|
|
||||||||
Plant |
One Shields Ave, Plant Pathology Dept, University of California, CA 95616 Davis, USA1
Faculty of Agricultural and Food Sciences, American University of Beirut, Lebanon2
Author for correspondence: Bryce Falk. Fax +1 5307525674. e-mail bwfalk{at}ucdavis.edu
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
We studied the genetic variation of the plant virus Cucurbit yellow stunting disorder virus (CYSDV), a member of the genus Crinivirus within the family Closteroviridae (Martelli et al., 2000
). CYSDV has a bipartite single-strand plus-sense RNA genome encapsidated in long filamentous and flexuous particles. CYSDV infections are phloem-limited and the virus is transmitted in a semipersistent manner by the whiteflies Bemisia tabaci (Gennadius) and B. argentifolii (Bellows & Perring) (Célix et al., 1996
; Martelli et al., 2000
). CYSDV was first identified in the United Arab Emirates in the early 1990s (Hassan & Duffus, 1991
) and since then it has been reported in other Middle East countries and in the Mediterranean basin, where it is recognized as a rapidly emerging and economically important plant virus (Célix et al., 1996
; Wisler et al., 1998
; Rubio et al., 1999
; Abou-Jawdah et al., 2000
). Just recently, CYSDV has been reported from North America (Kao et al., 2000
).
We used single-strand conformation polymorphism (SSCP) and nucleotide sequence analyses of the CYSDV coat protein (CP) gene to estimate the population structure and genetic variation within individual CYSDV isolates, and between CYSDV isolates collected in different years from different areas of the world. Also, we estimated the genetic variation of a region of the CYSDV HSP70 homologue gene (HSP70) from data obtained in a previous report (Rubio et al., 1999
) and from new data obtained after analysing additional CYSDV isolates.
Seventy-one CYSDV isolates were collected from cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; watermelon, Citrullus lanatus Schard; and melon, Cucumis melo L.) from different curcubit-growing regions included in the Mediterranean basin, Middle East and North America (Table 1
). Total RNAs were extracted from curcubit leaf tissue by using Tri Reagent (Molecular Research Center) according to manufacturers instructions, and were used as the template for RTPCR. Specific oligonucleotide primers CYSCPf (5' ATGGCGAGTTCGAGTGAGAATAA 3') and CYSCPr (5' ATTACCACAGCCACCTGGTGCTA 3') corresponding to both ends of the CYSDV CP gene were designed based on the nucleotide sequence published by Livieratos et al. (1999)
. RT was performed in a reaction mixture (20 µl) of 1xAMV buffer, 200 µM of each dNTP, 40 ng of CYSCPr primer, 2 units of Rnasin Ribonuclease Inhibitor (Promega), 0·3 units of AMV reverse transcriptase (Promega). The mixture was incubated at 42 °C for 45 min. PCR was performed in a 20 µl reaction containing 2 µl of the synthesized cDNA, 2 µl 10xbuffer, 5 units Pfu (Stratagene), 1 ng/µl of each primer. The mixture was incubated first at 94 °C for 4 min, followed by 30 cycles at 94 °C for 30 s, 50 °C, 72 °C for 2 min, and by a final cycle at 72 °C for 5 min. When the RTPCR products were electrophoresed in agarose gels, a unique DNA species of 755 nt, the expected size, was detected for each CYSDV isolate. No DNA was obtained from non-CYSDV-infected plants (data not shown).
|
|
The low genetic diversity found in the Western group, distributed in such an extensive area (Europe, Middle East and North America) is surprising for an RNA virus. One possible cause of this low diversity could be the rapid expansion of CYSDV, possibly related with the recent colonization and explosion of the CYSDV whitefly vectors into new areas (Brown et al., 1995
). For example, in Spain the displacement of another Crinivirus affecting cucurbits, Beet pseudo-yellows virus (BPYV), by CYSDV has been associated with the displacement of the BPYV vector, Trialeurodes vaporariorum, by the CYSDV vector, B. tabaci (Célix et al., 1996
; Berdiales et al., 1999
). However, the low genetic variation found here was not only for CYSDV isolates geographically distant, but also for CYSDV isolates separated temporally over a 3 year period (Table 1
). Negative selection due to functional constraints of virus-encoded proteins can limit the extent of genetic variation in virus populations. Therefore, we estimated the degree and sense of selection by calculating the ratio of nucleotide diversity at nonsynonymous (dN) to synonymous sites (dS) (as described by Pamilo & Bianchi, 1993
; Li, 1993
) of the HSP70 and CP coding regions between CYSDV Western and Eastern subpopulations. The dN/dS ratio was 0·07048 for CP and 0·10452 for HSP70, suggesting that both coding regions are under high negative selective constraints. However, this cannot explain the low variation at the synonymous positions found between isolates within the Western subpopulation. Other constraints, such as those imposed by secondary structure or expression recognition signals might have also limited the genetic variation (Roossinck, 1997
). A model of periodic selection, proposed by Moya et al. (1993)
, consisting of negative selection alternating with rapid expansion of a genome with high fitness (positive selection), could account for the genetic stability observed for CYSDV.
Spatial and temporal genetic stability have also been reported for the tobamoviruses Pepper mild mottle virus (Rodríguez-Cerezo et al., 1989
) and Tobacco mild green mosaic virus (Fraile et al., 1996
). Within the genus Crinivirus, data concerning the genetic variation are scarce and fragmented. Analysis of partial HSP70 homologue sequences of eight BPYV isolates from Italy, Crete and California showed very low genetic diversity (Rubio et al., 1999
; Fig. 2
). Although a larger number of isolates should be analysed for a more accurate estimation of BPYV genetic diversity, we can conclude that with respect to the genomic region analysed, geographically distant BPYV isolates are genetically very similar. Analysis of eight Ugandan isolates of another Crinivirus, Sweet potato chlorotic stunt virus (SPCSV; Alicai et al., 1999
), showed a small genetic diversity for HSP70 and CP genes (Fig. 2
). In contrast, a partial CP gene sequence of 20 Californian isolates of Citrus tristeza virus (CTV), a member of the genus Closterovirus (the other genus within the family Closteroviridae), showed a significantly greater genetic diversity (Fig. 2
) despite the low dN/dS ratio observed (0·02739), suggesting high negative selection pressure (unpublished data). The different genetic variation for CTV and CYSDV might be caused in part by differences in factors such as host plants and/or modes of transmission. CTV has perennial host plants that can be infected for years whereas CYSDV hosts are annual and infections are generally less than 60 days old. CYSDV is transmitted only by its whitefly vector, whereas CTV is also transmitted by vegetative propagation, a means which could remove selective constraints related to insect transmission.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Alicai, T., Fenby, N. S., Gibson, R. W., Adipala, E., Vetten, H. J., Foster, G. D. & Seal, S. E. (1999). Occurrence of two serotypes of sweet potato chlorotic stunt virus in East Africa and their associated differences in coat protein and HSP70 homologue gene sequences. Plant Pathology 48, 718-726.
Berdiales, B., Bernal, J. J., Sáez, E., Woudt, B. & Rodríguez-Cerezo, E. (1999). Occurrence of cucurbit yellow stunting disorder virus (CYSDV) and beet pseudo-yellows virus in cucurbit crops in Spain and transmission of CYSDV by two biotypes of Bemisia tabaci. European Journal of Plant Pathology 105, 211-215.
Brown, J. K., Frohlich, D. R. & Rosell, R. C. (1995). The sweet potato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annual Review of Entomology 40, 511-534.
Célix, A., López-Sesé, A., Almarza, N., Gómez-Guillamón, M. L. & Rodríguez-Cerezo, E. (1996). Characterization of cucurbit yellow stunting disorder virus, a Bemisia tabaci-transmitted closterovirus. Phytopathology 86, 1370-1376.
Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness for survival. Annual Review of Microbiology 51, 151-178.[Medline]
Enomoto, N., Kurosaki, M., Tanaka, Y., Marumo, F. & Sato, C. (1994). Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis. Journal of General Virology 75, 1361-1369.
Felsenstein, J. (1989). PHYLIP: Phylogenetic Inference Package (version 3.2). Cladistics 5, 164-166.
Fraile, A., Malpica, J. M., Aranda, M. A., Rodríguez-Cerezo, E. & García-Arenal, F. (1996). Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 223, 148-155.[Medline]
Hassan, A. A. & Duffus, J. E. (1991). A review of a yellowing and stunting disorder in the United Arab Emirates. Emirates Journal of Agricultural Sciences 2, 1-16.
Holland, J. & Domingo, E. (1998). Origin and evolution of viruses. Virus Genes 16, 13-21.[Medline]
Holland, J. J., Spindler, K., Horodyski, F., Grabau, E., Nichol, S. & VandePol, S. (1982). Rapid evolution of RNA genomes. Science 215, 1577-1582.
Kao, J., Jia, L., Tian, T., Rubio, L. & Falk, B. W. (2000). First report of Cucurbit yellow stunting disorder virus (Genus Crinivirus) in North America. Plant Disease 84, 101.
Kong, P., Rubio, L., Polek, M. & Falk, B. W. (2000). Population structure and genetic diversity of California citrus tristeza virus (CTV) field isolates. Virus Genes 21, 139-145.[Medline]
Li, W.-H. (1993). Unbiased estimation of the rates of synonymous and nonsynonymous substitutions. Journal of Molecular Evolution 36, 96-99.[Medline]
Livieratos, I. C., Avgelis, A. D. & Coutts, R. H. A. (1999). Molecular characterization of the cucurbit yellow stunting disorder virus coat protein gene. Phytopathology 89, 1050-1055.[Medline]
Lynch, M. & Crease, T. J. (1990). The analysis of population survey data on DNA sequence variation. Molecular Biology and Evolution 7, 377-394.[Abstract]
Martelli, G. P., Agranovsky, A. A., Bar-Joseph, M., Boscia, D., Candresse, T., Coutts, R. H. A., Dolja, V. V., Duffus, J. E., Falk, B. W., Gonsalves, D., Jelkmann, W., Karasev, A. V., Minafra, A., Murant, A., Namba, S., Niblett, C. L., Vetten, H. J. & Yoshikawa, N. (2000). Family Closteroviridae. In Seventh Report of the International Committee on Taxonomy of Viruses , pp. 943-952. Edited by M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. New York & San Diego: Academic Press.
Moya, A., Rodríguez-Cerezo, E. & García-Arenal, F. (1993). Genetic structure of natural populations of the plant RNA virus tobacco mild green mosaic virus. Molecular Biology and Evolution 10, 449-456.
Orita, M., Suzuki, Y., Sekiya, T. & Hayashi, K. (1989). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874-879.[Medline]
Pamilo, P. & Bianchi, N. O. (1993). Evolution of the Zfx and Zfy genes: rates and interdependence between the genes. Molecular Biology and Evolution 10, 271-281.[Abstract]
Rodríguez-Cerezo, E., Moya, A. & García-Arenal, F. (1989). Variability and evolution of the plant RNA virus pepper mild mottle virus. Journal of Virology 63, 2198-2203.
Roossinck, M. J. (1997). Mechanisms of plant virus evolution. Annual Review of Phytopathology 35, 1953-1965.
Rubio, L., Ayllón, M. A., Guerri, J., Pappu, H., Niblett, C. & Moreno, P. (1996). Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of the coat protein gene. Annals of Applied Biology 129, 479-489.
Rubio, L., Soong, J., Kao, J. & Falk, B. W. (1999). Geographic distribution and molecular variation of isolates of three whitefly-borne closteroviruses of cucurbits: lettuce infectious yellows virus, cucurbit yellow stunting disorder virus, and beet pseudo-yellows virus. Phytopathology 89, 707-711.[Medline]
Rubio, L., Guerri, J. & Moreno, P. (2000). Characterization of citrus tristeza virus isolates by single strand conformation polymorphism analysis of DNA complementary to their RNA population. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists. Edited by R. H. Yokomi, J. V. da Graca & R. F. Lee. Riverside, California: IOCV (in press).
Schneider, W. L. & Roossinck, M. J. (2000). Evolutionary related Sindbis-like plant viruses maintain different levels of population diversity in a common host. Journal of Virology 74, 3130-3134.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Wisler, G. C., Duffus, J. E., Liu, H. Y. & Li, R. H. (1998). Ecology and epidemiology of whitefly-transmitted Closteroviruses. Plant Disease 82, 270-280.
Received 13 November 2000;
accepted 15 December 2000.
This article has been cited by other articles:
![]() |
S. O. Park, J. R. Steadman, D. P. Coyne, and K. M. Crosby Development of a Coupling-Phase SCAR Marker Linked to the Ur-7 Rust Resistance Gene and Its Occurrence in Diverse Common Bean Lines Crop Sci., January 16, 2008; 48(1): 357 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hall Selective constraint and genetic differentiation in geographically distant barley yellow dwarf virus populations. J. Gen. Virol., October 1, 2006; 87(Pt 10): 3067 - 3075. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Marco and M. A. Aranda Genetic diversity of a natural population of Cucurbit yellow stunting disorder virus J. Gen. Virol., March 1, 2005; 86(3): 815 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Park, D. P. Coyne, J. R. Steadman, K. M. Crosby, and M. A. Brick RAPD and SCAR Markers Linked to the Ur-6 Andean Gene Controlling Specific Rust Resistance in Common Bean Crop Sci., September 1, 2004; 44(5): 1799 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Aguilar, M. Franco, C. F. Marco, B. Berdiales, E. Rodriguez-Cerezo, V. Truniger, and M. A. Aranda Further variability within the genus Crinivirus, as revealed by determination of the complete RNA genome sequence of Cucurbit yellow stunting disorder virus J. Gen. Virol., September 1, 2003; 84(9): 2555 - 2564. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-X. Lin, L. Rubio, A. Smythe, M. Jiminez, and B. W. Falk Genetic diversity and biological variation among California isolates of Cucumber mosaic virus J. Gen. Virol., January 1, 2003; 84(1): 249 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Vives, L. Rubio, L. Galipienso, L. Navarro, P. Moreno, and J. Guerri Low genetic variation between isolates of Citrus leaf blotch virus from different host species and of different geographical origins J. Gen. Virol., October 1, 2002; 83(10): 2587 - 2591. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rubio, M. A. Ayllon, P. Kong, A. Fernandez, M. Polek, J. Guerri, P. Moreno, and B. W. Falk Genetic Variation of Citrus Tristeza Virus Isolates from California and Spain: Evidence for Mixed Infections and Recombination J. Virol., September 1, 2001; 75(17): 8054 - 8062. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |