|
|
||||||||
Plant |
Department of Plant Pathology, Kansas State University, Manhattan, KS 66506-5502, USA1
Author for correspondence: Louis Heaton. Fax +1 785 532 5692. e-mail heaton{at}plantpath.ksu.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Turnip crinkle virus (TCV) encodes two small MPs, p8 and p9, which are both required for (Hacker et al., 1992
), and can function in trans in (Li et al., 1998
) cell-to-cell movement. In an effort to identify host proteins that interact with the TCV-encoded movement proteins, an Arabidopsis thaliana cDNA library was screened in a GAL4-based yeast two-hybrid system against TCV p8 and p9 baits. One A. thaliana cDNA clone was identified that encodes a protein, tentatively designated Atp8 (A. thaliana/p8), which interacted with p8 in yeast cells and in vitro. Atp8 mRNA was cloned and sequenced to show that Atp8 mRNA potentially encodes a protein with two possible transmembrane helices, several potential phosphorylation sites and two RGD sequences. We suggest that the characteristics of Atp8 are consistent with those expected of a host protein for participation in plant virus cell-to-cell movement.
| Methods |
|---|
|
|
|---|
Recombinant plasmid baits in the yeast two-hybrid system.pGBT-p8 cut with NheI was re-ligated to construct pGBT-p8d1, which had a deletion of amino acid residues 36 and 37. The ends of NheI-cut pGBT were polished with the Klenow fragment of DNA polymerase I (GibcoBRL) and re-ligated to construct pGBT-p8d2, which has a deletion of the C-terminal half of the 72 residue protein.
cDNA library screen, DNA sequencing and analysis.
DNA from an A. thaliana cDNA library (Clontech) was inserted into the GAL4 activation domain of pGAD10 (Clontech) to generate activation domain/A. thaliana hybrid plasmids. The activation domain/A. thaliana hybrid plasmids were amplified in E. coli strain DH5
, and plasmid DNA was prepared according to the manufacturers protocol.
Recombinant bait vectors, the DNA-binding domain/target protein hybrid plasmids pGBT-p8, pGBT-p9 and pGBT-pCP, were used to transform yeast strain HF7c by the mini-transformation protocol described by Gietz et al. (1992)
. Yeast cells harbouring recombinant bait vectors were transformed with the activation domain/A. thaliana hybrid plasmids by the large-scale transformation described by the manufacturer of the cDNA library. Transformants were spread on selective medium and incubated at 30 °C for 46 days. Filter assays for
-galactosidase activity were as described by the manufacturers of the MATCHMAKER Two-Hybrid System (Clontech). Yeast colonies were lifted from agar plates with circles of sterile Whatman #1 filter paper. The filters with colonies were frozen in liquid nitrogen and subsequently allowed to thaw at room temperature. The filters were placed, colony-side up, on a second filter presoaked in Z buffer/X-Gal solution comprising 100 ml Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, pH 7·0, 10 mM KCl, 1 mM MgSO4), 1·67 ml X-Gal stock solution (20 mg/ml of 5-bromo-4-chloro-3-indolyl
-D-galactopyranoside in N,N-dimethylformamide), and 0·27 ml
-mercaptoethanol. The filters were incubated at room temperature. After the appearance of a blue colour, generally after 3060 min, the filters were aligned with the agar plates to identify
-galactosidase-producing colonies. The
-galactosidase-positive colonies were re-streaked onto selection medium (SD, -Trp, -Leu) to allow segregation of cDNA fusion plasmids, and well-isolated colonies were reassayed as described above for
-galactosidase activity.
Leu+ Trp- transformant strains were generated according to the manufacturers protocol. Briefly, Leu+ Trp+ LacZ+ transformants were cultured for 12 days in liquid SD synthetic medium that lacked Leu and contained Trp. These conditions maintained the activation domain/A. thaliana hybrid plasmids, but the DNA-binding domain/target protein hybrid plasmid (pGBT-p8) was randomly lost from approximately 1020% of the transformants. Samples were plated onto SD agar with Trp and without Leu and incubated at 30 °C for 23 days. Colonies were transferred onto each of two SD agar plates, one lacking Leu and Trp and the other lacking only Leu. The Trp auxotrophs (those that grew on +Trp but not on -Trp plates) were assayed for
-galactosidase activity. Colonies that were positive for
-galactosidase activity were discarded as false positives and those that were negative were tested further.
The remaining candidate plasmids were isolated and used to re-transform yeast strain HF7c in the following combinations: (1) a candidate plasmid alone, (2) a candidate plasmid and pGBT9 (no bait insert), (3) a candidate plasmid and pGBT-p8, and (4) a candidate plasmid and pGBT-pCP, which encodes TCV CP, a non-interacting protein. Cotransformants in combinations 2, 3 and 4 were selected on SD synthetic medium that contained His, but lacked Trp and Leu. Transformants in combination 1 were selected on SD medium that lacked Leu, but contained Trp and His. Candidate plasmids in combinations 1, 2 and 4 that resulted in positive
-galactosidase assays were discarded as false positives. Candidate plasmids in combination 3 that resulted in positive
-galactosidase assays were used in additional transformations to further eliminate false-positive clones.
Positive two-hybrid interactions were further verified by cotransforming yeast strain SFY526 (supplied in the MATCHMAKER kit) with pGAD interacting candidates and pGBT-p8. The lacZ reporter gene in strain SFY526 is under the control of a different promoter than in strain HF7c. The two promoters share only the GAL4-responsive elements. Therefore, positive two-hybrid interactions observed in both strains are likely to require binding of the GAL4 DNA-binding domain specifically to the GAL4-responsive elements (Bartel et al., 1993
). After the elimination of false positives, one candidate activation domain/A. thaliana hybrid plasmid remained that was designated pAtp8-1.
To isolate additional cDNA clones of Atp8 mRNA, the cDNA insert of pAtp8-1 was 32P-labelled with the RadPrime DNA Labelling System (GibcoBRL) and used to screen the A. thaliana cDNA library in E. coli by in situ hybridization as described by Maniatis et al. (1982)
.
Sequences of cDNA inserts were determined with a DNA Sequenase Kit, Version 2.0 (USB) and the recommended protocol. A portion of the sequencing was performed by an in-house sequencing group (College of Veterinary Medicine, KSU) using an ABI 373A DNA Sequencer, Version 1.2.1. Nucleotide and deduced amino acid sequences were analysed with the PC/Gene software package (IntelliGenetics).
Protein expression, purification and in vitro binding assay.
The glutathione S-transferase (GST) expression vector pGEX-cs3 (kindly provided by D. Parks, Oregon State University, USA) was used to express p8 and Atp8 in E. coli. An upstream primer (5' GAACTTAGATCTGGATGGATCCTGAACG 3') and an EcoRI-tagged downstream primer (5' CTgaattcTTAGAAGTTGAAGTTG 3') were used to amplify p8 cDNA fragments from pTCV-3d1. Amplified p8 cDNA fragments were digested to completion with BamHI and partially with EcoRI, and ligated to BamHI/EcoRI-digested pGEX-cs3 to construct pGEX-p8. pGEX-p8 was cut with NheI and ligated to construct mutant pGEXp8d1 with a two amino acid deletion. NheI-digested pGEX-p8 was blunt-ended and re-ligated to construct mutant pGEX-p8d2 with a C-terminal deletion. cDNA fragments of Atp8-1 were isolated by EcoRI digestion of pAtp8-1, and ligated into EcoRI-digested pGEX-cs3. The plasmids were used to transform E. coli strain DH5
. Protein expression was induced by 0·3 mM IPTG. GST fusion proteins were purified on glutathioneSepharose 4B (Pharmacia) following the recommended protocol. A full-length Atp8 fragment was cloned into the expression vector pPROEX1 (GibcoBRL). His-Atp8 was induced in E. coli by addition of 0·6 mM IPTG, and purified on NiNTA resin (GibcoBRL).
The Protein Biotinylation System (GibcoBRL) and the recommended protocol were used to label purified HisAtp8 and GSTAtp8 with biotin. Approximately 2·0 µg each of the purified proteins was blotted to a nitrocellulose membrane (Schleicher & Schuell) through a slot-blot manifold (Bio-Rad). Blots were probed with approximately 5·0 µg of biotin-labelled HisAtp8/GSTAtp8 in Tris-buffered saline (TBS; Tris base, 20 mM, pH 7·5, NaCl, 500 mM), washed in TweenTris-buffered saline (TTBS; TBS+0·05% Tween 20), incubated with ExtrAvidin-alkaline phosphatase (Sigma) in TBS, washed in TTBS and assayed in an NBTBCIP alkaline phosphatase solution.
DNA, RNA and protein blots.
Two TCV p8 mutants were constructed by the methods described above. pTCV-3d1, which contains a full-length cDNA copy of the TCV genome, and two deletion mutants, pTCV-p8d1 and pTCV-p8d2, were linearized with XbaI, and transcribed in vitro as described by Heaton et al. (1989)
. Nicotiana benthamiana plants or isolated protoplasts were inoculated with in vitro-synthesized viral RNAs as previously described (Heaton et al., 1989
).
Genomic DNA was isolated from 3- to 4-week-old A. thaliana plants as described by Gelvin & Schilperoort (1988)
. A. thaliana genomic DNA was digested to completion with EcoRI or BamHI, resolved in 0·9% agarose gels, and transferred to nylon membranes (Schleicher & Schuell). DNA blots were probed with radiolabelled Atp8 cDNA fragments (Maniatis et al., 1982
). A Trizol RNA Kit (GibcoBRL) and its recommended protocol were used to isolate total RNA from plant tissues. An Oligotex mRNA Kit (Qiagen) was used to purify mRNA from total RNA. mRNA or total RNA was resolved in 1% agarose gels, and transferred to nylon membranes (Schleicher & Schuell). RNA blots were hybridized with a radiolabelled cDNA probe as previously described (Heaton et al., 1989
). Protein samples were prepared as previously described (Heaton et al., 1991
). Proteins were resolved in a 10% polyacrylamideSDS gel and blotted to nitrocellulose membranes. The blots were probed with an anti-TCV CP serum as previously described (Heaton et al., 1989
).
| Results |
|---|
|
|
|---|
-galactosidase positive. After elimination of false positive clones as described in Methods, one positive clone remained, which was designated pAtp8-1.
A C-terminal portion of p8 is required for interaction with Atp8
In an effort to determine if the product of pAtp8 specifically interacts with TCV p8, the ORFs for several proteins, including TCV CP and TCV p9, as well as the MP of Tomato bushy stunt virus (p22; Hearne et al., 1990
; Scholthof et al., 1995
), were tested in yeast cells. Yeast strain HF7c was co-transformed with pAtp8-1 plus pGBT-CP, pGBT-p9 or pGBT-p22. Neither the marker gene His+ nor lacZ was activated in yeast. These results further substantiate that the product of pAtp8-1 interacts specifically with TCV p8 in yeast cells.
To begin delimitation of the regions of p8 responsible for the interaction with Atp8, two deletion mutants of p8 were generated. In p8d1, two amino acid residues (36 and 37) in the central region of the 72 residue protein were deleted, and in p8d2 the C-terminal half of the protein was deleted by introducing a stop codon after 33 amino acid residues. Mutant p8d1 interacted with pAtp8-1 in yeast cells, but p8d2 did not. Thus, the N-terminal half of p8 is apparently not sufficient for interaction with Atp8.
Atp8 interacts with p8 in vitro
An in vitro protein-binding assay was used to further confirm the interaction between Atp8 and p8. E. coli-expressed and purified GSTp8, GSTp8d1, GSTp8d2, GST, HisAtp8, and additional control proteins including BSA and the GibcoBRL high molecular mass marker proteins (myosin, phosphorylase b, bovine serum albumin, carbonic anhydrase,
-lactoglobulin and lysozyme), were blotted onto a nitrocellulose membrane. The membrane was probed with biotin-labelled HisAtp8 in TBS. As shown in Fig. 1
, full-length His-Atp8 showed a strong interaction with GSTp8 and GSTp8d1 but not with itself, GSTp8d2, GST or the other control proteins. These results demonstrate that Atp8 specifically interacts with p8, but fails to interact with the N-terminal half of p8 in vitro. The N-terminal portion of Atp8, which interacted with p8 in the original two-hybrid screen, showed the same interaction with p8 in vitro (data not shown). These in vitro results substantiated the interaction in yeast cells.
|
|
|
Atp8 is potentially a membrane protein with two RGD sequences
The partial Atp8 cDNA fragment identified in the yeast two-hybrid system was approximately 0·5 kb long and did not represent the full-length (23 kb) of Atp8 mRNA, as determined by RNA gel analysis. To obtain the full-length sequence of Atp8 mRNA, the A. thaliana cDNA library was screened with 32P-labelled partial Atp8 cDNA fragments. Five clones were identified by hybridization with partial Atp8 cDNA fragments and their inserts were sequenced. The sequences overlapped and represented the 2·2 kb full-length sequence of Atp8 mRNA. The deduced amino acid sequences of Atp8 is listed in Fig. 4
. The sequence of Atp8 mRNA contains a non-coding 5' sequence of 131 nucleotides and a 3' non-coding region of 306 nucleotides upstream of a poly(A) tail. One long ORF was identified that potentially encodes a 67 kDa protein. The original Atp8 clone isolated from yeast cells encoded amino acid residues 66236 of Atp8. The nucleotide sequence of Atp8 mRNA showed significant identity to two A. thaliana cDNA sequences (accession nos N96677 and H76652) of unknown function, and the deduced amino acid sequence of Atp8 aligned with a single A. thaliana protein (AC084165) of unknown function. Atp8 contains two possible transmembrane helices, several potential phosphorylation sites and two RGD sequences (Fig. 4
).
|
| Discussion |
|---|
|
|
|---|
Atp8 mRNAs are expressed to approximately equal levels in the differentially TCV-susceptible A. thaliana ecotypes Dijon-0, Col-0 and No-0 (Fig. 2B
). Atp8 genes show restriction fragment length polymorphisms among the three ecotypes, which had nucleotide sequence differences among Atp8 genes (Fig. 2A
). Further studies are needed determine whether the nucleotide differences result in amino acid substitutions that affect TCV resistance and susceptibility. Our preliminary mutagenesis study of the Atp8p8 interaction is inconclusive. While a mutation of p8 that eliminated the Atp8 interaction also eliminated cell-to-cell movement in a plant host, a second p8 mutation that did not affect the interaction with Atp8 also eliminated cell-to-cell movement.
While speculation from the presence of amino acid sequence motifs is no substitute for empirical data, we believe the presence of two RGD cell-attachment sequences in Atp8 deserves attention. RGD-containing proteins and their receptors function in numerous biological phenomena. RGD sequences are recognized by integrins (Campbell et al., 2000
), which are, in turn, linked to the cytoskeleton (Ruoslahti & Pierschbacher, 1987
). RGDintegrin interactions are a major recognition system for adhesion to cells of a large number of adhesive extracellular proteins (Ruoslahti, 1996
), and integrin interactions with the actin-based cytoskeleton play important roles in cell signalling processes, including calcium mobilization, protein phosphorylation and alterations in cytoplasmic pH (Hynes, 1992
). Integrin-like proteins that display physiological and RGD-binding properties similar to the animal integrins have been described in a broad range of plant species including A. thaliana (Laval et al., 1999
; Nagpal & Quatrano, 1999
; Canut et al., 1998
; Faik et al., 1998
), Rubus fruticosus (Faik et al., 1998
), maize (Laboure et al., 1999
) and Vallisneria gigantea (Ryu et al., 1997
).
In addition to normal physiological functions, the RGD cell-attachment signal plays a critical role in several animal virushost cell interactions (Baxt & Becker, 1990
; Bergelson et al., 1993
; Roivainen et al., 1994
; Shafren et al., 1997
; Wickham et al., 1993
). The cell-surface receptors for the viral RGD motifs are integrins (Roivainen et al., 1994
; Wickham et al., 1993
), and the cytoskeletal network plays a critical role in receptor-mediated internalization of virus (Kizhatil & Albritton, 1997
). Recruitment of the actin cytoskeleton is thought to be an important feature of RGDintegrin-mediated virus internalization.
Recent advances in the elucidation of the mechanisms of TMV movement include findings that the TMV MP associates with the plant cytoskeleton through unknown interactions (Heinlein et al., 1995
), and that an extracellular enzyme involved in cell-wall extension (Nari et al., 1991
), pectin methylesterase (PME), specifically binds the TMV MP (Chen et al., 2000
). These findings are consistent with a model of TMV MP function in which an extracellular or cell surface RGD protein (like PME or Atp8) binds the MP, and an integrin-like protein that interacts with the cytoskeleton in turn, recognizes the RGD protein. The MPRGDintegrin complex could function in the intracellular movement and targeting of TMV by the same mechanisms as function for several animal viruses. We should note that the subcellular localization of Atp8 has not yet been determined so we do not know if it is an extracellular, cell-surface or intracellular protein. We also add that, while the RGD sequences are very rare among proteins in general, several PME accessions (AAF63815, T07593, P24791) contain RGD sequences.
While much remains to be done to demonstrate whether the RGD motifs of Atp8 and other proteins play a role, we suggest that the idea that TCV, like many animal viruses and perhaps several plant viruses, has recruited RGDintegrincytoskeleton trafficking interactions to facilitate virus movement within plant hosts is indeed a tantalizing one.
| Acknowledgments |
|---|
| Footnotes |
|---|
b Present address: Department of Anatomy, Physiological Sciences and Radiology, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27607, USA. ![]()
| References |
|---|
|
|
|---|
Baxt, B. & Becker, Y. (1990). The effect of peptides containing the arginine-glycine-aspartic acid sequence on the adsorption of foot-and-mouth disease virus to tissue culture cells. Virus Genes 4, 73-83.[Medline]
Bergelson, J. M., Chan, B. M., Finberg, R. W. & Hemler, M. E. (1993). The integrin VLA-2 binds echovirus 1 and extracellular matrix ligands by different mechanisms. Journal of Clinical Investigation 92, 232-239.
Campbell, K. D., Reed, W. A. & White, K. L. (2000). Ability of integrins to mediate fertilization, intracellular calcium release, and parthenogenetic development in bovine oocytes. Biology of Reproduction 62, 1702-1709.
Canut, H., Carrasco, A., Galaud, J. P., Cassan, C., Bouyssou, H., Vita, N., Ferrara, P. & Pont-Lezica, R. (1998). High affinity RGD-binding sites at the plasma membrane of Arabidopsis thaliana links the cell wall. Plant Journal 16, 63-71.[Medline]
Chen, M. H., Sheng, J., Hind, G., Handa, A. K. & Citovsky, V. (2000). Interaction between the tobacco mosaic virus movement protein and host cell pectin methylesterases is required for viral cell-to-cell movement. EMBO Journal 19, 913-920.[Medline]
Citovsky, V., Knorr, D., Schuster, G. & Zambryski, P. (1990). The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell 60, 637-647.[Medline]
Dorokhov, Y. L., Makinen, K., Frolova, O. Y., Merits, A., Saarinen, J., Kalkkinen, N., Atabekov, J. G. & Saarma, M. (1999). A novel function for a ubiquitous plant enzyme pectin methylesterase: the host-cell receptor for the tobacco mosaic virus movement protein. FEBS Letters 461, 223-228.[Medline]
Faik, A., Laboure, A. M., Gulino, D., Mandaron, P. & Falconet, D. (1998). A plant surface protein sharing structural properties with animal integrins. European Journal of Biochemistry 253, 552-559.[Medline]
Gelvin, S. B. & Schilperoort, R. A. (1988). Plant Molecular Biology Manual. Dordrecht & Boston: Kluwer Academic.
Gietz, D., St Jean, A., Woods, R. A. & Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research 20, 1425.
Hacker, D. L., Petty, I. T. D., Wei, N. & Morris, T. J. (1992). Turnip crinkle virus genes required for RNA replication and virus movement. Virology 189, 1-8.[Medline]
Ham, B. K., Lee, T. H., You, J. S., Nam, Y. W., Kim, J. K. & Paek, K. H. (1999). Isolation of a putative tobacco host factor interacting with cucumber mosaic virus-encoded 2b protein by yeast two-hybrid screening. Molecules and Cells 9, 548-555.[Medline]
Hearne, P. Q., Knorr, D. A., Hillman, B. I. & Morris, T. J. (1990). The complete genome structure and synthesis of infectious RNA from clones of tomato bushy stunt virus. Virology 177, 141-151.[Medline]
Heaton, L. A., Carrington, J. C. & Morris, T. J. (1989). Turnip crinkle virus infection from RNA synthesized in vitro. Virology 170, 214-218.[Medline]
Heaton, L. A., Lee, T. C., Wei, N. & Morris, T. J. (1991). Point mutations in the turnip crinkle virus capsid protein affect the symptoms expressed by Nicotiana benthamiana. Virology 183, 143-150.[Medline]
Heinlein, M., Epel, B. L., Padgett, H. S. & Beachy, R. N. (1995). Interaction of tobamovirus movement proteins with the plant cytoskeleton. Science 270, 1983-1985.
Hynes, R. O. (1992). Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11-25.[Medline]
Kizhatil, K. & Albritton, L. M. (1997). Requirements for different components of the host cell cytoskeleton distinguish ecotropic murine leukemia virus entry via endocytosis from entry via surface fusion. Journal of Virology 71, 7145-7156.[Abstract]
Laboure, A. M., Faik, A., Mandaron, P. & Falconet, D. (1999). RGD-dependent growth of maize calluses and immunodetection of an integrin-like protein. FEBS Letters 442, 123-128.[Medline]
Laval, V., Chabannes, M., Carriere, M., Canut, H., Barre, A., Rouge, P., Pont-Lezica, R. & Galaud, J. (1999). A family of Arabidopsis plasma membrane receptors presenting animal
-integrin domains. Biochimica et Biophysica Acta 1435, 61-70.[Medline]
Li, W. Z., Qu, F. & Morris, T. J. (1998). Cell-to-cell movement of turnip crinkle virus is controlled by two small open reading frames that function in trans. Virology 244, 405-416.[Medline]
McLean, B. G., Zupan, J. & Zambryski, P. C. (1995). Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco cells. Plant Cell 7, 2101-2114.[Abstract]
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Mushegian, A. R. & Koonin, E. V. (1993). Cell-to-cell movement of plant viruses. Insights from amino acid sequence comparisons of movement proteins and from analogies with cellular transport systems. Archives of Virology 133, 239-257.[Medline]
Nagpal, P. & Quatrano, R. S. (1999). Isolation and characterization of a cDNA clone from Arabidopsis thaliana with partial sequence similarity to integrins. Gene 230, 33-40.[Medline]
Nari, J., Noat, G. & Ricard, J. (1991). Pectin methylesterase, metal ions and plant cell-wall extension. Hydrolysis of pectin by plant cell-wall pectin methylesterase. Biochemical Journal 279, 343-350.
Oh, J.-W., Kong, Q., Song, C., Carpenter, C. D. & Simon, A. E. (1995). Open reading frames of turnip crinkle virus involved in satellite symptom expression and incompatibility with Arabidopsis thaliana ecotype Dijon. Molecular PlantMicrobe Interactions 8, 979-987.
Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R. & Lazarowitz, S. G. (1994). The geminivirus BR1 movement protein binds single-stranded DNA and localizes to the cell nucleus. Plant Cell 6, 995-1006.[Abstract]
Roivainen, M., Piirainen, L., Hovi, T., Virtanen, I., Riikonen, T., Heino, J. & Hyypia, T. (1994). Entry of coxsackievirus A9 into host cells: specific interactions with alpha v beta 3 integrin, the vitronectin receptor. Virology 203, 357-365.[Medline]
Ruoslahti, E. (1996). RGD and other recognition sequences for integrins. Annual Review of Cell and Developmental Biology 12, 697-715.[Medline]
Ruoslahti, E. & Pierschbacher, M. D. (1987). New perspectives in cell adhesion: RGD and integrins. Science 238, 491-497.
Ryu, J. H., Mizuno, K., Takagi, S. & Nagai, R. (1997). Extracellular components implicated in the stationary organization of the actin cytoskeleton in mesophyll cells of Vallisneria. Plant and Cell Physiology 38, 420-432.
Scholthof, H. B., Scholthof, K. B., Kikkert, M. & Jackson, A. O. (1995). Tomato bushy stunt virus spread is regulated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion. Virology 213, 425-438.[Medline]
Shafren, D. R., Dorahy, D. J., Greive, S. J., Burns, G. F. & Barry, R. D. (1997). Mouse cells expressing human intercellular adhesion molecule-1 are susceptible to infection by coxsackievirus A21. Journal of Virology 71, 785-789.[Abstract]
Soellick, T., Uhrig, J. F., Bucher, G. L., Kellmann, J. W. & Schreier, P. H. (2000). The movement protein NSm of tomato spotted wilt tospovirus (TSWV): RNA binding, interaction with the TSWV N protein, and identification of interacting plant proteins. Proceedings of the National Academy of Sciences, USA 97, 2373-2378.
Waigmann, E., Lucas, W. J., Citovsky, V. & Zambryski, P. (1994). Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of a domain involved in increasing plasmodesmal permeability. Proceedings of the National Academy of Sciences, USA 91, 1433-1437.
Waigmann, E., Cohen, Y., McLean, G. & Zambryski, P. (1998). Plasmodesmata: gateways for information transfer. Symposia of the Society for Experimental Biology 51, 43-49.[Medline]
Wickham, T. T., Mathias, P., Cheresh, D. A. & Nemerow, G. R. (1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319.[Medline]
Wolf, S., Deom, C. M., Beachy, R. & Lucas, W. J. (1991). Plasmodesmatal function is probed using transgenic tobacco plants that express a virus movement protein. Plant Cell 3, 593-604.
Received 6 November 2000;
accepted 26 January 2001.
This article has been cited by other articles:
![]() |
Y. Zhou, E. Ryabov, X. Zhang, and Y. Hong Influence of viral genes on the cell-to-cell spread of RNA silencing J. Exp. Bot., July 1, 2008; 59(10): 2803 - 2813. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Nelson and V. Citovsky Plant Viruses. Invaders of Cells and Pirates of Cellular Pathways Plant Physiology, August 1, 2005; 138(4): 1809 - 1814. [Full Text] [PDF] |
||||
![]() |
P. Boevink and K. J. Oparka Virus-Host Interactions during Movement Processes Plant Physiology, August 1, 2005; 138(4): 1815 - 1821. [Full Text] [PDF] |
||||
![]() |
M.-H. Chen, G.-W. Tian, Y. Gafni, and V. Citovsky Effects of Calreticulin on Viral Cell-to-Cell Movement Plant Physiology, August 1, 2005; 138(4): 1866 - 1876. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Carvalho and S. G. Lazarowitz Interaction of the Movement Protein NSP and the Arabidopsis Acetyltransferase AtNSI Is Necessary for Cabbage Leaf Curl Geminivirus Infection and Pathogenicity J. Virol., October 15, 2004; 78(20): 11161 - 11171. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ahlfors, S. Lang, K. Overmyer, P. Jaspers, M. Brosche, A. Tauriainen, H. Kollist, H. Tuominen, E. Belles-Boix, M. Piippo, et al. Arabidopsis RADICAL-INDUCED CELL DEATH1 Belongs to the WWE Protein-Protein Interaction Domain Protein Family and Modulates Abscisic Acid, Ethylene, and Methyl Jasmonate Responses PLANT CELL, July 1, 2004; 16(7): 1925 - 1937. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Laporte, G. Vetter, A.-M. Loudes, D. G. Robinson, S. Hillmer, C. Stussi-Garaud, and C. Ritzenthaler Involvement of the Secretory Pathway and the Cytoskeleton in Intracellular Targeting and Tubule Assembly of Grapevine fanleaf virus Movement Protein in Tobacco BY-2 Cells PLANT CELL, September 1, 2003; 15(9): 2058 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Kragler, M. Curin, K. Trutnyeva, A. Gansch, and E. Waigmann MPB2C, a Microtubule-Associated Plant Protein Binds to and Interferes with Cell-to-Cell Transport of Tobacco Mosaic Virus Movement Protein Plant Physiology, August 1, 2003; 132(4): 1870 - 1883. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Desvoyes, S. Faure-Rabasse, M.-H. Chen, J.-W. Park, and H. B. Scholthof A Novel Plant Homeodomain Protein Interacts in a Functionally Relevant Manner with a Virus Movement Protein Plant Physiology, August 1, 2002; 129(4): 1521 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsushita, O. Miyakawa, M. Deguchi, M. Nishiguchi, and H. Nyunoya Cloning of a tobacco cDNA coding for a putative transcriptional coactivator MBF1 that interacts with the tomato mosaic virus movement protein J. Exp. Bot., June 1, 2002; 53(373): 1531 - 1532. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |