J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, X.-G.
Right arrow Articles by Hamilton-Dutoit, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X.-G.
Right arrow Articles by Hamilton-Dutoit, S. J.
Agricola
Right arrow Articles by Zhou, X.-G.
Right arrow Articles by Hamilton-Dutoit, S. J.
Journal of General Virology (2001), 82, 1157-1167.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Epstein–Barr virus gene polymorphisms in Chinese Hodgkin’s disease cases and healthy donors: identification of three distinct virus variants

X.-G. Zhou1,2,3, K. Sandvej1, P.-J. Li4, X.-L. Ji5, Q.-H. Yan6, X.-P. Zhang7, J.-P. Da8 and S. J. Hamilton-Dutoit1

Institute of Pathology, Aarhus Kommunehospital, Noerrebrogade 44, DK-8000 Aarhus C, Denmark1
Research Unit of Molecular Medicine, Aarhus University Hospital and Faculty of Health Sciences, Aarhus, Denmark2
Departments of Pathology of Beijing Hospital3, Beijing Children’s Hospital4, Beijing 301 Hospital5, Beijing Railway General Hospital6, Wunancabumong District Hospital7 and Beijing Air Army General Hospital8, People’s Republic of China

Author for correspondence: Xiao-Ge Zhou (at Institute of Pathology). Fax +45 89 49 3570. e-mail zhouxg{at}hotmail.com


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr virus (EBV) is associated with several malignancies. Specific EBV gene variants, e.g. the BamHI f configuration, a C-terminal region 30 bp deletion in the latent membrane protein-1 (LMP1) gene (del-LMP) and the loss of an XhoI site in LMP1 (XhoI-loss), are found in Chinese cases of nasopharyngeal carcinoma (NPC), suggesting that EBV sequence variation may be involved in oncogenesis. In order to understand better the epidemiology of these EBV variants, they were studied in virus isolates from EBV-positive Chinese cases of Hodgkin’s disease (HD; n=71) and donor throat washings from healthy Chinese. Sequencing was performed of 15 representative EBV isolates, including the first analysis of the LMP1 promoter in Asian wild-type EBV isolates. The following observations were made. (i) Three EBV LMP1 variants were identified, designated Chinese groups (CG) 1–3. In both EBV-associated HD and in healthy Chinese, CG1-like viruses showing del-LMP1 and XhoI-loss were predominant. (ii) CG1viruses were distinct from European and African variants, suggesting that this profile is useful for epidemiological studies. (iii) Specific patterns of mutations were present in the LMP1 promoter in both CG1 and CG2. (iv) The BamHI f variant was not found in Chinese HD, in contrast to Chinese NPC and European HD. This study confirms that EBV isolates in Chinese HD and other tumours differ from those reported in Western cases. However, this reflects the predominant virus strain present in the healthy Chinese population, suggesting that these are geographically restricted polymorphisms rather than tumour-specific strains.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Epstein–Barr virus (EBV), the aetiological agent of infectious mononucleosis, is also an important human oncogenic virus, being implicated in the pathogenesis of several neoplasms including Burkitt’s lymphoma, nasopharyngeal carcinoma (NPC), immunodeficiency-associated lymphomas, peripheral T-cell lymphomas (PTLs) and Hodgkin’s disease (HD) (Anagnostopoulos & Hummel, 1996Down ).

Although EBV is ubiquitous in healthy populations throughout the world, the incidence of different EBV-associated tumours shows considerable geographical variation. One possible explanation for this may be the existence of oncogenic EBV strains that cause specific tumours in genetically susceptible populations. However, attempts to identify such viruses have met with little success, several studies suggesting that virus strains are geographically, not disease, restricted (Lin et al., 1995Down ; Khanim et al., 1996Down ; Sandvej et al., 1997Down ; Hayashi et al., 1997Down ). Some viruses appear particularly prevalent in Asia, including the type C strain, which lacks a BamHI site between BamHI W1 and I1, and a proposed substrain (f variant) carrying a deletion in BamHI F (Lung et al., 1990Down , 1991Down ). The f variant appears to be more frequent in NPC patients in southern China than in healthy Chinese individuals (Lung et al., 1990Down , 1991Down ), suggesting that this variant may be tumour-associated.

Recently, it has been proposed that sequence variations in the key EBV latent membrane protein-1 (LMP1) gene may be associated with disease. LMP1 is thought to play a central role in EBV-induced cell transformation and shows oncogenic activity in vitro. LMP1 transforms B lymphocytes and rodent fibroblasts (Fhraeus et al., 1993Down ; Wang et al., 1985Down ), induces cellular activation, DNA synthesis, hyperplasia and aberrant keratin expression in the skin of transgenic mice (Peng & Lundgren, 1992Down ; Wilson et al., 1990Down ), upregulates bcl-2 and adhesion molecule expression (Rowe et al., 1994Down ; Peng & Lundgren, 1993Down ) and inhibits human epithelial cell differentiation (Dawson et al., 1990Down ).

The nude mouse-passaged Chinese NPC EBV isolate CAO shows structural variations in the LMP1 gene compared with the EBV prototype B95.8 including: (i) several base substitutions in the promoter region and the coding sequence, (ii) 30 bp (del-LMP1) and 15 bp deletions and the insertion of three additional 33 bp repeats in the C terminus and (iii) the loss of an XhoI restriction site (XhoI-loss) resulting from a G->T mutation at position 169425 (Hu et al., 1991Down ). Similar LMP1 sequence variations have been reported in another NPC EBV strain, C1510 (Chen et al., 1992Down ). Both CAO and C1510 are more tumorigenic in SCID and nude mice than B95.8 (Hu et al., 1993Down ; Chen et al., 1992Down ). Furthermore, transfection studies in BALB/3T3 cells showed that B95.8 was rendered tumorigenic following deletion of the 30 bp sequence from the LMP1 gene, whilst insertion of this sequence into the LMP1 gene of C1510 abolished tumorigenicity (Li et al., 1996Down ). Variants showing XhoI-loss are found in 97–100% of Chinese NPC and in throat washings (TWs) from 30–40% of healthy Chinese, a significant difference (Hu et al., 1991Down ; Chen et al., 1992Down ; Jeng et al., 1994Down ).

In analyses of EBV-associated tumours, del-LMP1 has been found in about 10–30% of European HD cases, 80% of Mexican HD cases and 83–100% of human immunodeficiency virus-related HD cases, in 100% of Malaysian PTLs, 60% of Danish PTLs and 86% of Chinese PTLs (Knecht et al., 1993Down ; Sandvej et al., 1994Down ; Santon et al., 1995Down ; Dolcetti et al., 1997Down ; Dirnhofer et al., 1999Down ; Chang et al., 1995Down ), in 20% of Burkitt’s lymphoma cases and in 71% of aggressive non-Hodgkin’s lymphomas (Kingma et al., 1996Down ). In contrast, del-LMP1 variants have also been found in reactive conditions (Sandvej et al., 1994Down ; Kingma et al., 1996Down ; Chen et al., 1996bDown ; Leung et al., 1997Down ; Dirnhofer et al., 1999Down ) and healthy donors (Chen et al., 1992Down ; Khanim et al., 1996Down ; Dolcetti et al., 1997Down ; Sandvej et al., 1997Down ; Chiang et al., 1999Down ). Recently, we described four main groups of wild-type LMP1 isolates in a European population, including the del-LMP1 variant (Sandvej et al., 1997Down ). Khanim et al. (1996)Down found no increased incidence of del-LMP1 virus isolates in HD, Burkitt’s lymphomas or virus-associated carcinomas compared with appropriate normal populations from the same geographical regions. However, Chiang et al. (1999)Down reported a marked predominance of del-LMP1 compared with wild-type LMP1 (wt-LMP1) variants in nasal T/natural killer (NK)-cell lymphoma (TNKL) and found wt-LMP1 to be significantly more frequent in normal tissue than in tumour tissues. Sung et al. (1998)Down isolated three LMP1 variants from Chinese NPC. Two of these (China1 and China2) were specific to Chinese NPC. China1 resembles the CAO variant, the predominant strain in Chinese NPC. China2 is characterized by five nucleotide changes in the LMP1 N terminus in addition to those seen in China1, and by a different pattern of mutation in the C terminus, with retention of the 30 bp region (168290–168261). The third variant resembles prototype B95.8. China1 was associated with EBV subtype 1. Cheung et al. (1998)Down reported two Chinese EBV strains with either deletion or retention of the 30 bp region in LMP1. The deleted (DV) and retention (RV) variants resembled China1 and China2, respectively. RV was correlated with EBV subtype 2.

The rather contradictory results from these reports indicate the need for epidemiological studies that map geographical variation in the frequency of del-LMP1 and other virus polymorphisms in isolates from EBV-associated tumours. While EBV isolates have been studied from Chinese NPCs and PTLs, both of which are relatively common malignancies in this region, little information is available concerning Chinese HD. The latter is a rather rare tumour in China, and this may make it easier to identify an eventual tumour-specific virus strain compared with the background population. In the present study, we looked for del-LMP1, XhoI-loss and BamHI f variants in isolates from 71 EBV-positive HD cases from mainland Chinese patients and from control TWs from healthy Chinese. The sequences of the LMP1 promoter region and the N and C termini were analysed in selected cases.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cases.
Paraffin blocks were available from 71 EBV-positive Chinese HD cases with amplifiable DNA. The presence of EBV was demonstrated by LMP1 immunohistochemistry and EBER-1 in situ hybridization (data not shown). For comparison, we studied 21 TWs from healthy Chinese, six Chinese NPCs, two Chinese TNKLs and one Chinese HD case with EBV-negative Hodgkin and Reed–Sternberg (HRS) cells and EBV-positive reactive lymphocytes.

{blacksquare} DNA extraction.
DNA was extracted from paraffin blocks as described previously (Sandvej et al., 1994Down ). Briefly, tissue sections were deparaffinized and digested at 55 °C for 48 h with 0·28 mg/ml proteinase K in 250 ml digestion buffer (50 mM Tris–HCl, 1 mM EDTA and 0·5% Tween 20, pH 8·5). Proteinase K was inactivated at 95 °C for 20 min. The supernatant was used as the template for PCR amplification.

In order to obtain TWs, 10 ml Tris buffer was gargled. TW samples were centrifuged at 2000 r.p.m. for 20 min in graduated conical tubes (Falcon, Becton Dickinson) and the precipitate was digested with proteinase K, as described above.

{blacksquare} PCR procedure.
Amplification of EBNA-2 and EBNA-3C was done as described previously (Sandvej et al., 1994Down ). The region spanning the 30 bp del-LMP1 was amplified with primers LMP30bp3 (5' CGTCATCATCTCCACCGGAACCAGAAG 3') and LMP30bp5 (5' CGGAAGAGGTTGCAAACAAAGGAGGTG 3'). The reaction mixture contained 0·2 mM of each dNTP, 5 µl template, 25 pmol of each primer, 1 U Taq polymerase (Perkin-Elmer), 2·5 mM MgCl2, 5 µl 10x PCR buffer II (Perkin-Elmer) and distilled water to a total volume of 50 µl. Hot-start PCR was performed, comprising 12 cycles of 93 °C for 1 min, 63 °C for 1 min and 72 °C for 2 min and 25 cycles of 93 °C for 1 min, 60 °C for 50 s and 72 °C for 90 s, with a final additional extension at 72 °C for 10 min.

PCR analysis of XhoI restriction site polymorphism (Sandvej et al., 1997Down ), BamHI F region configuration (Khanim et al., 1996Down ) and EBV subtypes 1 and 2 was performed as described previously (Sandvej et al., 1994Down , 1997Down ). PCR products were electrophoresed in Visigel separation matrix (Stratagene) and visualized with ethidium bromide.

{blacksquare} Digestion with XhoI and BamHI.
Amplification of DNA fragments covering the XhoI site (113 bp) and BamHI F region (222 bp) was confirmed by electrophoresis in 6% Visigel. Aliquots of 10 µl PCR product were digested with 20 U XhoI (Pharmacia Biotech) or 20 U BamHI (Boehringer Mannheim) at 37 °C for 9 h. The presence of the restriction sites resulted in two bands of 46 and 67 bp (XhoI) or 97 bp and 125 bp (BamHI).

{blacksquare} Sequencing of the LMP1 gene.
Bidirectional solid-phase sequencing of the promoter region and the N and C termini of the LMP1 gene was performed by using the ABI Prism dRhodamine terminator cycle sequencing ready reaction kit (Perkin-Elmer Applied Biosystems). The following primer pairs were used: lmp9718 (5' GGACTCGCTTTTCTAACACAAACACACGC 3')/lmp9529 (5' GCAGTTGAGGAAAGAAGGGGGCAGAGCAG 3'), lmp9602 (5' CAAATCCCCCCGGGCCTACATC 3')/lmp9377 (5' AGGAGGAGAAGGAGAGCAAGGCCTAGG 3'), lmp9442 (5' CCCGCGACGGCCCCCTCGAG 3')/lmp9230 (5' CCTCCAAGTGGACAGAGAAGGTCTCTTCTG 3') and lmp9 (5' AGCGACTCTGCTGGAAATGAT 3')/lmp30bp3 (5' CGTCATCATCTCCACCGGAACCAGAAG 3'). Cycle sequencing was performed according to the manufacturer’s instructions. Briefly, PCR products (2 µl) were mixed with either the forward or reverse PCR primer (5 pmol, 1 µl), 2·5x buffer (4 µl), terminator ready reaction mix (4 µl) and distilled water (9 µl) to analyse the sense and anti-sense strand. The extension procedure comprised 25 cycles of 96 °C for 30 s, 50 °C for 15 s and 60 °C for 4 min. To remove excess dye terminators, the extension reaction was mixed with 2 µl 3 M sodium acetate (pH 4·6) and 50 µl 95% ethanol and spun at 14000 r.p.m. for 20 min. The pellet was washed with 250 µl 70% ethanol. After centrifugation and aspiration, the pellet was dried and mixed with 4·5 µl loading buffer. The samples were then run on a 6% polyacrylamide gel and analysed using an ABI Prism 373 A DNA sequencer with the Collection software.

{blacksquare} Controls.
Cell lines AG876 and B95.8 were used as positive and negative controls, respectively, for del-LMP1 (Sandvej et al., 1994Down ). Lymphoblastoid cell lines investigated previously for the presence or absence of the XhoI restriction site were used as controls for XhoI-loss (Sandvej et al., 1997Down ). Cases of Chinese NPC analysed previously for configuration of the BamHI F region were used as controls for the BamHI F and f variants. Negative PCR controls were prepared as published previously (Sandvej et al., 1994Down ).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Analysis of Chinese HD and TWs from healthy Chinese is summarized in Table 1Down. Sequencing results are shown in Tables 2–3 and Fig. 5Down.


View this table:
[in this window]
[in a new window]
 
Table 1. EBV gene polymorphisms in isolates from Chinese HD and TWs from healthy Chinese donors

 

View this table:
[in this window]
[in a new window]
 
Table 2. Sequence variation in the LMP1 N terminus of isolates from selected Chinese tumours and from TWs from healthy Chinese

 

View this table:
[in this window]
[in a new window]
 
Table 3. Sequence variation in the LMP1 C terminus in isolates from selected Chinese tumours and from TWs from healthy Chinese

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5. Sequence variation in the LMP1 promoter region in isolates from selected Chinese tumours and from the TWs from healthy Chinese compared with prototype EBV sequences. Only nucleotide changes compared with prototype B95.8 EBV are shown; dots indicate conserved residues relative to the B95.8 sequence. HD#72 is an HD control case with EBV-negative HRS cells and EBV-positive reactive lymphocytes. Previously published sequences were taken from Fennewald et al. (1984)Down (B95.8), Sandvej et al. (1997)Down (Group D) and Hu et al. (1991)Down (CAO).

 
EBV subtype
EBV was detected in 14/21 TWs (67%) from healthy Chinese; 13/14 (93%) could be subtyped, with subtype 1 in 11/13 (85%) and subtype 2 in 2/13 (15%) samples. In 71 informative cases of EBV-positive Chinese HD, EBV subtypes 1 and 2 were demonstrated in 65/71 (92%) and 6/71 (8%) isolates, respectively (Table 1Up; Fig. 1Down).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. PCR analysis for EBV typing at the EBNA-3C locus. EBV subtypes 1 and 2 are identified by specific 153 and 246 bp fragments. Lane 1 contains molecular mass markers (sizes in bp). Lanes 2, 3, 4, 6 and 7 are representative cases of HD (HD#2, 8, 17, 56 and 57, respectively). Lanes 5 and 8 are representative samples of TWs (TW8 and 13, respectively) from healthy donors. Lanes 9, 10 and 11 are positive controls for EBV subtype 2 and subtype 1 and a negative control, respectively.

 
LMP1 30 bp deletion
The region covering del-LMP1 was amplified successfully from 64/71 HD cases (90%). del-LMP1 was found in 53/64 cases (83%); 11/64 cases (17%) contained prototypic (B95.8-like) wt-LMP1 EBV sequences (Table 1Up; Fig. 2Down). The presence of del-LMP1 or wt-LMP1 was confirmed by sequencing in eight and four cases, respectively (see Table 3Up). EBV could be amplified from 14/21 TWs (67%); 12/14 (86%) harboured del-LMP1, one (TW13) carried EBV (subtype 2) with a 15 bp LMP1 deletion, which was confirmed by sequencing (Tables 1Up and 3Up), and the final sample contained wt-LMP1 (Fig. 2Down).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2. PCR analysis for the LMP1 gene 30 bp deletion in isolates from representative cases of HD and TWs. The specific 153 and 123 bp fragments are respectively consistent with the wt-LMP1 and del-LMP1 gene configurations. Lane 1, molecular mass markers (sizes in bp). Lanes 2 and 3 are non-deleted and deleted controls from B95.8 and AG876 cell lines. Lane 4 is the negative control. Lanes 5, 6, 8 and 9 are representative cases of HD (HD#56, 58, 24 and 25, respectively). Lanes 7 and 10 are TW samples (TW14 and 1, respectively) from healthy donors.

 
XhoI RFLP
Results of XhoI RFLP analysis are shown in Table 1Up and Fig. 3Down. Amplification of the XhoI region was successful in 66/71 HD isolates (93%). XhoI-loss was shown in 59/66 cases (89%); seven isolates (11%) carried the wild-type XhoI site (wt-XhoI). Thirteen of 21 TWs (62%) could be amplified for XhoI analysis; 12/13 (92%) showed XhoI-loss.



View larger version (51K):
[in this window]
[in a new window]
 
Fig. 3. PCR products from amplification of the LMP1 XhoI restriction site region were digested with XhoI and separated by Visigel electrophoresis. The presence of shorter, 67 bp band indicates an intact XhoI site. The 113 bp band indicates that the XhoI site has been lost. Lane 1, molecular mass markers (sizes in bp). Lanes 2, 3, 5, 6 and 7 are representative cases of HD (HD#54, 56, 58, 3 and 2, respectively). Lane 4 and 8 are TW samples (TW13 and 6, respectively). Lanes 9 and 10 are controls for XhoI-loss and wt-XhoI, respectively.

 
BamHI F RFLP
Results of BamHI F RFLP analysis are shown in Table 1Up and Fig. 4Down. Amplification of the BamHI F region was successful in 13/71 HD cases (18%) and 11/21 (52%) TWs. All showed a B95.8-like wild-type F configuration. A single HD control case, with EBV-negative HRS cells and EBV-positive reactive lymphocytes, harboured the f variant.



View larger version (84K):
[in this window]
[in a new window]
 
Fig. 4. PCR products from amplification of the LMP1 BamHI region were digested with BamHI and separated by Visigel electrophoresis. The digestion results in two short bands, of 97 and 125 bp, indicating the presence of an extra BamHI site (f variant). The undigested band of 222 bp indicates the absence of this BamHI site (F variant). Lane 1, molecular mass markers (sizes in bp). Lanes 2, 3 and 6 are representative cases of HD (HD#4, 2 and 72, respectively; HD#72 is a HD control case, with EBV-negative HRS cells and EBV-positive reactive lymphocytes). Lane 5 is a TW sample (TW1). Lanes 4 and 7 are respectively controls for the F and f variants.

 
Grouping of EBV LMP1 variants
In order to compare NPC-specific strains reported previously with our isolates, we sequenced the LMP1 promoter region and the N and C termini of the LMP1 gene in selected cases that showed either del-LMP1/XhoI-loss, wt-LMP1/XhoI-loss or wt-LMP1/wt-XhoI. Three distinct sequence variations, designated Chinese groups (CG) 1–3, were identified (see Tables 2–3UpUp and Fig. 5Up).

Sequence variation in the LMP1 N terminus
Isolates from 14 HD cases, two TWs and five NPC (for comparison) were sequenced at the LMP1 N terminus. CG1 sequences were found in most isolates (eight HD, one TW and three NPC). These showed 13 common nucleotide changes compared with B95.8, all identical to those described in Chinese NPC strains such as C1510 (Chen et al., 1992Down ), China1 (Sung et al., 1998Down ) and DV (Cheung et al., 1998Down ) (Table 2Up). All isolates showed XhoI-loss due to a G->T substitution at codon 17. In 3/14 cases (HD#5, HD#8 and HD#9), there were additional changes, at codons 64 (T->G), 36 (A->C) and 27 (T->G), respectively.

CG2 sequences were found in 2/14 HD and 2/5 NPC isolates. One (HD#53) had a sequence similar to that of China2 (Sung et al., 1998Down ). The informative changes involved 15 nucleotides, all of which were seen in China2. One isolate (HD#72) showed 18 nucleotide changes compared with B95.8, of which 17 and 16 changes were respectively identical to those found in RV(Cheung et al., 1998Down ) and China2. One additional change, C->G at codon 12, was present in this isolate, whilst a change at codon 41 in China2 was absent. HD#72 is a control case showing EBV in reactive lymphocytes but not in HRS cells, thus representing EBV in non-malignant cells. NPC#3 showed the same 16 nucleotide changes reported in the RV strain. Of these, 15 were identical to those found in China2. One change, at codon 60, was different in this case (C->A) compared with China2 (C->G). The change C->T at codon 41 seen in China2 was absent. Finally, NPC#6 harboured 17 nucleotide changes, 16 being identical to those found in China2. One additional change was present at codon 61 (G->C). In addition, G->A at codon 43 seen in China2 was absent.

Isolates from HD#56, HD#58 and TW13 were identical to B95.8 at the N terminus, apart from two changes (A->C at codons 63 and 65) in HD#56. These isolates were grouped separately as CG3.

In addition, two isolates (HD#49 and HD#51) showed XhoI-loss, but this was unexpectedly not due to the usual G->T at codon 17 seen in CG1 and CG2, but rather to changes in codons 16 and/or 18 (C->T and/or G->C, respectively). Only a limited sequence from codons 8 to 24 was available in these isolates, no more material being available to confirm these findings.

Sequence variation in the LMP1 C terminus
Three distinct sequence variants were also seen at the LMP1 C terminus. CG1 isolates from 8/12 cases of HD, 1/2 TW samples (TW1), 2/4 NPCs and 1/2 TNKL had sequences similar to those of the C1510, China1 and DV strains (Table 3Up). All harboured del-LMP1 at codons 346–355 and all of the informative cases showed six mutations in the sequence between codons 320 and 366. Surprisingly, the frequent change G->A at codon 335 reported in Chinese NPC isolates (Cheung et al., 1998Down ) was seen in only 1/8 HD isolates. Furthermore, this change was absent from TW, NPC and TNKL isolates. In Chinese NPC, the G->A change at codon 335 results in an amino acid alteration of Gly->Asp, designated deletion variant Asp335 (DV-Asp335). This mutation is reported in 94% of DV in southern Chinese NPC (Cheung et al., 1996Down , 1998Down ). In contrast, our Chinese HD isolates harboured predominantly Gly335 (7/8; 88%).

In CG2, 2/12 HD and 1/4 NPC isolates shared nine nucleotide changes compared with B95.8, but retained the 30 bp region from codons 346 to 355 (Table 3Up). The NPC isolate showed an additional change, T->A at codon 366. These changes resemble those seen in RV rather than China2. However, the change C->A at codon 362 in HD and NPC isolates was not seen in China2 or RV.

In contrast to the N terminus sequence, the C terminus sequence of CG3 showed clear differences compared with B95.8. Although 2/12 isolates (HD#56 and HD#58) retained the 30 bp region, they harboured nine and eight nucleotide changes, respectively. Of these, only two were shared, T->C at codon 338 and A->T at codon 342. Similarly, although TW13 had an identical sequence at the N terminus compared with B95.8, it showed six nucleotide alterations and a 15 bp deletion at the C terminus. In addition, 1/2 TNKL and 1/4 NPC also showed several variable nucleotide changes in this region.

Sequence variation in the LMP1 promoter region
Three distinct sequence variations were also found in the LMP1 promoter region. In CG1, six HD and three NPC isolates were sequenced from -174 to +41 (relative to the transcription start) and two HD and one TW isolates were sequenced from -64 to +41 (Fig. 5Up). These isolates showed similar sequence variation. There were 26 common nucleotide alterations (the only exceptions being the absence of mutations A->C and G->C at positions +26 and +40 in TW1 and HD#47, respectively). In addition, HD#4 had an additional mutation, T->G at position -51, and TW1 had one additional mutation, T->G at -50. CG1 had 26 nucleotide changes in this region, of which 24 were shared with CAO. In comparison, wild-type European EBV group D isolates (Sandvej et al., 1997Down ) showed 23 nucleotide alterations in the promoter compared with B95.8, of which 21 changes were shared with CG1. CAO, group D and CG1 showed identical GA->CT (-44 and -43) mutations at the important CREB site.

Sequence data were available from +41 to -60 for the single CG2 HD isolate (HD#72; HRS cell EBV-negative). In this region, 18 nucleotide changes were identified, of which 13 and 12, respectively, were shared with CAO and European group D. There were four nucleotide changes in the CREB site (Fig. 5Up). Isolates from the two CG2 NPCs (NPC#3 and NPC#6) showed 27 and 30 nucleotide changes, respectively, within the sequence -174 to +41. Of these, 19 and 20, respectively, were shared with CAO and European group D. There were also four nucleotide changes in the CREB site (Fig. 5Up).

Two CG3 HD isolates were sequenced from -174 to +41, whilst sequence data were available from -64 to +41 for isolates from one HD case (HD#55) and one TW (TW13). One isolate (HD#56) showed a single mutation, C->T at position -158. One isolate (HD#58) harboured two changes, C->T at -158 and A->C at -86. Two CG3 isolates (HD#55 and TW13) had promoter sequences identical to that of B95.8.

Summary of grouping
CG1 isolates show consistent changes, characterized by 26, 13 and six mutations in the promoter region, the N terminus and the C terminus, respectively. A mutation (G->T) at codon 17 in the N terminus causes XhoI-loss. The C terminus contains the 30 bp deletion at codons 346–355. CG2 isolates are characterized by 27, 16 and nine mutations in the promoter region, the N terminus and the C terminus, respectively. XhoI-loss, caused by a G->T mutation at codon 17 in the N terminus, is also seen, but the 30 bp deletion in the C terminus is absent. CG3 is identical to B95.8 in the promoter region and the N terminus, but not at the C terminus.

Based on our sequencing data, we used analysis of the 30 bp deletion and the XhoI restriction site to predict the grouping of the 71 HD isolates. In 58/71 (82%) cases, data were available concerning the configuration at both sites and these could be allocated as follows: 48 sequences were CG1, three were CG2, five were CG3 and two could not be assigned to any of the three groups. For the remaining 13 isolates, data concerning either the 30 bp deletion or the XhoI restriction site were unavailable and these could not be grouped.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Deletion of a 30 bp sequence in the C terminus of LMP1 appears to enhance the transforming activity of this key virus oncogene in vitro (Hu et al., 1993Down ; Chen et al., 1992Down ; Li et al., 1996Down ). The detection of del-LMP1 in naturally occurring virus isolates from several EBV-associated malignancies has led to speculation that this variant might be involved in tumour pathogenesis (Knecht et al., 1993Down ; Sandvej et al., 1994Down ; Santon et al., 1995Down ; Chang et al., 1995Down ; Kingma et al., 1996Down ; Dolcetti et al., 1997Down ; Dirnhofer et al., 1999Down ). Our study shows that del-LMP1 is common in Chinese HD isolates, being present in 53/64 cases (83%), a frequency similar to that described in Chinese NPC and PTL, in which 80–100% of tumours carry the variant (Miller et al., 1994Down ; Chang et al., 1995Down ; Chen et al., 1996aDown ; Cheung et al., 1996Down ; Khanim et al., 1996Down ). Thus, del-LMP1 is associated with both common and rare EBV-associated tumours in mainland China. However, we also found del-LMP1 in 12/14 (86%) informative TWs from healthy Chinese. This is in agreement with several studies that have described del-LMP1 in up to 92% of the normal Chinese population (Chang et al., 1995Down ; Chen et al., 1996bDown ; Cheung et al., 1996Down ; Khanim et al., 1996Down ). Although the frequency of del-LMP1 in Chinese EBV-associated tumours is considerably higher than in comparable Western tumours, the balance of evidence now suggests that this reflects the level of this variant in the background population.

Whilst it is intriguing that the del-LMP1 genotype appears to correlate with functional changes in vivo that promote tumorigenesis, it is too simplistic to view this molecule as a marker for an oncogenic virus, and we do not believe that it can account for the striking variations in geographical incidence observed for different EBV-associated tumours.

Sequence analysis has previously identified several LMP1 variants in different EBV-related diseases as well as in different geographical populations (Fennewald et al., 1984Down ; Hatfull et al., 1988Down ; Hu et al., 1991Down ; Chen et al., 1992Down ; Miller et al., 1994Down ; Cheung et al., 1998Down ; Sung et al., 1998Down ). Generally, LMP1 variants reported previously in Chinese NPC can be divided into three groups. One is characterized by the loss of an XhoI site at codon 17 and the 30 bp deletion at codons 346–355, together with several other changes in the N and C termini. This group includes CAO (Hu et al., 1991Down ), C1510 (Chen et al., 1992Down ), China1 (Sung et al., 1998Down ) and DV (Cheung et al., 1998Down ). A second group shows the same changes and XhoI-loss but without the 30 bp deletion. Examples include China2 (Sung et al., 1998Down ) and RV (Cheung et al., 1998Down ). The third group resembles B95.8 (Sung et al., 1998Down ).

We found three main groups of isolates in Chinese HD cases and in healthy Chinese, which showed sequence variations in the LMP1 promoter region and the N and C termini. Although these groups (which we have designated CG1, CG2 and CG3) are similar to China1 and DV, China2 and RV and B95.8-like variants, respectively, they show several notable differences. (i) In DV (derived from NPC from Hong Kong), 94% of variants showed G->A at codon 335, resulting in an amino acid alteration of Gly->Asp (DV-Asp335) (Cheung et al., 1996Down , 1998Down ). In contrast, the great majority (7/8; 88%) of our CG1 Chinese HD isolates had a non-mutated, DV-Gly335-like configuration. The distribution of DV-Asp335 and DV-Gly335 may reflect geographical variation, since all of the cases in our present study were collected from northern China. (ii) In China1, China2, DV and RV, XhoI-loss was caused consistently by a G->T change at codon 17. XhoI-loss in our CG1 and CG2 variants was also caused by this mutation, but in two HD isolates, it was caused by C->T at codon 16 or G->C at codon 18. Unfortunately, these isolates could not be sequenced further because of lack of material. (iii) In CG2, a C->A change at codon 362 was seen in two isolates. This was found in neither China2 nor RV. (iv) Sung et al. (1998)Down reported that 5/28 isolates from Chinese NPC were identical to B95.8 at the LMP1 N terminus, but they did not describe the C terminus sequence in these cases. In CG3, we found similar results with respect to the N terminus, with the exception of two nucleotide changes in one isolate. Surprisingly, however, these two isolates respectively showed eight and nine nucleotide alterations in the C terminus. Thus, a B95.8-like N terminus sequence may not necessarily be representative of the entire LMP1 gene sequence. This finding also suggests that the LMP1 C terminus is a hot-spot region for mutations, as we have proposed previously (Sandvej et al., 1997Down ). (v) The promoter region of LMP1 also showed three patterns of sequence variation.

Our study is the first to report sequence variation in the promoters of Asian wild-type LMP1 variants. Examination of this region revealed a number of nucleotide mutations in CG1 and CG2 but only occasional changes in CG3. The significance of these mutations is unclear. However, mutations G->C in CG1 and A->T in CG2 in the CREB recognition sequence (-45 to -38) could reduce LMP1 promoter activity by between three- and nine-fold (Chen et al., 1995Down ; Li et al., 1996Down ). Notably, all of the mutations seen in CG1 and CG2 were also present in TW isolates from healthy Chinese.

Our group has previously identified four wild-type LMP1 variants in a European population (Sandvej et al., 1997Down ). Chinese HD CG3 is similar to European groups A and B. However, Chinese HD CG1 and CG2, which we found in the majority of both tumour and healthy isolates from China, are distinct from all four European groups. These variants also differ from reported African and Alaskan EBV strains (C15 and Par 1; Miller et al., 1994Down ), suggesting that these genotypes could be useful as molecular markers in epidemiological studies.

We have proposed that del-LMP1 arises by misalignment of direct repeats (Sandvej et al., 1994Down ). The present study provides further support for this hypothesis. CG2 variants, which have retained the 30 bp sequence, show mutations that abolish the two 9 bp repeat regions involved in the misalignment (codon 344–346 and 354–356; Table 3Up).

XhoI-loss is associated significantly with Chinese NPC compared with healthy controls, and it has been considered to be a specific tumour marker (Hu et al., 1991Down ; Chen et al., 1992Down ; Jeng et al., 1994Down ). Similarly, it has been suggested that del-LMP1 is a specific change in several EBV-related tumours (Knecht et al., 1993Down ; Santon et al., 1995Down ; Chang et al., 1995Down ; Kingma et al., 1996Down ; Dolcetti et al., 1997Down ; Dirnhofer et al., 1999Down ). However, our LMP1 sequence analysis shows that XhoI-loss cannot be used alone to determine whether del-LMP1 is present in a particular isolate. Similarly, although the 30 bp deletion is always associated with XhoI-loss, retention of the 30 bp sequence is not specifically associated with either XhoI-loss or wt-XhoI (Sung et al., 1998Down ; Cheung et al., 1998Down ). Therefore, examination for only XhoI configuration or the 30 bp region cannot assess the virus strain definitively in all isolates. However, with this proviso, these remain useful markers for screening cases. Sequence analysis of selected cases confirmed the provisional grouping of CG1 isolates based on the presence of del-LMP1 and XhoI-loss. Thus, some 48/58 Chinese HD isolates (83%) and 12/13 informative TW samples (92%) would appear to be CG1 viruses, making this by far the most common EBV variant in our Chinese population.

Previously, the BamHI f variant has been reported predominantly in Chinese populations and only rarely outside Asia. This variant has been detected much more often in Chinese NPC (86%) than in healthy Chinese controls (8%) (Lung et al., 1990Down , 1992Down , 1994Down ) and it too has been proposed as a specific marker for Chinese NPC. Recently, however, BamHI f variants were detected in 10/21 (48%) cases of European HD but not in European lymphoblastoid cell line variants (Khanim et al., 1996Down ). In our study, we had some problems in amplifying the BamHI F region in all cases, presumably because of the relatively poor quality of DNA available from the paraffin blocks that we examined. We detected the f variant in only one control HD case, in which EBV was present in reactive lymphocytes but not in HRS cells. All informative EBV-positive HD (n=13) and TWs (n=11) showed the wild-type BamHI F configuration. These results, together with the findings of LMP1 gene polymorphisms, suggest that European and Chinese HD cases harbour different EBV variants. The different frequencies of the BamHI f variant detected by us in Chinese HD and that reported previously in Chinese NPC is difficult to explain, but may reflect geographical variation in the study populations. Some support for this comes from our analysis of NPC from northern China, in which we found BamHI f variants in 4/17 (24%) NPC isolates (data not shown), a frequency much lower than that reported for carcinomas from southern Chinese patients.


   Acknowledgments
 
We wish to thank Professor Niels Gregersen, Associate Professor Brage Andersen, Marit Nyholm and Inga Knudsen from the Research Unit of Molecular Medicine, Aarhus University Hospital and Faculty of Health Sciences, Aarhus, Denmark, for assistance with primer design and sequence analysis. This work was supported by the Danish Medical Research Council (grant no. 9503303 28809), the Danish Cancer Society (grant nos 95 120 01 and 95 100 16) and the National Foundation for Natural Science of China (grant no. 39400157).


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Anagnostopoulos, I. & Hummel, M. (1996). Epstein–Barr virus in tumours. Histopathology 29, 297-315.[Medline]

Chang, Y. S., Su, I. J., Chung, P. J., Shu, C. H., Ng, C. K., Wu, S. J. & Liu, S. T. (1995). Detection of an Epstein–Barr-virus variant in T-cell-lymphoma tissues identical to the distinct strain observed in nasopharyngeal carcinoma in the Taiwanese population. International Journal of Cancer 62, 673-677.

Chen, M. L., Tsai, C. N., Liang, C. L., Shu, C. H., Huang, C. R., Sulitzeanu, D., Liu, S. T. & Chang, Y. S. (1992). Cloning and characterization of the latent membrane protein (LMP) of a specific Epstein–Barr virus variant derived from the nasopharyngeal carcinoma in the Taiwanese population. Oncogene 7, 2131-2140.[Medline]

Chen, M. L., Wu, R. C., Liu, S. T. & Chang, Y. S. (1995). Characterization of 5'-upstream sequence of the latent membrane protein 1 (LMP-1) gene of an Epstein–Barr virus identified in nasopharyngeal carcinoma tissues. Virus Research 37, 75-84.[Medline]

Chen, H. L., Lung, M. L., Chan, K. H., Griffin, B. E. & Ng, M. H. (1996a). Tissue distribution of Epstein–Barr virus genotypes. Journal of Virology 70, 7301-7305.[Abstract/Free Full Text]

Chen, W. G., Chen, Y. Y., Bacchi, M. M., Bacchi, C. E., Alvarenga, M. & Weiss, L. M. (1996b). Genotyping of Epstein–Barr virus in Brazilian Burkitt’s lymphoma and reactive lymphoid tissue. Type A with a high prevalence of deletions within the latent membrane protein gene. American Journal of Pathology 148, 17-23.[Abstract]

Cheung, S. T., Lo, K. W., Leung, S. F., Chan, W. Y., Choi, P. H. K., Johnson, P. J., Lee, J. C. K. & Huang, D. P. (1996). Prevalence of LMP1 deletion variant of Epstein–Barr virus in nasopharyngeal carcinoma and gastric tumors in Hong Kong. International Journal of Cancer 66, 711-712.

Cheung, S. T., Leung, S. F., Lo, K. W., Chiu, K. W., Tam, J. S., Fok, T. F., Johnson, P. J., Lee, J. C. & Huang, D. P. (1998). Specific latent membrane protein 1 gene sequences in type 1 and type 2 Epstein–Barr virus from nasopharyngeal carcinoma in Hong Kong. International Journal of Cancer 76, 399-406.

Chiang, A. K., Wong, K. Y., Liang, A. C. & Srivastava, G. (1999). Comparative analysis of Epstein–Barr virus gene polymorphisms in nasal T/NK-cell lymphomas and normal nasal tissues: implications on virus strain selection in malignancy. International Journal of Cancer 80, 356-364.

Dawson, C. W., Rickinson, A. B. & Young, L. S. (1990). Epstein–Barr virus latent membrane protein inhibits human epithelial cell differentiation. Nature 344, 777-780.[Medline]

Dirnhofer, S., Angeles-Angeles, A., Ortiz-Hidalgo, C., Reyes, E., Gredler, E., Krugmann, J., Fend, F. & Quintanilla-Martinez, L. (1999). High prevalence of a 30-base pair deletion in the Epstein–Barr virus (EBV) latent membrane protein 1 gene and of strain type B EBV in Mexican classical Hodgkin’s disease and reactive lymphoid tissue. Human Pathology 30, 781-787.[Medline]

Dolcetti, R., Zancai, P., De Re, V., Gloghini, A., Bigoni, B., Pivetta, B., De Vita, S., Carbone, A. & Boiocchi, M. (1997). Epstein–Barr virus strains with latent membrane protein-1 deletions: prevalence in the Italian population and high association with human immunodeficiency virus-related Hodgkin’s disease. Blood 89, 1723-1731.[Abstract/Free Full Text]

Fhraeus, R., Jansson, A., Sjoblom, A., Nilsson, T., Klein, G. & Rymo, L. (1993). Cell phenotype-dependent control of Epstein–Barr virus latent membrane protein 1 gene regulatory sequences. Virology 195, 71-80.[Medline]

Fennewald, S., van Santen, V. & Kieff, E. (1984). Nucleotide sequence of an mRNA transcribed in latent growth-transforming virus infection indicates that it may encode a membrane protein. Journal of Virology 51, 411-419.[Abstract/Free Full Text]

Hatfull, G., Bankier, A. T., Barrell, B. G. & Farrell, P. J. (1988). Sequence analysis of Raji Epstein–Barr virus DNA. Virology 164, 334-340.[Medline]

Hayashi, K., Chen, W. G., Chen, Y. Y., Bacchi, M. M., Bacchi, C. E., Alvarenga, M., Abreu, E. S., Chang, K. L. & Weiss, L. M. (1997). Deletion of Epstein–Barr virus latent membrane protein 1 gene in United States and Brazilian Hodgkin’s disease and reactive lymphoid tissue: high frequency of a 30-bp deletion. Human Pathology 28, 1408-1414.[Medline]

Hu, L.-F., Zabarovsky, E. R., Chen, F., Cao, S.-L., Ernberg, I., Klein, G. & Winberg, G. (1991). Isolation and sequencing of the Epstein–Barr virus BNLF-1 gene (LMP1) from a Chinese nasopharyngeal carcinoma. Journal of General Virology 72, 2399-2409.[Abstract/Free Full Text]

Hu, L. F., Chen, F., Zheng, X., Ernberg, I., Cao, S. L., Christensson, B., Klein, G. & Winberg, G. (1993). Clonability and tumorigenicity of human epithelial cells expressing the EBV encoded membrane protein LMP1. Oncogene 8, 1575-1583.[Medline]

Jeng, K. C. G., Hsu, C. Y., Liu, M. T., Chung, T. T. & Liu, S. T. (1994). Prevalence of Taiwan variant of Epstein–Barr virus in throat washings from patients with head and neck tumors in Taiwan. Journal of Clinical Microbiology 32, 28-31.[Abstract/Free Full Text]

Khanim, F., Yao, Q. Y., Niedobitek, G., Sihota, S., Rickinson, A. B. & Young, L. S. (1996). Analysis of Epstein–Barr virus gene polymorphisms in normal donors and in virus-associated tumors from different geographic locations. Blood 88, 3491-3501.[Abstract/Free Full Text]

Kingma, D. W., Weiss, W. B., Jaffe, E. S., Kumar, S., Frekko, K. & Raffeld, M. (1996). Epstein–Barr virus latent membrane protein-1 oncogene deletions: correlations with malignancy in Epstein–Barr virus-associated lymphoproliferative disorders and malignant lymphomas. Blood 88, 242-251.[Abstract/Free Full Text]

Knecht, H., Bachmann, E., Brousset, P., Sandvej, K., Nadal, D., Bachmann, F., Odermatt, B. F., Delsol, G. & Pallesen, G. (1993). Deletions within the LMP1 oncogene of Epstein–Barr virus are clustered in Hodgkin’s disease and identical to those observed in nasopharyngeal carcinoma. Blood 82, 2937-2942.[Abstract/Free Full Text]

Leung, S. Y., Yuen, S. T., Chung, L. P., Chan, A. S. Y. & Wong, M. P. (1997). Prevalence of mutations and 30-bp deletion in the C-terminal region of Epstein–Barr virus latent membrane protein-1 oncogene in reactive lymphoid tissue and non-nasopharyngeal EBV-associated carcinomas in Hong Kong Chinese. International Journal of Cancer 72, 225-230.

Li, S. N., Chang, Y. S. & Liu, S. T. (1996). Effect of a 10-amino acid deletion on the oncogenic activity of latent membrane protein 1 of Epstein–Barr virus. Oncogene 12, 2129-2135.[Medline]

Lin, J. C., Lin, S. C., Luppi, M., Torelli, G. & Mar, E. C. (1995). Geographic sequence variation of latent membrane protein 1 gene of Epstein–Barr virus in Hodgkin’s lymphomas. Journal of Medical Virology 45, 183-191.[Medline]

Lung, M. L., Chang, R. S., Huang, M. L., Guo, H. Y., Choy, D., Sham, J., Tsao, S. Y., Cheng, P. & Ng, M. H. (1990). Epstein–Barr virus genotypes associated with nasopharyngeal carcinoma in southern China. Virology 177, 44-53.[Medline]

Lung, M. L., Lam, W. P., Sham, J., Choy, D., Yong-Sheng, Z., Guo, H. Y. & Ng, M. H. (1991). Detection and prevalence of the ‘f’ variant of Epstein–Barr virus in southern China. Virology 185, 67-71.[Medline]

Lung, M. L., Lam, W. P., Chan, K. H., Li, S., Sham, J. & Choy, D. (1992). Direct detection of Epstein–Barr virus in peripheral blood and comparison of Epstein–Barr virus genotypes present in direct specimens and lymphoblastoid cell lines established from nasopharyngeal carcinoma patients and healthy carriers in Hong Kong. International Journal of Cancer 52, 174-177.

Lung, M. L., Chang, G. C., Miller, T. R., Wara, W. M. & Phillips, T. L. (1994). Genotypic analysis of Epstein–Barr virus isolates associated with nasopharyngeal carcinoma in Chinese immigrants to the United States. International Journal of Cancer 59, 743-746.

Miller, W. E., Hood Edwards, R., Walling, D. M. & Raab-Traub, N. (1994). Sequence variation in the Epstein–Barr virus latent membrane protein 1. Journal of General Virology 75, 2729-2740.[Abstract/Free Full Text]

Peng, M. & Lundgren, E. (1992). Transient expression of the Epstein–Barr virus LMP1 gene in human primary B cells induces cellular activation and DNA synthesis. Oncogene 7, 1775-1782.[Medline]

Peng, M. & Lundgren, E. (1993). Transient expression of the Epstein–Barr virus LMP1 gene in B-cell chronic lymphocytic leukemia cells, T cells, and hematopoietic cell lines: cell-type-independent-induction of CD23, CD21, and ICAM-1. Leukemia 7, 104-112.[Medline]

Rowe, M., Peng-Pilon, M., Huen, D. S., Hardy, R., Croom-Carter, D., Lundgren, E. & Rickinson, A. B. (1994). Upregulation of bcl-2 by the Epstein–Barr virus latent membrane protein LMP1: a B-cell-specific response that is delayed relative to NF-{kappa}B activation and to induction of cell surface markers. Journal of Virology 68, 5602-5612.[Abstract/Free Full Text]

Sandvej, K., Peh, S. C., Andresen, B. S. & Pallesen, G. (1994). Identification of potential hot spots in the carboxy-terminal part of the Epstein–Barr virus (EBV) BNLF-1 gene in both malignant and benign EBV-associated diseases: high frequency of a 30-bp deletion in Malaysian and Danish peripheral T-cell lymphomas. Blood 84, 4053-4060.[Abstract/Free Full Text]

Sandvej, K., Gratama, J. W., Munch, M., Zhou, X. G., Bolhuis, R. L. H., Andresen, B. S., Gregersen, N. & Hamilton-Dutoit, S. (1997). Sequence analysis of the Epstein–Barr virus (EBV) latent membrane protein-1 gene and promoter region: identification of four variants among wild-type EBV isolates. Blood 90, 323-330.[Abstract/Free Full Text]

Santon, A., Manzanal, A. I., Camo, E. & Bellas, C. (1995). Deletion in the Epstein–Barr virus latent membrane protein-1 oncogene in Hodgkin’s disease. Journal of Clinical Pathology: Molecular Pathology 48, M184-M187.

Sung, N. S., Edwards, R. H., Seillier-Moiseiwitsch, F., Perkins, A. G., Zeng, Y. & Raab-Traub, N. (1998). Epstein–Barr virus strain variation in nasopharyngeal carcinoma from the endemic and non-endemic regions of China. International Journal of Cancer 76, 207-215.

Wang, D., Liebowitz, D. & Kieff, E. (1985). An EBV membrane protein expressed in immortalized lymphocytes transforms established rodent cells. Cell 43, 831-840.[Medline]

Wilson, J. B., Weinberg, W., Johnson, R., Yuspa, S. & Levine, A. J. (1990). Expression of the BNLF-1 oncogene of Epstein–Barr virus in the skin of transgenic mice induces hyperplasia and aberrant expression of keratin 6. Cell 61, 1315-1327.[Medline]

Received 10 October 2000; accepted 22 December 2000.


This article has been cited by other articles:


Home page
haematolHome page
N. Faumont, A. Chanut, A. Benard, N. Cogne, G. Delsol, J. Feuillard, and F. Meggetto
Comparative analysis of oncogenic properties and nuclear factor-{kappa}B activity of latent membrane protein 1 natural variants from Hodgkin's lymphoma's Reed-Sternberg cells and normal B-lymphocytes
Haematologica, March 1, 2009; 94(3): 355 - 363.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Jansson, P. Johansson, S. Li, and L. Rymo
Activity of the LMP1 gene promoter in Epstein-Barr virus-transformed cell lines is modulated by sequence variations in the promoter-proximal CRE site
J. Gen. Virol., July 1, 2007; 88(7): 1887 - 1894.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, X.-G.
Right arrow Articles by Hamilton-Dutoit, S. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, X.-G.
Right arrow Articles by Hamilton-Dutoit, S. J.
Agricola
Right arrow Articles by Zhou, X.-G.
Right arrow Articles by Hamilton-Dutoit, S. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS