO4 in PBS, dehydrated in a graded series of ethanol and embedded in Epon 812, according to standard protocols (Luft, 1961
). Epon blocs were cut into 80 nm sections on a Leica Ultracut 4 microtome and contrasted with 2% uranylacetate for 10 min and 2% lead citrate for 2 min at room temperature. Micrographs were taken on a Zeiss CEM 902 electron microscope using ESI mode.
PCR.
DNA from infected and control cells was isolated using preparation kits from Qiagen. DNA from spleen, kidney and lymph nodes of infected rats and guinea pigs was isolated using DNAzol (Life Technologies). For the detection of provirus, primers specific for the pol gene (forward primer 5' TTGACTTGGGAGTGGGACGGGTAAC and reverse primer 5' GAGGGTCACCTGAGGGTGTTGGAT) (Czauderna et al., 2000
) and the gag gene (forward primer 5' GCGACCCACGCAGTTGCATA and reverse primer 5' CAGTTCCTTGCCCAGTGTCCTT) (Paradis et al., 1999
) of PERV were used. For identification of the virus subtype, primers specific for each of the env genes were used [PERV-A, forward primer 5' TGGAAAGATTGGCAACAGCG and reverse primer 5' AGTGATGTTAGGCTCAGTGG (Le Tissier et al., 1997
); PERV-B, forward primer 5' TTCTCCTTTGTCAATTCCGG and reverse primer 5' TACTTTATCGGGTCCCACTG; PERV-C, forward primer 5' CTGACCTGGATTAGAACTGG and reverse primer 5' ATGTTAGAGGATGGTCCTGG (Takeuchi et al., 1998
)]. For PCR amplification, the standard PCR program of one cycle of 95 °C for 10 min, 35 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min and one cycle of 72 °C for 7 min was applied. PCR sensitivity was also analysed; one PERV-producing 293 cell was detected on the background of 1x106 uninfected 293 cells.
RTPCR.
For the detection of virus production from infected cells, viral RNA from supernatants of cultured cells was isolated. Cells were removed from supernatants by centrifugation at 200 g for 10 min. Thereafter, cell debris was removed by centrifugation at 3500 g for 10 min and an additional centrifugation step at 10000 g for 30 min. Virus was pelleted by ultracentrifugation (54000 g for 3 h) and viral RNA isolated using the viral RNA isolation kit from Qiagen. RNA was reverse transcribed using a one-step RTPCR kit (Life Technologies) and cDNA was screened using PCR with PERV-specific primers.
Immune peroxidase assay (IPA).
Cells were trypsinized and seeded in 6-well (1x105 cells per well) or 96-well (3x104 cells per well) plates coated with either 100 µl or 1 ml of a 0·005% poly(L-lysine) solution (Sigma), respectively. After 4 h of incubation at 37 °C, 5% CO2 and 98% humidity, cells were washed twice with PBS and fixed with methanol overnight at -20 °C. Cells were treated with 2% fat-free milk powder (Marvel) in PBS for 1 h to block unspecific antibody binding. Thereafter, cells were incubated for 1 h with PERV-specific antisera (diluted 1:40 in blocking solution). After washing four times with PBS, horseradish peroxidase-labelled protein G (1:5000 in blocking solution) was added to the cells. After 1 h of incubation, cells were washed four times with PBS and the substrate 3-amino-9-ethyl-carbazole (Sigma) was added.
Western blot assays.
Western blots were performed as described by Tacke et al. (2000a
). Supernatants from PERV-producing 293 cells were collected and cell debris was removed by centrifugation at 10000 g for 30 min. Virus was concentrated by ultracentrifugation (54000 g for 3 h) and pelleted through a 20% sucrose cushion (140000 g for 2 h). Resuspended virus pellets were then loaded onto a sucrose gradient (2050%, 200000 g for 3 h). Virus-containing fractions were collected, pelleted, subjected to denaturing 10% SDSPAGE using Tricine buffer and transferred to PVDF membranes by electroblotting. Membranes were blocked with 0·1% Tween-20 and 1% BSA in TBS. Sera were incubated for 12 h at 4 °C at 1:201:50 dilution followed by a further incubation with a 1:5001:1000 dilution of peroxidase-coupled species-specific anti-IgG antiserum for 2 h at room temperature. Antibody binding was visualized using metal-enhanced diaminobenzidine (Pierce) and peroxide. For all assays, a positive control goat antiserum, raised against a 15 kDa band from purified virus from PK-15 cells, and rabbit antiserum, raised against purified whole virus from infected 293 cells, were included (Tacke et al., 2000b
).
Measurement of RT.
RT activity was measured using a commercial assay (Cavidi Tech).
Virus titration.
Supernatants from infected human 293 cells and porcine PK-15 cells were titrated on uninfected human 293 cells in the presence of 8 µg/ml polybrene (PB) (Sigma) and virus infection was measured using IPA.
In vitro infection experiments.
For infection experiments, cell-free supernatants from PERV-producing porcine PK-15 and infected human 293 cells were used. In all cases, cell debris was removed by centrifugation at 10000 g for 30 min. For attempts at virus infection, 616 µg/ml PB or 6 µg/ml protamine sulfate (PS) (Sigma) was added.
Infection of rats.
Cell-free supernatants from porcine PK-15 or PERV-producing human 293 cells were collected and cell debris was removed by centrifugation at 10000 g for 30 min. For some infections, virus was concentrated by ultracentrifugation (54000 g for 3 h). Aliquots of 2 ml of virus-containing supernatant or pelleted virus were injected (titre up to 1x105 TCID50 per animal) either intraperitoneally (i.p.) or intramuscularly (i.m.) into naive rats (Wistar, Charles River Laboratories). For inoculation of cells, porcine PK-15 (1x107) or PERV-producing human 293 (1x108) cells were injected i.p. Rats were immunosuppressed by 10 mg/kg cyclosporin-A (Cs-A) (Sandimmune, Sandoz), which was applied i.m. every second day. Immunosuppressed rats received PERV intravenously (i.v.), i.m. and i.p. For complement inhibition, some rats received 500 µg/kg cobra venom factor (CVF) (Sigma) i.p. 5 days before virus application and on the day of virus inoculation.
Infection of guinea pigs.
Virus-containing cell-free supernatants and pelleted virus, as described above, were applied i.m. and i.p. to naive animals (Dunkin Hartley, Charles River Laboratories).
| Results |
|---|
|
|
|---|
|
|
Furthermore, extended investigations into the influence of infection enhancers, such as PB and PS, which are commonly used to enhance retrovirus infection in vitro (Themis et al., 1998
; Seitz et al., 1998
; Porter et al., 1998
), were performed. A significant increase of the in vitro infection potential of PERV in the presence of each of the two substances was demonstrated (Fig. 1C
). However, no obvious differences in the enhancement of infection were detected when both PB and PS were compared. For that reason, and having in mind the limited lifespan of primary cells, we decided to use 68 µg/ml PB for our infection experiments.
In vitro infection experiments
Infection experiments with primary cells and cell lines of small animals were performed. Mink lung fibroblasts (Mv1Lu) and the feline CRFK and PG4 cell lines were inoculated with PERV derived from porcine PK-15 and infected human 293 cells. Supernatants from all three cell lines were positive for RT activity. Although inoculated CRFK cells released RT, no PERV-specific provirus was found by PCR, indicating that an endogenous feline retrovirus was released. This has been reported for other feline cell lines (Lieber et al., 1973
). The infected mink Mv1Lu and feline PG4 cells expressed PERV protein, which was measured by IPA, and PERV provirus was detectable by PCR. Therefore mink Mv1Lu and feline PG4 cell lines were productively infected by PERV. Primary cells of rats and cotton rats, including preparations from embryos that contain low levels of differentiated cells which are more susceptible to retroviral infection (Argirova et al., 1973
), could not be infected (Table 1
). Although some of the rat cells released RT activity, the lack of PERV provirus indicated that endogenous retroviruses had been released. This has been shown previously for other permanent cell lines of these species (Gazzolo et al., 1971
; Kindig & Kirsten, 1967
).
|
|
In vivo infection experiments
Rats were chosen for the initial attempts to establish a practical animal model because of the reported infection of rat cell lines (Takeuchi et al., 1998
). In our first in vivo experiment, adult naive rats were inoculated i.p. with 1x108 porcine PK-15 cells, 1x108 PERV-infected human 293 cells or 5x107 mitogen-stimulated porcine PBMCs as well as with pelleted virus from PK-15 and infected 293 cell cultures, respectively. Rats remained uninfected, as shown by the absence of specific antibodies against PERVs at different time-points post-infection as well as by the absence of PERV provirus in the genomic DNA of the spleen, kidneys and lymph nodes of the animals 3 months post-inoculation (data not shown). In a second experiment (Table 2
), adult naive rats were inoculated i.m. with pelleted virus from porcine PK-15 and infected human 293 cells (groups 1 and 2). Simultaneously, rats immunosuppressed by Cs-A were inoculated i.m. and i.v. (groups 4 and 5). Frequent measurements of Cs-A indicated that levels were high enough to induce permanent immunosuppression. Due to the lack of PERV provirus and antibodies against PERV 4 weeks post-infection, rats of groups 1, 2, 4 and 5 (Table 2
) were inoculated again, this time i.p. with 5x107 porcine PK-15 or infected human 293 cells, respectively. After a further 4 weeks, all animals still remained negative for PERV-specific antibody and PERV DNA, as shown by PCR. Finally, newborn rats (groups 8 and 9) and rats treated with both Cs-A and CVF (for complement inhibition) (groups 1012) were inoculated either i.p. or i.v. with pelleted virus from either porcine PK-15 or infected human 293 cells. These rats also showed no evidence of infection. These data indicate that neither naive, immunosuppressed, immunosuppressed and simultaneously complement-inhibited adult rats nor newborn rats, with a not yet developed immune system, could be infected with PERV under the conditions used in this study.
|
| Discussion |
|---|
|
|
|---|
In comparison with PERVs derived directly from PK-15 cells, PERVs produced by human kidney cells demonstrate an enhanced infectivity for human and non-human cells, especially after repeated passaging on uninfected human 293 cells. In contrast to PERVs derived directly from PK-15 cells or to the first passage of PERV on uninfected 293 cells, later passages of the virus did not even require the presence of PB for efficient infection of their target cells in vitro (Fig. 1C
). Productive infection by these viruses was detected by RT activity measurement in both the presence and the absence of PB at nearly the same time-points.
In vitro infection of cells of a certain species does not automatically indicate that this species is susceptible in vivo. The complement system and specific and unspecific immune responses of the transplant recipient may prevent infection. However, in the case of transplants from transgenic animals carrying human complement regulatory genes designed to prevent hyperacute rejection, PERV particles produced by these transgenic pigs will not be recognized by the human complement system (Patience et al., 1997
), as has been shown for many other retroviruses (Takeuchi et al., 1994
, 1996
). The specific immune system of the transplant recipient will be inhibited by pharmacological immunosuppression, which is designed to prevent immunological rejection of the transplant. Therefore, the final outcome in the human transplant recipient will be determined by all the factors summarized here, e.g. by the susceptibility shown in vitro and the degree of protection remaining after the numerous manipulations performed to protect the transplant.
In that context, infection with PERV in SCID mouse models described recently (van der Laan et al., 2000
; Deng et al., 2000
) is of great interest for the evaluation of cross-species virus transmission and replication. In contrast to SCID mice, which completely lack a functional immune system, even heavily immunosuppressed transplant recipients will show partial immune responses. For that reason, we decided to use rats that had been immunosuppressed with Cs-A and CVF in comparison with naive rats and guinea pigs, respectively. In addition to the differences in the state of the immune system, the SCID mouse models and our animal experiments differ in species, virus subtype and inoculated virus titre. To evaluate the influence of these components we have commenced further experiments, which include analysis of a non-human primate model.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Argirova, R. M., Zakharova, L. G. & Altstein, A. D. (1973). The sensitivity of embryonal cell cultures from rats and mice of different lines: the transformation-destructive effect of mouse sarcoma virus. Voprosy Virusologii 18, 5459 (in Russian).[Medline]
Armstrong, J. A., Porterfield, J. S. & De Madrid, A. T. (1971). C-type virus particles in pig kidney cell lines. Journal of General Virology 10, 195-198.
Bouillant, A. M. P., Greig, A. S., Lieber, M. M. & Todaro, G. J. (1975). Type C virus production by a continuous line of pig oviduct cells (PFT). Journal of General Virology 27, 173-180.
Breese, S. S.Jr (1970). Virus-like particles occurring in cultures of stable pig kidney cell lines. Archiv für die Gesamte Virusforschung 30, 401-404.[Medline]
Czauderna, F., Fischer, N., Boller, K., Kurth, R. & Tönjes, R. (2000). Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. Journal of Virology 74, 4028-4038.
Deng, Y. M., Tuch, B. E. & Rawlinson, W. D. (2000). Transmission of porcine endogenous retroviruses in severe combined immunodeficient mice xenotransplanted with fetal porcine pancreatic cells. Transplantation 70, 1010-1016.[Medline]
Denner, J. (1998). Immunosuppression by retroviruses: implications for xenotransplantation. Annals of the New York Academy of Sciences 862, 75-86.
Denner, J. (1999). Immunsuppression durch Retroviren: Implikationen für die Xenotransplantation. Transplantationsmedizin 11, 223-233.
Fan, H. (1994). Retroviruses and their role in cancer. In The Retroviridae , pp. 313-362. Edited by J. A. Levy. New York:Plenum Press.
Frazier, M. E. (1985). Evidence for retrovirus in miniature swine with radiation-induced leukemia or metaplasia. Archives of Virology 83, 83-97.[Medline]
Freshney, R. I. (1987). Culture of Animal Cells. A Manual of Basic Technique. New York: John Wiley.
Gazzolo, L., Smicovic, D. & Martin-Berthelon, M. C. (1971). The presence of C-type RNA virus particles in a rat embryo cell line spontaneously transformed in tissue culture. Journal of General Virology 12, 303-311.
Hardy, W. D. (1993). Feline oncoretroviruses. In The Retroviridae , pp. 109-180. Edited by J. A. Levy. New York:Plenum Press.
Kindig, D. A. & Kirsten, W. H. (1967). Virus-like particles in established cell lines: electron microscopic observations. Science 155, 1543-1545.
Le Tissier, P. l., Stoye, J. P., Takeuchi, Y., Patience, C. & Weiss, R. A. (1997). Two sets of human-topic pig retrovirus. Nature 389, 681-682.[Medline]
Lieber, M. M., Beneviste, R. E., Livingston, D. M. & Todaro, G. J. (1973). Mammalian cells in culture frequently release type C viruses. Science 182, 56-59.
Lieber, M. M., Sherr, C. J., Benveniste, R. E. & Todaro, G. J. (1975). Biologic and immunologic properties of porcine type C viruses. Virology 66, 616-619.[Medline]
Luft, J. H. (1961). Improvements in epoxy resin embedding methods. Journal of Biophysical and Biochemical Cytology 9, 409-413.
Martin, U., Kiessig, V., Blusch, J. H., Haverich, A., von der Helm, K., Herden, T. & Steinhoff, G. (1998). Expression of pig endogenous retrovirus by primary porcine endothelial cells and infection of human cells. Lancet 352, 692-694.[Medline]
Paradis, K., Langford, G., Long, Z., Heneine, W., Sandstrom, P., Switzer, W. M., Chapman, L. E., Lockey, C., Onions, D. & Otto, E. (1999). Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285, 1236-1241.
Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282-286.[Medline]
Porter, C. D., Lukacs, K. V., Box, G., Takeuchi, Y. & Collins, M. K. (1998). Cationic liposomes enhance the rate of transduction by recombinant retroviral vector in vitro and in vivo. Journal of Virology 72, 4832-4840.
Seitz, B., Baktanian, E., Gordon, E. M., Anderson, W. F., LaBree, L. & McDonnell, P. J. (1998). Retroviral vector-mediated gene transfer into keratocytes: in vitro effects of polybrene and protamine sulfate. Graefes Archive for Clinical and Experimental Ophthalmology 23, 602-612.
Starzl, T. E., Fung, J., Tzakis, A., Todo, S., Demetris, A. J., Marino, I. R., Doyle, H., Zeevi, A., Warty, V. & Michaels, M. (1993). Baboon-to-human liver transplantation. Lancet 341, 65-71.[Medline]
Swindle, M. M. (1998). Defining appropriate health status and management programs for specific-pathogen-free swine for xenotransplantation. Annals of the New York Academy of Sciences 862, 111-120.
Tacke, S. J., Kurth, R. & Denner, J. (2000a). Porcine endogenous retroviruses inhibit human immune cell function: risk for xenotransplantation? Virology 268, 87-93.[Medline]
Tacke, S. J., Specke, V., Stephan, O., Seibold, E., Bodusch, K. & Denner, J. (2000b). Porcine endogenous retroviruses: diagnostic assays and evidence for immunosuppressive properties. Transplantation Proceedings 32, 1166.[Medline]
Takeuchi, Y., Cosset, F.-L., Lachmann, P. J., Okada, H., Weiss, R. A. & Collins, M. K. L. (1994). Type C retrovirus inactivation by human complement is determined by both the viral genome and the producer cell. Journal of Virology 68, 8001-8007.
Takeuchi, Y., Porter, C. D., Strahan, K. M., Preece, A. F., Gustafsson, K., Cosset, F.-L., Weiss, R. A. & Collins, M. K. L. (1996). Sensitization of cells and retroviruses to human serum by (
13)galactosyltransferase. Nature 379, 85-88.[Medline]
Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P. & Stoye, J. P. (1998). Host range and interference studies of three classes of pig endogenous retrovirus. Journal of Virology 72, 9986-9991.
Themis, M., Forbes, S. J., Chan, L., Cooper, R. G., Etheridge, C. J., Miller, A. D., Hodgson, H. J. & Coutelle, C. (1998). Enhanced in vitro and in vivo gene delivery using cationic agent complexed retrovirus vectors. Gene Therapy 5, 1180-1186.[Medline]
Todaro, G. J., Benveniste, R. E., Lieber, M. M. & Sherr, C. J. (1974). Characterization of a type C virus released from the porcine cell line PK(15). Virology 58, 65-74.[Medline]
van der Laan, L. J. W., Lockely, C., Griffeth, B. C., Fraiser, F. S., Wilson, C. A., Onions, D. E., Hering, J., Long, Z., Otto, E., Torbett, B. E. & Salomon, D. R. (2000). Infection by porcine endogenous retrovirus after islet xenotransplantation in SCID mice. Nature 407, 501-504.
Wilson, C. A., Wong, S., Muller, J., Davidson, C. E., Rose, T. M. & Burd, P. (1998). Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. Journal of Virology 72, 3082-3087.
Wilson, C. A., Wong, S., VanBrocklin, M. & Federspiel, J. (2000). Extended analysis of the in vitro tropism of porcine endogenous retrovirus. Journal of Virology 74, 49-56.
Received 22 June 2000;
accepted 21 December 2000.
This article has been cited by other articles:
![]() |
U. Fiebig, M. G. Hartmann, N. Bannert, R. Kurth, and J. Denner Transspecies transmission of the endogenous koala retrovirus. J. Virol., June 1, 2006; 80(11): 5651 - 5654. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Martina, K. T. Marcucci, S. Cherqui, A. Szabo, T. Drysdale, U. Srinivisan, C. A. Wilson, C. Patience, and D. R. Salomon Mice transgenic for a human porcine endogenous retrovirus receptor are susceptible to productive viral infection. J. Virol., April 1, 2006; 80(7): 3135 - 3146. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Garkavenko, M. C. Croxson, M. Irgang, A. Karlas, J. Denner, and R. B. Elliott Monitoring for Presence of Potentially Xenotic Viruses in Recipients of Pig Islet Xenotransplantation J. Clin. Microbiol., November 1, 2004; 42(11): 5353 - 5356. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lavillette and D. Kabat Porcine Endogenous Retroviruses Infect Cells Lacking Cognate Receptors by an Alternative Pathway: Implications for Retrovirus Evolution and Xenotransplantation J. Virol., August 15, 2004; 78(16): 8868 - 8877. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Scobie, S. Taylor, N. A. Logan, S. Meikle, D. Onions, C. Patience, and G. Quinn Characterization of germline porcine endogenous retroviruses from Large White pig J. Gen. Virol., August 1, 2004; 85(8): 2421 - 2428. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Xiao, J.-Y. Min, and J. P. Morgan Immunosuppression and xenotransplantation of cells for cardiac repair Ann. Thorac. Surg., February 1, 2004; 77(2): 737 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Argaw, W. Colon-Moran, and C. A. Wilson Limited infection without evidence of replication by porcine endogenous retrovirus in guinea pigs J. Gen. Virol., January 1, 2004; 85(1): 15 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Ericsson, Y. Takeuchi, C. Templin, G. Quinn, S. F. Farhadian, J. C. Wood, B. A. Oldmixon, K. M. Suling, J. K. Ishii, Y. Kitagawa, et al. Identification of receptors for pig endogenous retrovirus PNAS, May 27, 2003; 100(11): 6759 - 6764. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ritzhaupt, L. J. W. van der Laan, D. R. Salomon, and C. A. Wilson Porcine Endogenous Retrovirus Infects but Does Not Replicate in Nonhuman Primate Primary Cells and Cell Lines J. Virol., October 11, 2002; 76(22): 11312 - 11320. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |