J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thiel, V.
Right arrow Articles by Siddell, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thiel, V.
Right arrow Articles by Siddell, S. G.
Agricola
Right arrow Articles by Thiel, V.
Right arrow Articles by Siddell, S. G.
Journal of General Virology (2001), 82, 1273-1281.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus

Volker Thiel1, Jens Heroldb,1, Barbara Schelle1 and Stuart G. Siddell1

Institute of Virology and Immunology, University of Würzburg, Versbacher Straße 7, 97078 Würzburg, Germany1

Author for correspondence: Stuart Siddell. Fax +49 931 201 3970. e-mail siddell{at}vim.uni-wuerzburg.de


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The coronavirus genome is a positive-strand RNA of extraordinary size and complexity. It is composed of approximately 30000 nucleotides and it is the largest known autonomously replicating RNA. It is also remarkable in that more than two-thirds of the genome is devoted to encoding proteins involved in the replication and transcription of viral RNA. Here, a reverse-genetic system is described for the generation of recombinant coronaviruses. This system is based upon the in vitro transcription of infectious RNA from a cDNA copy of the human coronavirus 229E genome that has been cloned and propagated in vaccinia virus. This system is expected to provide new insights into the molecular biology and pathogenesis of coronaviruses and to serve as a paradigm for the genetic analysis of large RNA virus genomes. It also provides a starting point for the development of a new class of eukaryotic, multi-gene RNA vectors that are able to express several proteins simultaneously.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Coronaviruses are enveloped, vertebrate viruses that are associated mainly with respiratory and enteric diseases. The human coronaviruses are responsible for 10–20% of all common colds (McIntosh, 1996Down ). The virus genome is a positive-strand RNA of approximately 30 kb that encodes a minimal set of four structural proteins and a large array of non-structural proteins involved in replication and transcription (Lai & Cavanagh, 1997Down ; Siddell & Snijder, 1998Down ). These so-called replicase proteins are encoded in two overlapping open reading frames (ORFs) that extend about 20 kb from the 5' end of the genome. It is a hallmark of coronaviruses that extensive co- and post-translational proteolytic processing is required to produce the proteins needed to assemble a functional replication–transcription complex (Ziebuhr et al., 2000Down ). It is also noteworthy that the generation of coronavirus subgenomic mRNAs involves an unusual process of discontinuous transcription (Spaan et al., 1983Down ), most probably during the synthesis of subgenomic, negative-strand templates (Sawicki & Sawicki, 1998Down ). Discontinuous transcription is a highly regulated process and is, at least in part, dependent upon base-pairing between cis-acting elements, the so-called transcription-associated sequences, located at the 5' end of the genome and at various 3'-proximal sites (van Marle et al., 1999Down ).

Until recently, the study of coronavirus genetics was essentially restricted to the analysis of temperature-sensitive (ts) mutants (Lai & Cavanagh, 1997Down ; Stalcup et al., 1998Down ), the analysis of defective RNA templates that depend upon replicase proteins provided by a helper virus (Repass & Makino, 1998Down ; Izeta et al., 1999Down ; Williams et al., 1999Down ) and the analysis of chimeric viruses generated by targetted recombination (Fischer et al., 1997Down ; Hsue & Masters, 1999Down ; Kuo et al., 2000Down ). This was because the large size of the coronavirus genome and the instability of some coronavirus cDNAs in bacteria effectively precluded the use of cloning procedures that have been used to generate infectious RNA from cDNA copies of other positive-strand RNA virus genomes (Ruggli & Rice, 1999Down ). Recently, however, two different approaches have been developed that appear to overcome these problems. Firstly, Almazán et al. (2000)Down have reported that the cloning of full-length, transmissible gastroenteritis virus (TGEV) cDNA in a bacterial artificial chromosome, combined with nuclear expression of infectious RNA, can be used to produce recombinant virus. Secondly, Yount et al. (2000)Down have described a system to assemble a full-length cDNA construct of the TGEV genome by using adjoining cDNA subclones that have unique, flanking, interconnecting junctions. Transcripts derived from the TGEV cDNA assembled in this way can be used to derive infectious recombinant virus.

Despite the remarkable achievements of Almazán et al. (2000)Down and Yount et al. (2000)Down , we have been unable to construct a stable, full-length cDNA copy of the genome of either the human coronavirus strain 229E (HCoV) or murine hepatitis virus (MHV) using plasmids, bacterial artificial chromosomes, bacteriophage vectors or an in vitro approach based upon long-range RT–PCR (Thiel et al., 1997Down ; Herold et al., 1998Down ). We, therefore, decided to pursue an alternative strategy based upon the optimization of in vitro DNA ligation, the use of vaccinia virus as a eukaryotic cloning vector and the cytoplasmic expression of transfected RNA that has been transcribed in vitro. We reasoned that this approach would have several advantages. Firstly, poxvirus vectors are eminently suitable for the cloning of large cDNAs. It has been shown that they have the capacity to accept at least 26 kbp of foreign DNA (Smith & Moss, 1983Down ) and recombinant vaccinia genomes of this size are stable, infectious and replicate in tissue culture to the same titre as non-recombinant virus. Secondly, vaccinia virus vectors have been developed that are designed for the insertion of foreign DNA by in vitro ligation (Merchlinsky & Moss, 1992Down ). This obviates the need for plasmid intermediates carrying the entire cDNA insert. Thirdly, using this approach, recombinant virus is recovered from an infectious RNA that is introduced and replicates in the cytoplasm of the transfected cell. Thus, there are no concerns regarding RNA modification, processing and export from or degradation within the nucleus.

In this study, we show that human coronavirus cDNA fragments of more than 27 kbp can be stably cloned and propagated in vaccinia virus. Moreover, a recombinant vaccinia virus clone, containing a full-length HCoV cDNA, enabled us to produce infectious in vitro RNA transcripts and to rescue recombinant human coronavirus.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and virus and RNA transfection.
Human lung fibroblast (MRC-5), monkey kidney fibroblast (CV-1) and human cervix epithelial (HeLa-S3) cells were purchased from the European Collection of Cell Cultures and maintained in minimum essential medium (MEM) supplemented with HEPES (25 mM), foetal bovine serum (5–10%) and antibiotics. HCoV 229E, vaccinia virus strain vNotI/tk (Merchlinsky & Moss, 1992Down ) and vaccinia virus recombinants were propagated, titrated and purified by using standard procedures (Raabe et al., 1990Down ; Mackett et al., 1985Down ). Fowlpox virus strain HP1.441 (Mayr & Malicki, 1966Down ) was propagated in chicken embryo fibroblast cells that were maintained in MEM supplemented with 7% foetal bovine serum.

{blacksquare} Transfection.
CV-1 cells were grown to 80% confluence and transfected for 2 h at 37 °C with 1–5 µg in vitro-ligated DNA and 10 µl lipofectin in OPTIMEM 1, according to the supplier’s instructions (Life Technologies). MRC-5 cells were grown to 80% confluence and transfected for 30 min at 37 °C with 1 µg in vitro-transcribed RNA and 10 µl lipofectin in OPTIMEM 1, according to the supplier’s instructions.

{blacksquare} Preparation of poly(A)-containing RNA and preparative RT–PCR.
Poly(A)-containing RNA was isolated from coronavirus-infected MRC-5 cells by using oligo(dT)25 Dynabeads as described by Thiel et al. (1997Down ). RT–PCR was also done as described by Thiel et al. (1997)Down with Superscript II reverse transcriptase (Life Technologies) and native Pfu thermostable DNA polymerase (Stratagene). To produce the DNA fragment PCR-BF, three oligonucleotide primers were used: 5' CTACTCACGATATCGTAC 3' (nt 7840–7858, reverse transcription), 5' AGTTGGTGTTATTGCTGATAAGGAC 3' (nt 5176–5200, PCR) and 5' GACATAGGCCGGCCCTGTTGGTTGCACATTTGTTTTGGT 3' (nt 6968–7006, PCR). The PCR-BF fragment comprises 1830 bp representing positions 5176–7006 in the HCoV genome. The PCR-BF fragment is flanked by a natural 5' BglII site (nt 5203–5208) and a 3' FseI site present in the PCR primer (nt 6993–7000). In order to identify diagnostic mutations in the recombinant HCoV genome, three oligonucleotides primers were used: 5' CTACTCACGATATCGTAC 3' (nt 7840–7858, reverse transcription), 5' CAACTTGATGAAAAGGCAC 3' (nt 6032–6050, PCR) and 5' AACCTCTTTGCAAGAATACTTGCT 3' (nt 7094–7117, PCR and sequencing).

{blacksquare} Gel electrophoresis.
RNAs were fractionated by electrophoresis in 0·8% agarose/TBE gels containing 0·1% SDS (TBE is 89 mM Tris–HCl, 89 mM borate, 2 mM EDTA, pH 8·3). Smaller DNA fragments were resolved by electrophoresis in 0·6–1·0% agarose/TBE gels. Larger DNA fragments were resolved by pulsed-field gel electrophoresis in the CHEF-DR III system (Bio-Rad) using 1% agarose/0·5xTBE gels at 14 °C with a switch time of 3–30 s, a run time of 18 h and 6 V/cm at an angle of 120°. RNA and large DNA samples were heated to 65 °C for 10 min prior to electrophoresis. Gels were stained with ethidium bromide after electrophoresis.

{blacksquare} Northern and Southern blots, PCR and sequence analysis.
Poly(A)+ RNA from HCoV-infected MRC-5 cells was electrophoresed on 2·2 M formaldehyde–1% agarose gels. The gels were dried and hybridized to 5'-end 32P-labelled oligonucleotides as described by Meinkoth & Wahl (1984)Down . The oligonucleotide 5' AGAAACTTCATCACGCACTGG 3' (nt 26802–26822) was used to detect HCoV genomic and subgenomic RNAs. The oligonucleotide 5' ACATACGCTGGGCCTGTT 3' (nt 6988–7005) was used to detect the parental HCoV 229E genomic RNA. The oligonucleotide 5' ACATAGGCCGGCCCTGTT 3' (nt 6988–7005) was used to detect the recombinant HCoV-inf-1 genomic RNA.

CV-1 cells (1x105) were infected with parental or recombinant vaccinia virus and incubated until cytopathic effects were evident. The cells were harvested and incubated for 2 h at 50 °C with 200 µl proteinase K buffer (0·1 mg/ml proteinase K in 100 mM Tris–HCl, pH 7·5, 5 mM EDTA, 0·2% SDS, 200 mM NaCl). The digest was then deproteinized with phenol–chloroform extraction and precipitated with ethanol. The DNA was digested overnight at 37 °C with HindIII and the resulting fragments were electrophoresed and transferred to nylon membranes as described by Ausubel et al. (1987)Down . The Multiprime DNA-labelling system was used as recommended by the supplier (Amersham) to produce two 32P-labelled probes from DNA templates. The templates were a 19 kb RT–PCR product corresponding to nt 1048–20582 of the HCoV genome and a PCR product corresponding to nt 23850–26822 (V. Thiel, unpublished). The probes were mixed and hybridized to the immobilized DNA fragments by standard methods (Ausubel et al., 1987Down ).

In addition to Southern blot analysis, recombinant vaccinia virus DNAs were screened by PCR analysis. To do this, DNA from infected CV-1 cells was prepared as described above and used as a template for a standard PCR using thermostable Taq DNA polymerase and the oligonucleotides 5' CCAGGCTGGAGTCTGCAG 3' (nt 22491–22508) and 5' GACAACTAGGTCTGGAAC 3' (nt 23723–23740).

Sequencing of plasmid constructs, RT–PCR products and the recombinant vaccinia virus cDNA insert was done by standard cycle-sequencing methods using the BigDye Terminator kit (Applied Biosystems). The analysis of sequencing products was done by capillary electrophoresis using an ABI 310 PRISM Genetic Analyser. Computer-assisted analysis of sequence data was facilitated by the LASERGENE bio-computing software (DNASTAR).

{blacksquare} Plasmid construction.
Plasmids were constructed from a library of HCoV 229E cDNA clones and RT–PCR products by standard procedures (Ausubel et al., 1987Down ). The precise details of these procedures are available from the authors upon request. The plasmid pEB is based on pBluescript II KS+ and contains sequences corresponding to nt 1–5207 of the HCoV 229E genome, preceded by an additional G nucleotide, the sequence for the bacteriophage T7 RNA polymerase promoter and Bsp120I and EagI restriction sites. The plasmids pME and pFE are based on pBR322. pFE contains sequences corresponding to nt 6993–20569 of the HCoV genome followed by the green fluorescent protein gene, HCoV 229E sequences from nt 26279 to 27277, a synthetic poly(A) tail of approximately 40 nt and ClaI, Bsp120I and EagI restriction sites. The nucleotides at positions 6994, 6997 and 7000 of pFE were mutated from their original sequence. These mutations result in a silent FseI site that is useful for both cloning and diagnostic purposes. pME contains sequences corresponding to nt 12677–27277 of the HCoV 229E genome, a synthetic poly(A) tail of approximately 40 nt and restriction sites for ClaI, Bsp120I and EagI.

{blacksquare} Cloning in vaccinia virus.
Plasmid and RT–PCR DNA fragments were purified with QIAEX II resin following separation by agarose gel electrophoresis. Ligation reactions containing vaccinia virus DNA were analysed by pulsed-field agarose gel electrophoresis. Ligation reactions containing NotI were incubated for 16 h at 25 °C in the recommended digestion buffer (New England Biolabs) supplemented with 1 mM ATP. Subsequently, the T4 DNA ligase was heat-inactivated and the incubation was continued for an additional hour at 37 °C with additional NotI enzyme.

Construction of the full-length HCoV cDNA was carried out in two steps (Fig. 1Down). Firstly, cDNA insert fragments EB and FE were derived from the plasmids pEB and pFE by digestion with EagI/BglII and FseI/EagI, respectively, and treated with alkaline phosphatase. Fragment EB was then ligated with PCR-BF that had been digested with BglII. The resulting 7 kbp ligation product was digested with FseI, purified by agarose gel electrophoresis and ligated with fragment FE to produce a 22·5 kbp cDNA. This cDNA fragment was ligated without further purification to vNotI/tk vaccinia virus DNA in the presence of NotI enzyme. The ligation products were then transfected with lipofectin into CV-1 cells that had been infected 1 h previously with fowlpox virus at an m.o.i. of 5. Two h later, the cells were harvested and replated into 96-well tissue culture dishes with a 4-fold excess of non-transfected, non-infected CV-1 cells. Recombinant vaccinia viruses were isolated from 96 wells that developed cytopathic effect within 2 weeks, plaque purified and analysed by PCR and Southern blots. The sequence of the 22·5 kbp cDNA insert was determined from one such recombinant vaccinia virus, vHCoV-vec-1 (V. Thiel, unpublished results). In a second phase, a cDNA fragment of 22·5 kbp was obtained by digestion of purified vHCoV-vec-1 genomic DNA with Bsp120I, dephosphorylated by alkaline phosphatase and purified by gel electrophoresis. After digestion with MluI and heat inactivation of the MluI enzyme, the resulting fragments of 12·7 and 9·6 kbp were ligated to a cDNA fragment of pME that was obtained by digestion with MluI/EagI, treatment with alkaline phosphatase and purification by gel electrophoresis. This produced, amongst other products, a 27·3 kbp cDNA fragment containing the full-length cDNA of the HCoV 229E genome. The ligation products were then ligated to vNotI/tk vaccinia virus DNA without further purification in the presence of NotI enzyme. By using the rescue procedure described above, a recombinant vaccinia virus, vHCoV-inf-1, was recovered, plaque purified and characterized by PCR and Southern blot analysis. The sequence of the 27·3 kbp cDNA insert of vaccinia virus vHCoV-inf-1 was determined and has been deposited in the GenBank database.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Cloning of full-length HCoV cDNA in the vaccinia virus genome. (a) The two-phase strategy used to generate a full-length HCoV cDNA. The structural relationship of the HCoV 229E ORFs, the plasmid DNA and vaccinia virus HCoV-vec-1 inserts used to assemble the full-length HCoV cDNA is shown. The relevant restriction sites are indicated. ORFs encoding virus replicase proteins are coloured red. Virus structural protein genes are coloured dark blue and virus non-structural protein genes are coloured light blue. Fragment pFE also contains a region encoding green fluorescent protein, which is coloured green. (b) PCR analysis of 16 random recombinant vaccinia virus genomic DNAs. The templates for the PCRs were: lane 1, pME plasmid DNA; lane 2, water; lanes 3–18, DNA from rescued vaccinia virus plaques. HindIII/EcoRI-digested lambda DNA is shown as a size marker. The indicated PCR product of 1249 bp (lanes 3, 6, 8, 16 and 17) is amplified from a region within the surface protein gene (nt 22491–23740) that is present only in recombinant vaccinia viruses containing the full-length HCoV-229E cDNA insert. (c) Southern blot analysis of two selected vaccinia virus vHCoV-inf clones containing full-length cDNA inserts in different orientations. DNA from CV-1 cells infected with vNotI/tk (lane 1), recombinant vHCoV-inf-1 (lane 2) or recombinant vHCoV-inf-2 (lane 3) was digested with HindIII and analysed by Southern blotting using two random-primed 32P-labelled DNA probes representing the HCoV 229E genome between nt 1048–20582 and 23850–26822. The DNA fragments expected from HindIII-digested, full-length HCoV 229E cDNA (6·0, 5·1, 4·3, 3·2, 1·8, 1·2, 1·2, 1·0, 0·7 and 0·6 kbp; fragments below 0·5 kbp are not detected) are shown. The HindIII fragments representing the fusion of the 3' end of the HCoV genomic cDNA and the vaccinia genomic DNA are indicated; the fragments of approximately 2·1 kbp (lane 2) and 6·0 kbp (lane 3) represent the alternative cDNA orientations.

 
{blacksquare} In vitro transcription.
DNA was prepared from purified recombinant vaccinia virus vHCoV-inf-1 by proteinase K/phenol treatment (Ausubel et al., 1987Down ) and ethanol precipitation. The genomic DNA was cleaved with ClaI enzyme and deproteinized by phenol extraction and ethanol precipitation. In vitro transcription of capped RNA was done by using a RiboMAX kit. The reaction was based upon the conditions recommended by the supplier (Promega) and contained 5–10 µg ClaI-cleaved vHCoV-inf-1 DNA and m7G(5')ppp(5')G RNA (cap analogue) at a ratio of 1:1 with GTP. The in vitro transcription reaction was incubated at 25 °C for 2·5 h and was followed by DNase I treatment and RNA precipitation.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The overall strategy of this study is illustrated in Fig. 2Down. Briefly, cDNAs representing the entire HCoV genomic RNA were assembled by in vitro ligation. The cDNA was then ligated, again in vitro, to the left and right arms of a vaccinia virus genomic DNA that had been cleaved at a unique NotI site. The recombinant vaccinia virus DNA was transfected into CV-1 cells and recombinant vaccinia viruses were rescued by co-infection with fowlpox virus. After the isolation of a recombinant vaccinia virus containing a full-length HCoV genomic cDNA, the recombinant vaccinia virus DNA was purified and used as a template for the in vitro transcription of recombinant HCoV genomic RNA. This RNA was transfected into MRC-5 cells and the cultures were monitored for the recovery of recombinant coronavirus.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Strategy for the production of infectious HCoV 229E RNA and the recovery of recombinant coronavirus. The structural relationship of the HCoV 229E ORFs, HCoV 229E genomic RNA and the HCoV-inf-1 cDNA is shown. Two cDNA fragments, derived from vHCoV-vec-1 and pME, are assembled by in vitro ligation using an MluI restriction site. Subsequent ligation of the resulting cDNA with NotI-cleaved vNotI/tk vaccinia virus DNA produces the recombinant vaccinia virus vHCoV-inf DNA. This DNA is then transfected into CV-1 cells and the recombinant vaccinia virus vHCoV-inf-1 is recovered by using fowlpox helper virus. RNA transcripts are produced in vitro by using genomic vHCoV-inf-1 DNA and bacteriophage T7 RNA polymerase and transfected into MRC-5 cells. Finally, tissue cultures are monitored for the production of recombinant human coronavirus.

 
Cloning and propagation of HCoV cDNA in vaccinia virus
One of the major goals in this study was to establish a protocol that enabled us to introduce large coronavirus cDNAs into the vaccinia virus genome. First, we produced a set of plasmid clones, pEB, pFE and pME, that contained extensive segments of the HCoV genome. These plasmids were assembled from a collection of well-characterized cDNA clones (Herold et al., 1993Down ; Raabe et al., 1990Down ; Raabe & Siddell, 1989aDown , bDown ; Myint et al., 1990Down ; S. Siddell, unpublished). Next, we constructed and cloned in vaccinia virus a 22·5 kbp HCoV cDNA insert, HCoV-vec-1. The construction and cloning of the cDNA will be described in detail elsewhere (V. Thiel, unpublished results) but is described here, briefly, because it represents an important intermediate in the derivation of the full-length HCoV genomic cDNA (Fig. 1aUp). First, we ligated cDNA fragments prepared from plasmids pEB and pFE together with an RT–PCR cDNA product, PCR-BF. PCR-BF encompasses a region of the HCoV genome (circa nt 5200–7000) that we are unable to maintain as a plasmid cDNA in bacteria. The products of this reaction were then ligated with vaccinia virus vNotI/tk vector DNA in the presence of NotI enzyme. The in vitro-ligated, recombinant vaccinia virus DNA was then used to recover a recombinant vaccinia virus, vHCoV-vec-1, using fowlpox virus as described in Methods. After having confirmed the sequence of the vHCoV-vec-1 cDNA insert, it was used as a source for one of the two DNA fragments needed to construct the full-length HCoV genomic cDNA.

In a second phase, the vHCoV-vec-1 genomic DNA was used to produce a fragment, BM, that essentially encompassed the HCoV 5' NTR and the replicase ORF 1a. The plasmid pME was used to produce a cDNA fragment that encompasses the remainder of the genome (Fig. 1aUp). These fragments, together with vaccinia virus vNotI/tk vector DNA, were ligated in vitro in the presence of NotI enzyme. The reason for adding NotI is that it favours the accumulation of recombinant vaccinia virus genomes, rather than the parental vaccinia virus genome (V. Thiel, unpublished results). The ligation reaction products were then used to recover recombinant vaccinia virus plaques as described in Methods. We obtained more than 50 vaccinia virus plaques and analysed 16 of them by PCR. Fig. 1Up(bUp) shows that, of these 16 plaques, five contained coronavirus cDNA inserts that included the structural surface protein gene. Southern blot analysis of the genomic DNA of these five recombinant vaccinia viruses indicated that they all contained single-copy, full-length HCoV cDNA (data not shown). Further analysis of two clones, vHCoV-inf-1 and vHCoV-inf-2 (Fig. 1cUp, lanes 2 and 3), confirmed the integrity and orientations of the inserts. Finally, the 27·3 kbp cDNA insert of vHCoV-inf-1 was sequenced and found to be as predicted; this sequence has been deposited in GenBank. Although the insert cDNA of vHCoV-inf-1 exceeds the length of any insert cloned so far into the vaccinia virus genome, this recombinant clone remained stable and infectious and replicated in tissue culture at the same rate and to same titre as standard vaccinia virus (data not shown).

Recovery of a recombinant human coronavirus
To recover a recombinant human coronavirus, we prepared genomic DNA from purified vaccinia virus vHCoV-inf-1, cleaved this DNA with ClaI enzyme and transcribed capped RNA in vitro using bacteriophage T7 RNA polymerase. As is shown in Fig. 3Down(aDown), in vitro transcription of this DNA at 25 °C gave both a reasonable amount (approximately 50 µg per reaction) and a high proportion of full-length (i.e. 27·3 kb) RNA. We found that higher or lower temperatures were detrimental to the integrity and/or the yield of the RNA transcripts (data not shown). When this RNA was transfected into MRC-5 cells using lipofection as described in Methods, cytopathic effects characteristic of human coronavirus infection developed throughout the culture after 6–7 days. A virus, which we have designated HCoV-inf-1, was recovered from the tissue culture supernatant, plaque purified and propagated by three or four undiluted passages in MRC-5 cells to produce stocks containing approximately 1x107 TCID50/ml. The growth kinetics, cytopathic effect and stability of the recovered virus were indistinguishable from those of parental virus (data not shown). These stocks were then used to infect MRC-5 cells at an m.o.i. of 5 and poly(A)-containing RNA was isolated for Northern hybridization analysis. As shown in Fig. 3Down(bDown), the patterns of genomic and subgenomic RNAs synthesized in HCoV 229E- and HCoV-inf-1-infected cells were identical. Specifically, the characteristic pattern of HCoV genomic and subgenomic mRNAs (RNA1, 27·3 kb; RNA2, 6·8 kb; RNA3, 5·2 kb; RNA4, 3·3 kb; RNA5, 2·6 kb; RNA6, 2·4 kb; RNA7, 1·7 kb) accumulated in both infections with the same kinetics in non-equimolar but constant ratios.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Recovery of recombinant human coronavirus. (a) Ethidium bromide-stained, 1% agarose gel in which 1 µg capped RNA, transcribed in vitro from vHCoV-inf-1 DNA, has been electrophoresed. The full-length (27·3 kb) in vitro transcription product is indicated. Also shown is the structural relationship of the HCoV ORFs, the in vitro-transcribed HCoV-inf-1 RNA and the predicted genomic and subgenomic mRNAs in HCoV-inf-1 RNA-transfected MRC-5 cells. (b) Analysis of poly(A)-containing RNA from parental virus- and recombinant virus-infected cells. Poly(A)-containing RNA was isolated from MRC-5 cells that had been mock-infected (lane 1), infected with parental HCoV 229E virus (lane 2) or infected with recombinant HCoV-inf-1 virus (lane 3). The RNA was analysed by Northern hybridization using a 32P-end-labelled oligonucleotide (5' AGAAACTTCATCACGCACTGG 3') corresponding to nt 26802–26822 within the HCoV nucleocapsid protein gene. The characteristic set of genomic and subgenomic HCoV mRNAs is indicated. (c) Northern hybridization of in vitro-transcribed HCoV-inf-1 RNA (lanes 1 and 4) and poly(A)-containing RNA from parental HCoV 229E-infected MRC-5 cells (lanes 2 and 5) and HCoV-inf-1-infected MRC-5 cells (lanes 3 and 6). The RNAs were probed with a parental HCoV 229E-specific oligonucleotide, 5' ACATACGCTGGGCCTGTT 3' (lanes 1–3), or an HCoV-inf-1-specific oligonucleotide, 5' ACATAGGCCGGCCCTGTT 3' (lanes 4–6). The oligonucleotides were 32P-end-labelled. (d) Sequence analysis of HCoV-inf-1 genomic RNA in the region encompassing the three silent mutations specific to the recombinant virus genome. The three nucleotide mutations are indicated that represent the diagnostic FseI site.

 
In order to confirm that we had, indeed, recovered a recombinant virus, the viral RNAs isolated from infected cells were probed with two synthetic oligonucleotides that discriminate between the parental sequence (nt 6988AACAGGCCCAGCGUAUGU7005) and the recombinant virus sequence (nt 6988AACAGGGCCGGCCUAUGU7005; i.e. the sequence around the unique FseI site). As shown in Fig. 3Up(cUp), the oligonucleotides respectively hybridized specifically to the genomes of the parental and the recombinant virus (Fig. 3cUp, lanes 2 and 6). The recombinant virus-specific probe also hybridized to the in vitro-transcribed HCoV-inf-1 RNA (Fig. 3cUp, lane 4), whereas the parental virus-specific probe did not (Fig. 3cUp, lane 1). Finally, sequence analysis of an RT–PCR-amplified DNA fragment that encompasses the relevant region of the HCoV-inf-1 genome confirmed the presence of the diagnostic mutations (Fig. 3dUp). These results demonstrate, conclusively, the recovery of a recombinant human coronavirus and they demonstrate that the coronavirus genomic RNA alone is able to initiate a productive infectious cycle.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The system we describe here should find wide application in the analysis of the molecular biology and pathogenesis of coronaviruses. We have shown that it is possible to clone a full-length cDNA copy of the human coronavirus genome in the vaccinia virus genome and to produce infectious RNA transcripts from this template. In the long term, this system will improve our ability to control coronavirus infections in humans, livestock and domestic animals.

The basis of the approach taken in this study is the use of vaccinia virus as a cloning vector for large cDNA inserts. In this respect, we believe the vaccinia virus system has a number of advantages. Firstly, we have never observed instability of the cloned insert cDNA in the vaccinia virus system. This is in marked contrast to our experience with bacterial systems, where we regularly encounter instability (for example, the insertion of foreign sequences, the deletion of nucleotides, the rearrangement of inserts and the occurrence of single nucleotide changes) when handling large cDNA clones encompassing specific regions of the coronavirus genome. Furthermore, irrespective of the size of the cDNA insert, we have not seen any differences in the infectivity, growth kinetics or stability of the recombinant vaccinia viruses compared to the parental virus. Secondly, we have shown that large cDNA fragments, assembled by in vitro ligation using plasmid DNA, RT–PCR DNA or recombinant vaccinia virus cDNA, can be cloned efficiently into the vaccinia virus genome. By incorporating the NotI enzyme in the ligation reactions, we have found that more that 90% of recovered vaccinia viruses are recombinant. This protocol facilitates the isolation of recombinant vaccinia virus clones without the need for selection, it obviates the need for plasmid intermediates carrying full-length insert cDNAs and it represents a very flexible way of introducing defined mutations into large cDNA clones. To improve the system further, we think that it should also be possible to introduce specific mutations rapidly into the cloned viral cDNA by using vaccinia virus-mediated homologous recombination (Moss, 1996Down ) and we hope that it will be possible to develop simplified procedures for the recovery of recombinant coronaviruses from recombinant vaccinia virus genomes. This should then result in a straightforward and universal reverse-genetic approach for RNA viruses with large genomes, such as coronaviruses, closteroviruses (Mawassi et al., 2000Down ) and okaviruses (Cowley et al., 2000Down ).

The reverse-genetic system we have developed will be useful in a number of areas. It will greatly facilitate the analysis of coronavirus RNA replication and transcription. For example, Sawicki and colleagues have recently characterized the phenotypes and genotypes of a collection of temperature-sensitive (ts) MHV mutants that are unable to synthesize RNA at the restrictive temperature (S. Sawicki, personal communication). The valuable information obtained by this classical approach can now be complemented by a reverse-genetic approach. Moreover, the system we describe also facilitates, in principle, the analysis of coronavirus replication, independent of the virus life-cycle and without the requirement for receptor-mediated infection. Thus, it can be put to great advantage in the analysis of the virus–host cell interaction in the context of virus replication, transcription, assembly and release.

Secondly, the system we describe will complement existing methods of producing recombinant coronaviruses (Masters, 1999Down ; Almazán et al., 2000Down ; Yount et al., 2000Down ) and significantly advance the analysis of coronavirus pathogenesis. With the systems now available, it should be possible to generate rapidly a large collection of genetically modified coronaviruses; for example, intra- and interspecific chimeric viruses, viruses with gene inactivations or deletions and viruses with attenuating modifications or supplementary functions. The phenotypes associated with these modifications, at least those that are not lethal, can then be tested in animal models of infection. In particular, this should provide important insights into the relationship between coronavirus infection and the immune response.

Finally, the results we present should also encourage the development of coronavirus vectors for the expression of heterologous proteins. In the long term, we believe that the expression of multiple subgenomic mRNAs in coronavirus-infected cells could form the basis of a vector system that allows the expression of multiple transcriptional units, each encoding a heterologous protein. These features and the autonomy of coronavirus RNA replication could then be exploited in the development of a new class of RNA vaccine vectors (Bredenbeek & Rice, 1992Down ; Mandl et al., 1998Down ).


   Acknowledgments
 
We thank V. ter Meulen for his continuous support. This work was supported by a grant (SFB 479/B4) from the German Research Council (DFG) to S.G.S.


   Footnotes
 
The GenBank accession number of the sequence reported in this paper is AF304460.

b Present address: SWITCH-Biotech AG, Fraunhofer Straße 10, 82152 Martinsried, Germany. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Almazán, F., González, J. M., Pénzes, Z., Izeta, A., Calvo, E., Plana-Durán, J. & Enjuanes, L. (2000). Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proceedings of the National Academy of Sciences, USA 97, 5516-5521.[Abstract/Free Full Text]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. D., Smith, J. A. & Struhl, K. (editors) (1987). Current Protocols in Molecular Biology. New York: John Wiley.

Bredenbeek, P. J. & Rice, C. M. (1992). Animal RNA virus expression systems. Seminars in Virology 3, 297-310.

Cowley, J. A., Dimmock, C. M., Spann, K. M. & Walker, P. J. (2000). Gill-associated virus of Penaeus monodon prawns: an invertebrate virus with ORF1a and ORF1b genes related to arteri- and coronaviruses. Journal of General Virology 81, 1473-1484.[Abstract/Free Full Text]

Fischer, F., Stegen, C. F., Koetzner, C. A. & Masters, P. S. (1997). Analysis of a recombinant mouse hepatitis virus expressing a foreign gene reveals a novel aspect of coronavirus transcription. Journal of Virology 71, 5148-5160.[Abstract]

Herold, J., Raabe, T., Schelle-Prinz, B. & Siddell, S. G. (1993). Nucleotide sequence of the human coronavirus 229E RNA polymerase locus. Virology 195, 680-691.[Medline]

Herold, J., Thiel, V. & Siddell, S. G. (1998). A strategy for the generation of infectious RNAs and autonomously replicating RNAs based on the HCV 229E genome. Advances in Experimental Medicine and Biology 440, 265-268.[Medline]

Hsue, B. & Masters, P. S. (1999). Insertion of a new transcriptional unit into the genome of mouse hepatitis virus. Journal of Virology 73, 6128-6135.[Abstract/Free Full Text]

Izeta, A., Smerdou, C., Alonso, S., Pénzes, Z., Mendez, A., Plana-Durán, J. & Enjuanes, L. (1999). Replication and packaging of transmissible gastroenteritis coronavirus-derived synthetic minigenomes. Journal of Virology 73, 1535-1545.[Abstract/Free Full Text]

Kuo, L., Godeke, G. J., Raamsman, M. J., Masters, P. S. & Rottier, P. J. (2000). Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier. Journal of Virology 74, 1393-1406.[Abstract/Free Full Text]

Lai, M. M. C. & Cavanagh, D. (1997). The molecular biology of coronaviruses. Advances in Virus Research 48, 1-100.

McIntosh, K. (1996). Coronaviruses. In Fields Virology , pp. 1095-1103. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterisation of vaccinia virus recombinants expressing foreign genes. In DNA Cloning: a Practical Approach , pp. 191-211. Edited by D. M. Glover. Oxford:IRL Press.

Mandl, C. W., Aberle, J. H., Aberle, S. W., Holzmann, H., Allison, S. L. & Heinz, F. X. (1998). In vitro-synthesized infectious RNA as an attenuated live vaccine in a flavivirus model. Nature Medicine 4, 1438-1440.[Medline]

Masters, P. S. (1999). Reverse genetics of the largest RNA viruses. Advances in Virus Research 53, 245-264.[Medline]

Mawassi, M., Satyanarayana, T., Gowda, S., Albiach-Marti, M. R., Robertson, C. & Dawson, W. O. (2000). Replication of heterologous combinations of helper and defective RNA of citrus tristeza virus. Virology 267, 360-369.[Medline]

Mayr, A. & Malicki, K. (1966). Attenuation of virulent fowlpox virus in tissue culture and characteristics of the attenuated virus. Zentralblatt für Veterinärmedizin 13, 1–13 (in German).

Meinkoth, J. & Wahl, G. (1984). Hybridization of nucleic acids immobilized on solid supports. Analytical Biochemistry 138, 267-284.[Medline]

Merchlinsky, M. & Moss, B. (1992). Introduction of foreign DNA into the vaccinia virus genome by in vitro ligation: recombination-independent selectable cloning vectors. Virology 190, 522-526.[Medline]

Moss, B. (1996). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2637-2671. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Myint, S., Harmsen, D., Raabe, T. & Siddell, S. G. (1990). Characterization of a nucleic acid probe for the diagnosis of human coronavirus 229E infections. Journal of Medical Virology 31, 165-172.[Medline]

Raabe, T. & Siddell, S. (1989a). Nucleotide sequence of the human coronavirus HCV 229E mRNA 4 and mRNA 5 unique regions. Nucleic Acids Research 17, 6387.[Free Full Text]

Raabe, T. & Siddell, S. G. (1989b). Nucleotide sequence of the gene encoding the membrane protein of human coronavirus 229 E. Archives of Virology 107, 323-328.[Medline]

Raabe, T., Schelle-Prinz, B. & Siddell, S. G. (1990). Nucleotide sequence of the gene encoding the spike glycoprotein of human coronavirus HCV 229E. Journal of General Virology 71, 1065-1073.[Abstract/Free Full Text]

Repass, J. F. & Makino, S. (1998). Importance of the positive-strand RNA secondary structure of a murine coronavirus defective interfering RNA internal replication signal in positive-strand RNA synthesis. Journal of Virology 72, 7926-7933.[Abstract/Free Full Text]

Ruggli, N. & Rice, C. M. (1999). Functional cDNA clones of the Flaviviridae: strategies and applications. Advances in Virus Research 53, 183-207.[Medline]

Sawicki, S. G. & Sawicki, D. L. (1998). A new model for coronavirus transcription. Advances in Experimental Medicine and Biology 440, 215-219.[Medline]

Siddell, S. G. & Snijder, E. J. (1998). Coronaviruses, toroviruses and arteriviruses. In Topley & Wilson’s Microbiology and Microbial Infections , pp. 463-484. Edited by B. W. J. Mahy & L. Collier. London:Arnold.

Smith, G. L. & Moss, B. (1983). Infectious poxvirus vectors have capacity for at least 25000 base pairs of foreign DNA. Gene 25, 21-28.[Medline]

Spaan, W., Delius, H., Skinner, M., Armstrong, J., Rottier, P., Smeekens, S., van der Zeijst, B. A. & Siddell, S. G. (1983). Coronavirus mRNA synthesis involves fusion of non-contiguous sequences. EMBO Journal 2, 1839-1844.[Medline]

Stalcup, R. P., Baric, R. S. & Leibowitz, J. L. (1998). Genetic complementation among three panels of mouse hepatitis virus gene 1 mutants. Virology 241, 112-121.[Medline]

Thiel, V., Rashtchian, A., Herold, J., Schuster, D. M., Guan, N. & Siddell, S. G. (1997). Effective amplification of 20-kb DNA by reverse transcription PCR. Analytical Biochemistry 252, 62-70.[Medline]

van Marle, G., Dobbe, J. C., Gultyaev, A. P., Luytjes, W., Spaan, W. J. & Snijder, E. J. (1999). Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences. Proceedings of the National Academy of Sciences, USA 96, 12056-12061.[Abstract/Free Full Text]

Williams, G. D., Chang, R. Y. & Brian, D. A. (1999). A phylogenetically conserved hairpin-type 3' untranslated region pseudoknot functions in coronavirus RNA replication. Journal of Virology 73, 8349-8355.[Abstract/Free Full Text]

Yount, B., Curtis, K. M. & Baric, R. S. (2000). Strategy for systematic assembly of large RNA and DNA genomes: transmissible gastroenteritis virus model. Journal of Virology 74, 10600-10611.[Abstract/Free Full Text]

Ziebuhr, J., Snijder, E. J. & Gorbalenya, A. E. (2000). Virus-encoded proteinases and proteolytic processing in the Nidovirales. Journal of General Virology 81, 853-879.[Free Full Text]

Received 8 February 2001; accepted 12 March 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
J. K. Roth-Cross, H. Stokes, G. Chang, M. M. Chua, V. Thiel, S. R. Weiss, A. E. Gorbalenya, and S. G. Siddell
Organ-Specific Attenuation of Murine Hepatitis Virus Strain A59 by Replacement of Catalytic Residues in the Putative Viral Cyclic Phosphodiesterase ns2
J. Virol., April 15, 2009; 83(8): 3743 - 3753.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. K. Eriksson, L. Cervantes-Barragan, B. Ludewig, and V. Thiel
Mouse Hepatitis Virus Liver Pathology Is Dependent on ADP-Ribose-1''-Phosphatase, a Viral Function Conserved in the Alpha-Like Supergroup
J. Virol., December 15, 2008; 82(24): 12325 - 12334.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. F. Donaldson, B. Yount, A. C. Sims, S. Burkett, R. J. Pickles, and R. S. Baric
Systematic Assembly of a Full-Length Infectious Clone of Human Coronavirus NL63
J. Virol., December 1, 2008; 82(23): 11948 - 11957.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Tekes, R. Hofmann-Lehmann, I. Stallkamp, V. Thiel, and H.-J. Thiel
Genome Organization and Reverse Genetic Analysis of a Type I Feline Coronavirus
J. Virol., February 15, 2008; 82(4): 1851 - 1859.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Ziebuhr, B. Schelle, N. Karl, E. Minskaia, S. Bayer, S. G. Siddell, A. E. Gorbalenya, and V. Thiel
Human Coronavirus 229E Papain-Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replication
J. Virol., April 15, 2007; 81(8): 3922 - 3932.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Almazan, M. L. DeDiego, C. Galan, D. Escors, E. Alvarez, J. Ortego, I. Sola, S. Zuniga, S. Alonso, J. L. Moreno, et al.
Construction of a Severe Acute Respiratory Syndrome Coronavirus Infectious cDNA Clone and a Replicon To Study Coronavirus RNA Synthesis
J. Virol., November 1, 2006; 80(21): 10900 - 10906.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. O. Pasternak, W. J. M. Spaan, and E. J. Snijder
Nidovirus transcription: how to make sense...?
J. Gen. Virol., June 1, 2006; 87(6): 1403 - 1421.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. R. St-Jean, M. Desforges, F. Almazan, H. Jacomy, L. Enjuanes, and P. J. Talbot
Recovery of a Neurovirulent Human Coronavirus OC43 from an Infectious cDNA Clone.
J. Virol., April 1, 2006; 80(7): 3670 - 3674.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Minskaia, T. Hertzig, A. E. Gorbalenya, V. Campanacci, C. Cambillau, B. Canard, and J. Ziebuhr
Discovery of an RNA virus 3'->5' exoribonuclease that is critically involved in coronavirus RNA synthesis
PNAS, March 28, 2006; 103(13): 5108 - 5113.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
S. R. Weiss and S. Navas-Martin
Coronavirus Pathogenesis and the Emerging Pathogen Severe Acute Respiratory Syndrome Coronavirus
Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 635 - 664.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Putics, W. Filipowicz, J. Hall, A. E. Gorbalenya, and J. Ziebuhr
ADP-Ribose-1"-Monophosphatase: a Conserved Coronavirus Enzyme That Is Dispensable for Viral Replication in Tissue Culture
J. Virol., October 15, 2005; 79(20): 12721 - 12731.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Casais, M. Davies, D. Cavanagh, and P. Britton
Gene 5 of the Avian Coronavirus Infectious Bronchitis Virus Is Not Essential for Replication
J. Virol., July 1, 2005; 79(13): 8065 - 8078.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. S. Baric and A. C. Sims
Humanized mice develop coronavirus respiratory disease
PNAS, June 7, 2005; 102(23): 8073 - 8074.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Lassnig, C. M. Sanchez, M. Egerbacher, I. Walter, S. Majer, T. Kolbe, P. Pallares, L. Enjuanes, and M. Muller
From The Cover: Development of a transgenic mouse model susceptible to human coronavirus 229E
PNAS, June 7, 2005; 102(23): 8275 - 8280.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Schelle, N. Karl, B. Ludewig, S. G. Siddell, and V. Thiel
Selective Replication of Coronavirus Genomes That Express Nucleocapsid Protein
J. Virol., June 1, 2005; 79(11): 6620 - 6630.
[Abstract] [Full Text] [PDF]


Home page
BioinformaticsHome page
Z. R. Yang
Mining SARS-CoV protease cleavage data using non-orthogonal decision trees: a novel method for decisive template selection
Bioinformatics, June 1, 2005; 21(11): 2644 - 2650.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. E. Coley, E. Lavi, S. G. Sawicki, L. Fu, B. Schelle, N. Karl, S. G. Siddell, and V. Thiel
Recombinant Mouse Hepatitis Virus Strain A59 from Cloned, Full-Length cDNA Replicates to High Titers In Vitro and Is Fully Pathogenic In Vivo
J. Virol., March 1, 2005; 79(5): 3097 - 3106.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
H. Chen, A. Gill, B. K. Dove, S. R. Emmett, C. F. Kemp, M. A. Ritchie, M. Dee, and J. A. Hiscox
Mass Spectroscopic Characterization of the Coronavirus Infectious Bronchitis Virus Nucleoprotein and Elucidation of the Role of Phosphorylation in RNA Binding by Using Surface Plasmon Resonance
J. Virol., January 15, 2005; 79(2): 1164 - 1179.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
F. Almazan, C. Galan, and L. Enjuanes
The Nucleoprotein Is Required for Efficient Coronavirus Genome Replication
J. Virol., November 15, 2004; 78(22): 12683 - 12688.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Prentice, J. McAuliffe, X. Lu, K. Subbarao, and M. R. Denison
Identification and Characterization of Severe Acute Respiratory Syndrome Coronavirus Replicase Proteins
J. Virol., September 15, 2004; 78(18): 9977 - 9986.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. A. Ivanov, T. Hertzig, M. Rozanov, S. Bayer, V. Thiel, A. E. Gorbalenya, and J. Ziebuhr
Major genetic marker of nidoviruses encodes a replicative endoribonuclease
PNAS, August 24, 2004; 101(34): 12694 - 12699.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. R. St-Jean, H. Jacomy, M. Desforges, A. Vabret, F. Freymuth, and P. J. Talbot
Human Respiratory Coronavirus OC43: Genetic Stability and Neuroinvasion
J. Virol., August 15, 2004; 78(16): 8824 - 8834.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
T. Hertzig, E. Scandella, B. Schelle, J. Ziebuhr, S. G. Siddell, B. Ludewig, and V. Thiel
Rapid identification of coronavirus replicase inhibitors using a selectable replicon RNA
J. Gen. Virol., June 1, 2004; 85(6): 1717 - 1725.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. A. Ivanov, V. Thiel, J. C. Dobbe, Y. van der Meer, E. J. Snijder, and J. Ziebuhr
Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase
J. Virol., June 1, 2004; 78(11): 5619 - 5632.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. A. M. de Haan, L. van Genne, J. N. Stoop, H. Volders, and P. J. M. Rottier
Coronaviruses as Vectors: Position Dependence of Foreign Gene Expression
J. Virol., November 1, 2003; 77(21): 11312 - 11323.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Yount, K. M. Curtis, E. A. Fritz, L. E. Hensley, P. B. Jahrling, E. Prentice, M. R. Denison, T. W. Geisbert, and R. S. Baric
Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus
PNAS, October 28, 2003; 100(22): 12995 - 13000.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Ontiveros, T. S. Kim, T. M. Gallagher, and S. Perlman
Enhanced Virulence Mediated by the Murine Coronavirus, Mouse Hepatitis Virus Strain JHM, Is Associated with a Glycine at Residue 310 of the Spike Glycoprotein
J. Virol., October 1, 2003; 77(19): 10260 - 10269.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
V. Thiel, N. Karl, B. Schelle, P. Disterer, I. Klagge, and S. G. Siddell
Multigene RNA Vector Based on Coronavirus Transcription
J. Virol., September 15, 2003; 77(18): 9790 - 9798.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Thiel, K. A. Ivanov, A. Putics, T. Hertzig, B. Schelle, S. Bayer, B. Weissbrich, E. J. Snijder, H. Rabenau, H. W. Doerr, et al.
Mechanisms and enzymes involved in SARS coronavirus genome expression
J. Gen. Virol., September 1, 2003; 84(9): 2305 - 2315.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Escors, A. Izeta, C. Capiscol, and L. Enjuanes
Transmissible Gastroenteritis Coronavirus Packaging Signal Is Located at the 5' End of the Virus Genome
J. Virol., July 15, 2003; 77(14): 7890 - 7902.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Kanjanahaluethai, D. Jukneliene, and S. C. Baker
Identification of the Murine Coronavirus MP1 Cleavage Site Recognized by Papain-Like Proteinase 2
J. Virol., July 1, 2003; 77(13): 7376 - 7382.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. J. Haijema, H. Volders, and P. J. M. Rottier
Switching Species Tropism: an Effective Way To Manipulate the Feline Coronavirus Genome
J. Virol., April 15, 2003; 77(8): 4528 - 4538.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
I. Sola, S. Alonso, S. Zuniga, M. Balasch, J. Plana-Duran, and L. Enjuanes
Engineering the Transmissible Gastroenteritis Virus Genome as an Expression Vector Inducing Lactogenic Immunity
J. Virol., April 1, 2003; 77(7): 4357 - 4369.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Yount, M. R. Denison, S. R. Weiss, and R. S. Baric
Systematic Assembly of a Full-Length Infectious cDNA of Mouse Hepatitis Virus Strain A59
J. Virol., October 2, 2002; 76(21): 11065 - 11078.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Kuo and P. S. Masters
Genetic Evidence for a Structural Interaction between the Carboxy Termini of the Membrane and Nucleocapsid Proteins of Mouse Hepatitis Virus
J. Virol., April 16, 2002; 76(10): 4987 - 4999.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. M. Gonzalez, Z. Penzes, F. Almazan, E. Calvo, and L. Enjuanes
Stabilization of a Full-Length Infectious cDNA Clone of Transmissible Gastroenteritis Coronavirus by Insertion of an Intron
J. Virol., March 27, 2002; 76(9): 4655 - 4661.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Alonso, I. Sola, J. P. Teifke, I. Reimann, A. Izeta, M. Balasch, J. Plana-Duran, R. J. M. Moormann, and L. Enjuanes
In vitro and in vivo expression of foreign genes by transmissible gastroenteritis coronavirus-derived minigenomes
J. Gen. Virol., March 1, 2002; 83(3): 567 - 579.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Hegyi, A. Friebe, A. E. Gorbalenya, and J. Ziebuhr
Mutational analysis of the active centre of coronavirus 3C-like proteases
J. Gen. Virol., March 1, 2002; 83(3): 581 - 593.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Hegyi and J. Ziebuhr
Conservation of substrate specificities among coronavirus main proteases
J. Gen. Virol., March 1, 2002; 83(3): 595 - 599.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Alonso, A. Izeta, I. Sola, and L. Enjuanes
Transcription Regulatory Sequences and mRNA Expression Levels in the Coronavirus Transmissible Gastroenteritis Virus
J. Virol., February 1, 2002; 76(3): 1293 - 1308.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Casais, V. Thiel, S. G. Siddell, D. Cavanagh, and P. Britton
Reverse Genetics System for the Avian Coronavirus Infectious Bronchitis Virus
J. Virol., December 15, 2001; 75(24): 12359 - 12369.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
V. Thiel, J. Herold, B. Schelle, and S. G. Siddell
Viral Replicase Gene Products Suffice for Coronavirus Discontinuous Transcription
J. Virol., July 15, 2001; 75(14): 6676 - 6681.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Ziebuhr, V. Thiel, and A. E. Gorbalenya
The Autocatalytic Release of a Putative RNA Virus Transcription Factor from Its Polyprotein Precursor Involves Two Paralogous Papain-like Proteases That Cleave the Same Peptide Bond
J. Biol. Chem., August 24, 2001; 276(35): 33220 - 33232.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Thiel, V.
Right arrow Articles by Siddell, S. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Thiel, V.
Right arrow Articles by Siddell, S. G.
Agricola
Right arrow Articles by Thiel, V.
Right arrow Articles by Siddell, S. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS