|
|
||||||||
Animal: RNA Viruses |
Centre de Recherche en Santé Humaine1 et Centre de Recherche en Microbiologie et Biotechnologie2, INRSInstitut Armand-Frappier, 531 boul. des Prairies, Laval, Laval-des-Rapides, Québec, CanadaH7N 4Z3
Author for correspondence: Yves St-Pierre. Fax +1 450 686 5501. e-mail yves_st-pierre{at}inrs-iaf.uquebec.ca
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
A number of studies have shown that local production of extracellular proteases plays a key role in immune lung disorders (reviewed by Greenberger, 1997
). The increased expression of extracellular proteases can affect the hosts immune response against opportunistic infectious agents. In cystic fibrosis, for instance, opsonization of Pseudomonas aeruginosa is ineffective because neutrophil-derived elastase released in the extracellular space cleaves immunoglobulins and digests the C3b receptor on neutrophils, thereby limiting phagocytosis of pathogens (Greenberger, 1997
). The cellular immune response can also be altered whenever extracellular proteases cleave molecules involved in cell-mediated immunity, such as CD4 and CD8 (Döring et al., 1995
), ICAM-1 (Champagne et al., 1998
) and IL-2 (Ariel et al., 1998
). The local production of extracellular proteases, most notably matrix metalloproteases (MMPs), can also alter the local tissue architecture directly by degrading the proteins of the extracellular matrix (Shapiro, 1994
). High levels of MMP-2 and MMP-9 in the lungs have been shown to promote the infiltration of inflammatory cells and to exacerbate the symptoms associated with bronchial asthma (Kumagai et al., 1999
). Although both MMP-2 and MMP-9 have been shown to cleave denatured collagen (gelatin) and, somewhat less efficiently, native collagen types IV and V, they can also degrade elastin (Senior et al., 1991
), an important component of the lung architecture. Most of our understanding of the role of proteases in immunological lung disorders has, however, come from studies of specific genetic diseases. Whether proteolytic activity can be augmented in pulmonary virus infections remains unknown.
Porcine reproductive and respiratory syndrome (PRRS) is an emerging virus disease causing late-term reproductive failure and severe pneumonia in unweaned and weaned piglets (Bilodeau et al., 1991
; Goyal, 1993
). The causative agent, PRRS virus (PRRSV), is a member of the new family Arteriviridae, order Nidovirales, that replicates in lung alveolar macrophages, producing an influenza-like illness associated with respiratory distress (Snijder & Meulenberg, 1998
; Dea et al., 2000
). Respiratory disease in the nursery is indeed a common sign of PRRSV infection in a herd, with the presence of classical interstitial pneumonia, along with lesions typical of co-infections by common pulmonary agents such as Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Pasteurella multocida and Streptococcus suis (Goyal, 1993
; Kobayashi et al., 1996
). The presence of these pathogens in lungs of PRRSV-infected piglets has been taken as an indication that PRRSV infection can favour the establishment of opportunistic infectious agents (Dee & Joo, 1994
; Molitor et al., 1997
), although it is yet unclear whether PRRS does indeed lead to local immunosuppression (Drew, 2000
; Samsom et al., 2000
). One reason for this ambiguity is that the pathogenic mechanisms of PRRS remain poorly defined. The purpose of the present study was to investigate the possible involvement of extracellular proteases in the pathogenesis of the immune lung disorders associated with PRRSV infection in pigs.
| Methods |
|---|
|
|
|---|
Reagents and antibodies.
Animals.
Fifteen castrated crossbred F1 (LandracexYorkshire) specific-pathogen-free (SPF) piglets, 45 weeks old, were obtained from a breeding farm located in southern Québec, Canada. Prior to shipping, the breeding stock and piglets were tested and proven to be seronegative for PRRSV, encephalomyocarditis virus, porcine parvovirus, haemagglutinating encephalomyelitis virus, transmissible gastroenteritis virus and Mycoplasma hyopneumoniae. Animals were also tested at the end of the experiment by multiplex PCR to confirm the absence of porcine circovirus type
, Mycoplasma hyopneumoniae and Mycoplasma hyorhinis, as described elsewhere (Ouardani et al., 1999
; Caron et al., 2000
). The piglets used in this study were from two different litters and were divided randomly into one control group and four experimental groups (three piglets per group) and kept in facilities equipped with a micro-organism-free, filtered in-flowing and out-flowing air systems. The animals were fed commercial feed and water ad libitum.
Virus infection.
The Québec cytopathogenic strain IAF-Klop of PRRSV (Mardassi et al., 1994b
), which has been propagated for 1520 passages in MARC-145 cells, a clone of MA-104 cells highly permissive to PRRSV (Kim et al., 1993
), was used in this study. Prior to experimental inoculation of SPF piglets, the tissue culture-adapted PRRSV strain was propagated twice in primary cultures of porcine alveolar macrophages (PAMs) to increase its virulence for pigs. PAMs were obtained by bronchoalveolar lavage (BAL), as described previously (Wensvoort et al., 1991
). Virus infectivity titres of 107 TCID50/ml were determined for the virus stock used for inoculation of the 12 experimental piglets. These were inoculated intratracheally under sedation with acepromazine/ketamine by using a laryngoscope and then monitored daily for clinical symptoms for a 3-week observation period before euthanasia. Their lungs, spleen, kidneys and mesenteric and thoracic lymph nodes were collected aseptically and processed for histopathology, RTPCR and attempts at cultivation of PRRSV in MARC-145 cells. The three control piglets were mock-infected with virus-free culture medium.
Bronchoalveolar lavage (BAL).
At days 3, 7, 14 and 42 post-infection (p.i.), three piglets were euthanized and their lungs were collected aseptically and filled with 100 ml PBS supplemented with 1% penicillinstreptomycin, 0·2% gentamycin, 1% anti-pplo (tylosin) and 0·4% amphotorycine (fungizone). The PBS-filled lungs were then massaged and 3545 ml of lavage fluid was obtained by applying gentle uniform pressure onto the lungs. The BALs were then clarified by centrifugation at 300 g for 20 min to remove cells. Lung samples were specifically taken from dark-red, collapsed zones showing typical signs of infection; some were frozen, others were fixed in formalin. Spleen and kidney samples were also harvested for histopathological analysis. Samples from thoracic and mesenteric lymph nodes were collected and frozen.
Histological examination.
Thin sections (5 µm thick) of formalin-fixed, paraffin-embedded tissues from the lungs, spleen and kidneys of control and experimentally infected pigs were processed routinely for haematoxylineosin (H&E) staining, as described previously (Dea et al., 1991
).
Measure of net proteolytic activity in BALs of PRRSV-infected pigs.
The proteolytic activity of BALs was measured by FASC, as described previously (St-Pierre et al., 1996
). The enzymatic reactions were performed at 37 °C for 18 h in a final volume of 100 µl serum-free RPMI as the reaction medium. Briefly, samples for analysis contained 88 µl BAL at various dilutions and 5 µl FITC-labelled substrate-coated microspheres. The volume was completed with serum-free RPMI medium. The reaction was stopped by adding 900 µl of a 50 mM TrisHCl (pH 9·5), 150 mM NaCl solution and the samples were kept on ice until analysis. To titrate the proteolytic activity of the BALs, serial dilutions ranging from 1/5 to 1/625 (v/v) were prepared. Affinity-purified human MMP-9 was used as a positive control. Flow cytometric analyses were performed on a Coulter XL-MCL using standard optics for detection of FITC fluorescence, as described previously (St-Pierre et al., 1996
). The ED50 corresponded to the dilution with 50% maximal proteolytic activity.
Detection of MMPs by zymography.
Gelatinolytic activity in the serum and BALs of PRRSV-infected piglets was determined by SDSPAGEgelatin zymography, as described previously (Aoudjit et al., 1997
), with minor modifications. Briefly, aliquots of serum (diluted 1:10 in distilled water) or BALs (concentrated 20-fold by lyophilization) were mixed with 5 µl loading buffer (Bio-Rad, Laemmli loading buffer) and then analysed by electrophoresis on an 8% SDSpolyacrylamide gel containing 1 mg/ml denatured collagen. After electrophoresis, the gel was washed to remove SDS and incubated in a renaturing buffer (50 mM Tris, 5 mM CaCl2, 1% Triton X-100, 0·02% NaN3) for 18 h at 37 °C. The gel was then stained with Coomassie brilliant blue and destained in 30:10:60 (by vol.) methanol/acetic acid/water. Proteolytic activity was identified as a clear band on a blue background. Quantitative analysis was carried out by using a computerized densitometric imager (model GS-670, Bio-Rad). Results were expressed as arbitrary scanning units.
Virus isolation.
Ten per cent homogenates of lung and spleen were prepared in serum-free DMEM, supplemented with 1% penicillinstreptavidin, 0·2% gentamycin and 0·4% fungizone, by using a Dremel MultiPro (model 395 type 5) apparatus. The homogenates were clarified by centrifugation at 3000 g for 30 min and then diluted further to 1/100, 1/1000 and 1/10000 in serum-free DMEM prior to inoculation onto confluent monolayers of MARC-145 cells in Linbro 24-well tissue culture plates. Following a 4 day incubation period at 37 °C, the virus was harvested by two freezethaw cycles of infected cultures. Aliquots of 200 µl clarified supernatant fluid were used for a subsequent passage on the same cell type and the cultures were then monitored daily for the presence of cytopathic effect. Virus titres were calculated by using the formula of Reed and Muench and expressed as TCID50/g tissue. Serological identification of PRRSV was obtained by indirect immunofluorescence staining with MAb IAF-K8, as described previously (Mardassi et al., 1994a
).
RTPCR and PCR experiments.
Total RNA was extracted from frozen tissue samples with the Tripure reagent (Roche), according to the manufacturers directions. Total RNA was resuspended in 20 µl diethyl pyrocarbonate-treated water and processed for RTPCR as described previously (Mardassi et al., 1994b
). The oligonucleotide primers used were VR7.1.1S (5' ATGGCCAGCCAGTCAATCA) and VR7.2.2AS (5'CGGATCAGGCGCACAGTATG), designed to amplify a 303 bp DNA fragment of the ORF7 gene of North American and European strains of PRRSV (Shin et al., 1998
).
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The results showed clearly that both MMP-2 and MMP-9, but not leukocyte elastase, were upregulated in the lungs of PRRSV-infected piglets. This pattern of proteolytic activity was not unexpected, as elastase-rich BALs are mostly associated with neutrophil infiltration, as observed in emphysema and cystic fibrosis (Greenberger, 1997
). In fact, the detection by 714 days p.i. of increased amounts of extracellular MMP-2 and MMP-9 proteolytic enzymes in BALs, two proteases commonly secreted by cells of the lymphocytic/monocytic lineage, corroborates recent observations by other investigators, who reported that the numbers of lymphocytes and monocytes increased considerably in the lungs of PRRSV-infected piglets from day 2 until day 21 p.i. (Shimizu et al., 1996
; Samsom et al., 2000
). Indeed, Beyer et al. (1998)
have shown that there is an increase in the alveolar macrophage chemokine AMCFII in the lungs following PRRSV infection. The increased secretion of both MMPs was detectable only in pulmonary fluids and could not be detected in serum samples, indicating that modulation of the immune response during PRRS is only locally affected.
There have been some indications that PRRSV infection is associated with local immunosuppression that favours opportunistic infections (Dee & Joo, 1994
; Molitor et al., 1997
; Drew, 2000
). One possible reason for this immunosuppression is the fact that the virus can compromise the immune system of infected pigs temporarily through its ability to infect alveolar macrophages (Oleksiewicz & Nielsen, 1999
; Zhang et al., 1999
; Chiou et al., 2000
). At the molecular level, the effect of PRRSV on PAMs might result from the ability of the virus to alter the cellular transcriptome. This possibility is supported by the recent study by Zhang et al. (1999)
, who showed that four gene transcripts were induced following infection of PAMs by PRRSV, one of which was a gene encoding a ubiquitin-specific protease that regulates protein trafficking and degradation. Our data, showing that the virus infection induces a rapid increase in the proteolytic activity of BALs, reveal another mechanism that may compromise the pulmonary immune response of PRRSV-infected pigs for several days, since such proteolytic enzymes can lead to the cleavage of key molecules involved in development of the immune response (Döring et al., 1995
; Champagne et al., 1998
). Further experiments will be necessary, however, to determine whether such molecules are indeed cleaved upon PRRSV infection and to identify those that are more susceptible to the proteolytic activities of MMP-2 and MMP-9. The fact that the increased proteolytic activity of BALs could not be associated with upregulated elastolytic activity suggests, however, that local expression of molecules such as CD4, CD8 and ICAM-1 could be intact during the infection process (Champagne et al., 1998
).
A number of studies have shown the presence of both PRRSV and mycoplasmas in the lungs of dysphneic piglets (Thacker et al., 1999
). Although it can be postulated that the increase in proteolytic activity of BALs induced upon PRRSV infection may favour secondary mycoplasmal infection, further studies are required in order to determine whether mycoplasmal infections may also lead to increased proteolytic activity in the lungs that could potentiate the effects of PRRSV, as suggested recently following vaccination against both agents.
In conclusion, the results obtained in the present study provide preliminary evidence that PRRSV pulmonary infection can modulate local proteolytic activity, mainly a significant increase in the secretion of both MMP-2 and MMP-9 by cells of the lymphocytic/monocytic lineage associated previously with pulmonary dysfunction (OConnor & FitzGerald, 1994
; Kumagai et al., 1999
). These results contribute to a better understanding of the molecular mechanisms underlying PRRS, particularly pulmonary dysfunction and transient immunodeficiency.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Aoudjit, F., Estève, P.-O., Desrosiers, M., Potworowski, E. F. & St-Pierre, Y. (1997). Gelatinase B (MMP-9) production and expression by stromal cells in the normal and adult thymus and experimental thymic lymphoma. International Journal of Cancer 71, 71-78.
Ariel, A., Yavin, E. J., Hershkoviz, R., Avron, A., Franitza, S., Hardan, I., Cahalon, L., Fridkin, M. & Lider, O. (1998). IL-2 induces T cell adherence to extracellular matrix: inhibition of adherence and migration by IL-2 peptides generated by leukocyte elastase. Journal of Immunology 161, 2465-2472.
Babiuk, L. A., Lawman, M. J. & Ohmann, H. B. (1988). Viralbacterial synergistic interaction in respiratory disease. Advances in Virus Research 35, 219-249.[Medline]
Beyer, J., Fichtner, D., Schirrmeier, H., Granzow, H., Polster, U., Weiland, E., Berndt, A. & Wege, H. (1998). Arterivirus PRRSV. Experimental studies on the pathogenesis of respiratory disease. Advances in Experimental Medicine and Biology 440, 593-599.[Medline]
Bilodeau, R., Dea, S., Sauvageau, R. & Martineau, G. P. (1991). Porcine reproductive and respiratory syndrome in Québec. Veterinary Record 129, 102-103.[Medline]
Caron, J., Ouardani, M. & Dea, S. (2000). Diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis infections in pigs by PCR amplification of the p36 and p46 genes. Journal of Clinical Microbiology 38, 1390-1396.
Champagne, B., Tremblay, P., Cantin, A. & St-Pierre, Y. (1998). Proteolytic cleavage of ICAM-1 by human neutrophil elastase. Journal of Immunology 161, 6398-6405.
Chiou, M.-T., Jeng, C.-R., Chueh, L.-L., Cheng, C.-H. & Pang, V. F. (2000). Effects of porcine reproductive and respiratory syndrome virus (isolate tw91) on porcine alveolar macrophages in vitro. Veterinary Microbiology 71, 9-25.[Medline]
Dea, S., Bilodeau, R., Sauvageau, R. & Martineau, G. P. (1991). Outbreaks in Québec pig farms of reproductive and respiratory problems associated with encephalomyocarditis virus. Journal of Veterinary Diagnostic Investigation 3, 275-282.
Dea, S., Gagnon, C. A., Mardassi, H. & Milane, G. (1996). Antigenic variability among North American and European strains of porcine reproductive and respiratory syndrome virus as defined by monoclonal antibodies to the matrix protein. Journal of Clinical Microbiology 34, 1488-1493.[Abstract]
Dea, S., Gagnon, C. A., Mardassi, H., Pirzadeh, B. & Rogan, D. (2000). Current knowledge on structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Archives of Virology 145, 659-688.[Medline]
Dee, S. A. & Joo, H. S. (1994). Prevention of the spread of porcine reproductive and respiratory syndrome virus in endemically infected pig herds by nursery depopulation. Veterinary Record 135, 6-9.[Abstract]
Döring, G., Frank, F., Boudier, C., Herbert, S., Fleischer, B. & Bellon, G. (1995). Cleavage of lymphocyte surface antigens CD2, CD4, and CD8 by polymorphonuclear leukocyte elastase and cathepsin G in patients with cystic fibrosis. Journal of Immunology 154, 4842-4850.[Abstract]
Drew, T. W. (2000). A review of evidence for immunosuppression due to porcine reproductive and respiratory syndrome virus. Veterinary Research 31, 27-39.[Medline]
Glück, T., Geerdes-Fenge, H. F., Straub, R. H., Raffenberg, M., Lang, B., Lode, H. & Scholmerich, J. (2000). Pneumocystis carinii pneumonia as a complication of immunosuppressive therapy. Infection 28, 227-230.[Medline]
Goyal, S. M. (1993). Porcine reproductive and respiratory syndrome. Journal of Veterinary Diagnostic Investigation 5, 656-664.
Graziosi, C. & Pantaleo, G. (1998). Analysis of virologic and immunologic events in HIV infection. Pathobiology 66, 123-127.[Medline]
Greenberger, P. A. (1997). Immunologic aspects of lung diseases and cystic fibrosis. Journal of the American Medical Association 278, 1924-1930.
Kim, H. S., Kwang, J., Yoon, I. J., Joo, H. S. & Frey, M. L. (1993). Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line. Archives of Virology 133, 477-483.[Medline]
Kobayashi, H., Morozumi, T., Miyamoto, C., Shimizu, M., Yamada, S., Ohashi, S., Kubo, M., Kimura, K., Mitani, K., Ito, N. & Yamamoto, K. (1996). Mycoplasma hyorhinis infection levels in lungs of piglets with porcine reproductive and respiratory syndrome (PRRS). Journal of Veterinary Medical Science 58, 109-113.[Medline]
Kumagai, K., Ohno, I., Okada, S., Ohkawara, Y., Suzuki, K., Shinya, T., Nagase, H., Iwata, K. & Shirato, K. (1999). Inhibition of matrix metalloproteinases prevents allergen-induced airway inflammation in a murine model of asthma. Journal of Immunology 162, 4212-4219.
Mankowski, J. L., Carter, D. L., Spelman, J. P., Nealen, M. L., Maughan, K. R., Kirstein, L. M., Didier, P. J., Adams, R. J., Murphey-Corb, M. & Zink, M. C. (1998). Pathogenesis of simian immunodeficiency virus pneumonia: an immunopathological response to virus. American Journal of Pathology 153, 1123-1130.
Mardassi, H., Athanassious, R., Mounir, S. & Dea, S. (1994a). Porcine reproductive and respiratory syndrome virus: morphological, biochemical and serological characteristics of Quebec isolates associated with acute and chronic outbreaks of porcine reproductive and respiratory syndrome. Canadian Journal of Veterinary Research 58, 55-64.
Mardassi, H., Wilson, L., Mounir, S. & Dea, S. (1994b). Detection of porcine reproductive and respiratory syndrome virus and efficient differentiation between Canadian and European strains by reverse transcription and PCR amplification. Journal of Clinical Microbiology 32, 2197-2203.
Molitor, T. W., Bautista, E. M. & Choi, C. S. (1997). Immunity to PRRSV: double-edged sword. Veterinary Microbiology 55, 265-276.[Medline]
Murray, J., Sonnenberg, P., Shearer, S. & Godfrey-Faussett, P. (2000). Drug-resistant pulmonary tuberculosis in a cohort of southern African goldminers with a high prevalence of HIV infection. South African Medical Journal 90, 381-386.
OConnor, C. M. & FitzGerald, M. X. (1994). Matrix metalloproteases and lung disease. Thorax 49, 602-609.
Oleksiewicz, M. B. & Nielsen, J. (1999). Effect of porcine reproductive and respiratory syndrome virus (PRRSV) on alveolar lung macrophage survival and function. Veterinary Microbiology 66, 15-27.[Medline]
Ouardani, M., Wilson, L., Jetté, R., Montpetit, C. & Dea, S. (1999). Multiplex PCR for detection and typing of porcine circoviruses. Journal of Clinical Microbiology 37, 3917-3924.
St-Pierre, Y., Desrosiers, M., Tremblay, P., Estève, P.-O. & Opdenakker, G. (1996). Flow cytometric analysis of gelatinase B (MMP-9) activity using immobilized fluorescent substrate on microspheres. Cytometry 25, 374-380.[Medline]
Samsom, J. N., de Bruin, T. G. M., Voermans, J. J. M., Meulenberg, J. J. M., Pol, J. M. A. & Bianchi, A. T. J. (2000). Changes of leukocyte phenotype and function in the broncho-alveolar lavage fluid of pigs infected with porcine reproductive and respiratory syndrome virus: a role for CD8+ cells. Journal of General Virology 81, 497-505.
Senior, R. M., Griffin, G. L., Fliszar, C. J., Shapiro, S. D., Goldberg, G. I. & Welgus, H. G. (1991). Human 92- and 72-kilodalton type IV collagenases are elastases. Journal of Biological Chemistry 266, 7870-7875.
Shapiro, S. D. (1994). Elastolytic metalloproteinases produced by human mononuclear phagocytes. Potential roles in destructive lung disease. American Journal of Respiratory and Critical Care Medicine 150, S160-S164.
Shimizu, M., Yamada, S., Kawashima, K., Ohashi, S., Shimizu, S. & Ogawa, T. (1996). Changes of lymphocyte subpopulations in pigs infected with porcine reproductive and respiratory syndrome (PRRS) virus. Veterinary Immunology and Immunopathology 50, 19-27.[Medline]
Shin, J., Bautista, E. M., Kang, Y.-B. & Molitor, T. W. (1998). Quantitation of porcine reproductive and respiratory syndrome virus RNA in semen by single-tube reverse transcriptionnested polymerase chain reaction. Journal of Virological Methods 72, 67-79.[Medline]
Shoo, M. K. (1989). Experimental bovine pneumonic pasteurellosis: a review. Veterinary Record 124, 141-144.[Abstract]
Snijder, E. J. & Meulenberg, J. J. M. (1998). The molecular biology of arteriviruses. Journal of General Virology 79, 961-979.[Medline]
Storz, J., Stine, L., Liem, A. & Anderson, G. A. (1996). Coronavirus isolation from nasal swab samples in cattle with signs of respiratory tract disease after shipping. Journal of the American Veterinary Medical Association 208, 1452-1455.[Medline]
Thacker, E. L., Halbur, P. G., Ross, R. F., Thanawongnuwech, R. & Thacker, B. J. (1999). Mycoplasma hyopneumoniae potentiation of porcine reproductive and respiratory syndrome virus-induced pneumonia. Journal of Clinical Microbiology 37, 620-627.
Weeks, B. S. (1998). The role of HIV-1 activated leukocyte adhesion mechanisms and matrix metalloproteinase secretion in AIDS pathogenesis. International Journal of Molecular Medicine 1, 361-366.[Medline]
Wensvoort, G., Terpstra, C., Pol, J. M. A., ter Laak, E. A., Bloemraad, M., de Kluyver, E. P., Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., Boekhuijsen, J. M., Moonen, P. L. J. M., Zetstra, T., de Boer, E. A., Tibben, H. J., de Jong, M. F., vant Veld, P., Groenland, G. J. R., van Gennep, J. A., Voets, M. Th., Verheijden, J. H. M. & Braamskamp, J. (1991). Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Veterinary Quarterly 13, 121-130.[Medline]
Wright, P. E. (1997). Respiratory diseases. In Viral Pathogenesis , pp. 703-743. Edited by N. Nathanson, R. Ahmed, F. Gonzalez-Srarano, D. E. Griffin, K. V. Holmes, F. A. Murphy & H. L. Robinson. Philadelphia:LippincottRaven.
Zhang, X., Shin, J., Molitor, T. W., Schook, L. B. & Rutherford, M. S. (1999). Molecular responses of macrophages to porcine reproductive and respiratory syndrome virus infection. Virology 262, 152-162.[Medline]
Received 29 September 2000;
accepted 30 January 2001.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |