|
|
||||||||
Animal: RNA Viruses |
Institute of Virology and Immunology, University of Würzburg, Versbacher Straße 7, 97078 Würzburg, Germany1
Author for correspondence: Stuart Siddell. Fax +49 931 201 3970. e-mail siddell{at}vim.uni-wuerzburg.de
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Until recently, the study of coronavirus genetics was essentially restricted to the analysis of temperature-sensitive (ts) mutants (Lai & Cavanagh, 1997
; Stalcup et al., 1998
), the analysis of defective RNA templates that depend upon replicase proteins provided by a helper virus (Repass & Makino, 1998
; Izeta et al., 1999
; Williams et al., 1999
) and the analysis of chimeric viruses generated by targetted recombination (Fischer et al., 1997
; Hsue & Masters, 1999
; Kuo et al., 2000
). This was because the large size of the coronavirus genome and the instability of some coronavirus cDNAs in bacteria effectively precluded the use of cloning procedures that have been used to generate infectious RNA from cDNA copies of other positive-strand RNA virus genomes (Ruggli & Rice, 1999
). Recently, however, two different approaches have been developed that appear to overcome these problems. Firstly, Almazán et al. (2000)
have reported that the cloning of full-length, transmissible gastroenteritis virus (TGEV) cDNA in a bacterial artificial chromosome, combined with nuclear expression of infectious RNA, can be used to produce recombinant virus. Secondly, Yount et al. (2000)
have described a system to assemble a full-length cDNA construct of the TGEV genome by using adjoining cDNA subclones that have unique, flanking, interconnecting junctions. Transcripts derived from the TGEV cDNA assembled in this way can be used to derive infectious recombinant virus.
Despite the remarkable achievements of Almazán et al. (2000)
and Yount et al. (2000)
, we have been unable to construct a stable, full-length cDNA copy of the genome of either the human coronavirus strain 229E (HCoV) or murine hepatitis virus (MHV) using plasmids, bacterial artificial chromosomes, bacteriophage vectors or an in vitro approach based upon long-range RTPCR (Thiel et al., 1997
; Herold et al., 1998
). We, therefore, decided to pursue an alternative strategy based upon the optimization of in vitro DNA ligation, the use of vaccinia virus as a eukaryotic cloning vector and the cytoplasmic expression of transfected RNA that has been transcribed in vitro. We reasoned that this approach would have several advantages. Firstly, poxvirus vectors are eminently suitable for the cloning of large cDNAs. It has been shown that they have the capacity to accept at least 26 kbp of foreign DNA (Smith & Moss, 1983
) and recombinant vaccinia genomes of this size are stable, infectious and replicate in tissue culture to the same titre as non-recombinant virus. Secondly, vaccinia virus vectors have been developed that are designed for the insertion of foreign DNA by in vitro ligation (Merchlinsky & Moss, 1992
). This obviates the need for plasmid intermediates carrying the entire cDNA insert. Thirdly, using this approach, recombinant virus is recovered from an infectious RNA that is introduced and replicates in the cytoplasm of the transfected cell. Thus, there are no concerns regarding RNA modification, processing and export from or degradation within the nucleus.
In this study, we show that human coronavirus cDNA fragments of more than 27 kbp can be stably cloned and propagated in vaccinia virus. Moreover, a recombinant vaccinia virus clone, containing a full-length HCoV cDNA, enabled us to produce infectious in vitro RNA transcripts and to rescue recombinant human coronavirus.
| Methods |
|---|
|
|
|---|
Cells and virus and RNA transfection.
Transfection.
CV-1 cells were grown to 80% confluence and transfected for 2 h at 37 °C with 15 µg in vitro-ligated DNA and 10 µl lipofectin in OPTIMEM 1, according to the suppliers instructions (Life Technologies). MRC-5 cells were grown to 80% confluence and transfected for 30 min at 37 °C with 1 µg in vitro-transcribed RNA and 10 µl lipofectin in OPTIMEM 1, according to the suppliers instructions.
Preparation of poly(A)-containing RNA and preparative RTPCR.
Poly(A)-containing RNA was isolated from coronavirus-infected MRC-5 cells by using oligo(dT)25 Dynabeads as described by Thiel et al. (1997
). RTPCR was also done as described by Thiel et al. (1997)
with Superscript II reverse transcriptase (Life Technologies) and native Pfu thermostable DNA polymerase (Stratagene). To produce the DNA fragment PCR-BF, three oligonucleotide primers were used: 5' CTACTCACGATATCGTAC 3' (nt 78407858, reverse transcription), 5' AGTTGGTGTTATTGCTGATAAGGAC 3' (nt 51765200, PCR) and 5' GACATAGGCCGGCCCTGTTGGTTGCACATTTGTTTTGGT 3' (nt 69687006, PCR). The PCR-BF fragment comprises 1830 bp representing positions 51767006 in the HCoV genome. The PCR-BF fragment is flanked by a natural 5' BglII site (nt 52035208) and a 3' FseI site present in the PCR primer (nt 69937000). In order to identify diagnostic mutations in the recombinant HCoV genome, three oligonucleotides primers were used: 5' CTACTCACGATATCGTAC 3' (nt 78407858, reverse transcription), 5' CAACTTGATGAAAAGGCAC 3' (nt 60326050, PCR) and 5' AACCTCTTTGCAAGAATACTTGCT 3' (nt 70947117, PCR and sequencing).
Gel electrophoresis.
RNAs were fractionated by electrophoresis in 0·8% agarose/TBE gels containing 0·1% SDS (TBE is 89 mM TrisHCl, 89 mM borate, 2 mM EDTA, pH 8·3). Smaller DNA fragments were resolved by electrophoresis in 0·61·0% agarose/TBE gels. Larger DNA fragments were resolved by pulsed-field gel electrophoresis in the CHEF-DR III system (Bio-Rad) using 1% agarose/0·5xTBE gels at 14 °C with a switch time of 330 s, a run time of 18 h and 6 V/cm at an angle of 120°. RNA and large DNA samples were heated to 65 °C for 10 min prior to electrophoresis. Gels were stained with ethidium bromide after electrophoresis.
Northern and Southern blots, PCR and sequence analysis.
Poly(A)+ RNA from HCoV-infected MRC-5 cells was electrophoresed on 2·2 M formaldehyde1% agarose gels. The gels were dried and hybridized to 5'-end 32P-labelled oligonucleotides as described by Meinkoth & Wahl (1984)
. The oligonucleotide 5' AGAAACTTCATCACGCACTGG 3' (nt 2680226822) was used to detect HCoV genomic and subgenomic RNAs. The oligonucleotide 5' ACATACGCTGGGCCTGTT 3' (nt 69887005) was used to detect the parental HCoV 229E genomic RNA. The oligonucleotide 5' ACATAGGCCGGCCCTGTT 3' (nt 69887005) was used to detect the recombinant HCoV-inf-1 genomic RNA.
CV-1 cells (1x105) were infected with parental or recombinant vaccinia virus and incubated until cytopathic effects were evident. The cells were harvested and incubated for 2 h at 50 °C with 200 µl proteinase K buffer (0·1 mg/ml proteinase K in 100 mM TrisHCl, pH 7·5, 5 mM EDTA, 0·2% SDS, 200 mM NaCl). The digest was then deproteinized with phenolchloroform extraction and precipitated with ethanol. The DNA was digested overnight at 37 °C with HindIII and the resulting fragments were electrophoresed and transferred to nylon membranes as described by Ausubel et al. (1987)
. The Multiprime DNA-labelling system was used as recommended by the supplier (Amersham) to produce two 32P-labelled probes from DNA templates. The templates were a 19 kb RTPCR product corresponding to nt 104820582 of the HCoV genome and a PCR product corresponding to nt 2385026822 (V. Thiel, unpublished). The probes were mixed and hybridized to the immobilized DNA fragments by standard methods (Ausubel et al., 1987
).
In addition to Southern blot analysis, recombinant vaccinia virus DNAs were screened by PCR analysis. To do this, DNA from infected CV-1 cells was prepared as described above and used as a template for a standard PCR using thermostable Taq DNA polymerase and the oligonucleotides 5' CCAGGCTGGAGTCTGCAG 3' (nt 2249122508) and 5' GACAACTAGGTCTGGAAC 3' (nt 2372323740).
Sequencing of plasmid constructs, RTPCR products and the recombinant vaccinia virus cDNA insert was done by standard cycle-sequencing methods using the BigDye Terminator kit (Applied Biosystems). The analysis of sequencing products was done by capillary electrophoresis using an ABI 310 PRISM Genetic Analyser. Computer-assisted analysis of sequence data was facilitated by the LASERGENE bio-computing software (DNASTAR).
Plasmid construction.
Plasmids were constructed from a library of HCoV 229E cDNA clones and RTPCR products by standard procedures (Ausubel et al., 1987
). The precise details of these procedures are available from the authors upon request. The plasmid pEB is based on pBluescript II KS+ and contains sequences corresponding to nt 15207 of the HCoV 229E genome, preceded by an additional G nucleotide, the sequence for the bacteriophage T7 RNA polymerase promoter and Bsp120I and EagI restriction sites. The plasmids pME and pFE are based on pBR322. pFE contains sequences corresponding to nt 699320569 of the HCoV genome followed by the green fluorescent protein gene, HCoV 229E sequences from nt 26279 to 27277, a synthetic poly(A) tail of approximately 40 nt and ClaI, Bsp120I and EagI restriction sites. The nucleotides at positions 6994, 6997 and 7000 of pFE were mutated from their original sequence. These mutations result in a silent FseI site that is useful for both cloning and diagnostic purposes. pME contains sequences corresponding to nt 1267727277 of the HCoV 229E genome, a synthetic poly(A) tail of approximately 40 nt and restriction sites for ClaI, Bsp120I and EagI.
Cloning in vaccinia virus.
Plasmid and RTPCR DNA fragments were purified with QIAEX II resin following separation by agarose gel electrophoresis. Ligation reactions containing vaccinia virus DNA were analysed by pulsed-field agarose gel electrophoresis. Ligation reactions containing NotI were incubated for 16 h at 25 °C in the recommended digestion buffer (New England Biolabs) supplemented with 1 mM ATP. Subsequently, the T4 DNA ligase was heat-inactivated and the incubation was continued for an additional hour at 37 °C with additional NotI enzyme.
Construction of the full-length HCoV cDNA was carried out in two steps (Fig. 1
). Firstly, cDNA insert fragments EB and FE were derived from the plasmids pEB and pFE by digestion with EagI/BglII and FseI/EagI, respectively, and treated with alkaline phosphatase. Fragment EB was then ligated with PCR-BF that had been digested with BglII. The resulting 7 kbp ligation product was digested with FseI, purified by agarose gel electrophoresis and ligated with fragment FE to produce a 22·5 kbp cDNA. This cDNA fragment was ligated without further purification to vNotI/tk vaccinia virus DNA in the presence of NotI enzyme. The ligation products were then transfected with lipofectin into CV-1 cells that had been infected 1 h previously with fowlpox virus at an m.o.i. of 5. Two h later, the cells were harvested and replated into 96-well tissue culture dishes with a 4-fold excess of non-transfected, non-infected CV-1 cells. Recombinant vaccinia viruses were isolated from 96 wells that developed cytopathic effect within 2 weeks, plaque purified and analysed by PCR and Southern blots. The sequence of the 22·5 kbp cDNA insert was determined from one such recombinant vaccinia virus, vHCoV-vec-1 (V. Thiel, unpublished results). In a second phase, a cDNA fragment of 22·5 kbp was obtained by digestion of purified vHCoV-vec-1 genomic DNA with Bsp120I, dephosphorylated by alkaline phosphatase and purified by gel electrophoresis. After digestion with MluI and heat inactivation of the MluI enzyme, the resulting fragments of 12·7 and 9·6 kbp were ligated to a cDNA fragment of pME that was obtained by digestion with MluI/EagI, treatment with alkaline phosphatase and purification by gel electrophoresis. This produced, amongst other products, a 27·3 kbp cDNA fragment containing the full-length cDNA of the HCoV 229E genome. The ligation products were then ligated to vNotI/tk vaccinia virus DNA without further purification in the presence of NotI enzyme. By using the rescue procedure described above, a recombinant vaccinia virus, vHCoV-inf-1, was recovered, plaque purified and characterized by PCR and Southern blot analysis. The sequence of the 27·3 kbp cDNA insert of vaccinia virus vHCoV-inf-1 was determined and has been deposited in the GenBank database.
|
In vitro transcription.| Results |
|---|
|
|
|---|
|
In a second phase, the vHCoV-vec-1 genomic DNA was used to produce a fragment, BM, that essentially encompassed the HCoV 5' NTR and the replicase ORF 1a. The plasmid pME was used to produce a cDNA fragment that encompasses the remainder of the genome (Fig. 1a
). These fragments, together with vaccinia virus vNotI/tk vector DNA, were ligated in vitro in the presence of NotI enzyme. The reason for adding NotI is that it favours the accumulation of recombinant vaccinia virus genomes, rather than the parental vaccinia virus genome (V. Thiel, unpublished results). The ligation reaction products were then used to recover recombinant vaccinia virus plaques as described in Methods. We obtained more than 50 vaccinia virus plaques and analysed 16 of them by PCR. Fig. 1
(b
) shows that, of these 16 plaques, five contained coronavirus cDNA inserts that included the structural surface protein gene. Southern blot analysis of the genomic DNA of these five recombinant vaccinia viruses indicated that they all contained single-copy, full-length HCoV cDNA (data not shown). Further analysis of two clones, vHCoV-inf-1 and vHCoV-inf-2 (Fig. 1c
, lanes 2 and 3), confirmed the integrity and orientations of the inserts. Finally, the 27·3 kbp cDNA insert of vHCoV-inf-1 was sequenced and found to be as predicted; this sequence has been deposited in GenBank. Although the insert cDNA of vHCoV-inf-1 exceeds the length of any insert cloned so far into the vaccinia virus genome, this recombinant clone remained stable and infectious and replicated in tissue culture at the same rate and to same titre as standard vaccinia virus (data not shown).
Recovery of a recombinant human coronavirus
To recover a recombinant human coronavirus, we prepared genomic DNA from purified vaccinia virus vHCoV-inf-1, cleaved this DNA with ClaI enzyme and transcribed capped RNA in vitro using bacteriophage T7 RNA polymerase. As is shown in Fig. 3
(a
), in vitro transcription of this DNA at 25 °C gave both a reasonable amount (approximately 50 µg per reaction) and a high proportion of full-length (i.e. 27·3 kb) RNA. We found that higher or lower temperatures were detrimental to the integrity and/or the yield of the RNA transcripts (data not shown). When this RNA was transfected into MRC-5 cells using lipofection as described in Methods, cytopathic effects characteristic of human coronavirus infection developed throughout the culture after 67 days. A virus, which we have designated HCoV-inf-1, was recovered from the tissue culture supernatant, plaque purified and propagated by three or four undiluted passages in MRC-5 cells to produce stocks containing approximately 1x107 TCID50/ml. The growth kinetics, cytopathic effect and stability of the recovered virus were indistinguishable from those of parental virus (data not shown). These stocks were then used to infect MRC-5 cells at an m.o.i. of 5 and poly(A)-containing RNA was isolated for Northern hybridization analysis. As shown in Fig. 3
(b
), the patterns of genomic and subgenomic RNAs synthesized in HCoV 229E- and HCoV-inf-1-infected cells were identical. Specifically, the characteristic pattern of HCoV genomic and subgenomic mRNAs (RNA1, 27·3 kb; RNA2, 6·8 kb; RNA3, 5·2 kb; RNA4, 3·3 kb; RNA5, 2·6 kb; RNA6, 2·4 kb; RNA7, 1·7 kb) accumulated in both infections with the same kinetics in non-equimolar but constant ratios.
|
| Discussion |
|---|
|
|
|---|
The basis of the approach taken in this study is the use of vaccinia virus as a cloning vector for large cDNA inserts. In this respect, we believe the vaccinia virus system has a number of advantages. Firstly, we have never observed instability of the cloned insert cDNA in the vaccinia virus system. This is in marked contrast to our experience with bacterial systems, where we regularly encounter instability (for example, the insertion of foreign sequences, the deletion of nucleotides, the rearrangement of inserts and the occurrence of single nucleotide changes) when handling large cDNA clones encompassing specific regions of the coronavirus genome. Furthermore, irrespective of the size of the cDNA insert, we have not seen any differences in the infectivity, growth kinetics or stability of the recombinant vaccinia viruses compared to the parental virus. Secondly, we have shown that large cDNA fragments, assembled by in vitro ligation using plasmid DNA, RTPCR DNA or recombinant vaccinia virus cDNA, can be cloned efficiently into the vaccinia virus genome. By incorporating the NotI enzyme in the ligation reactions, we have found that more that 90% of recovered vaccinia viruses are recombinant. This protocol facilitates the isolation of recombinant vaccinia virus clones without the need for selection, it obviates the need for plasmid intermediates carrying full-length insert cDNAs and it represents a very flexible way of introducing defined mutations into large cDNA clones. To improve the system further, we think that it should also be possible to introduce specific mutations rapidly into the cloned viral cDNA by using vaccinia virus-mediated homologous recombination (Moss, 1996
) and we hope that it will be possible to develop simplified procedures for the recovery of recombinant coronaviruses from recombinant vaccinia virus genomes. This should then result in a straightforward and universal reverse-genetic approach for RNA viruses with large genomes, such as coronaviruses, closteroviruses (Mawassi et al., 2000
) and okaviruses (Cowley et al., 2000
).
The reverse-genetic system we have developed will be useful in a number of areas. It will greatly facilitate the analysis of coronavirus RNA replication and transcription. For example, Sawicki and colleagues have recently characterized the phenotypes and genotypes of a collection of temperature-sensitive (ts) MHV mutants that are unable to synthesize RNA at the restrictive temperature (S. Sawicki, personal communication). The valuable information obtained by this classical approach can now be complemented by a reverse-genetic approach. Moreover, the system we describe also facilitates, in principle, the analysis of coronavirus replication, independent of the virus life-cycle and without the requirement for receptor-mediated infection. Thus, it can be put to great advantage in the analysis of the virushost cell interaction in the context of virus replication, transcription, assembly and release.
Secondly, the system we describe will complement existing methods of producing recombinant coronaviruses (Masters, 1999
; Almazán et al., 2000
; Yount et al., 2000
) and significantly advance the analysis of coronavirus pathogenesis. With the systems now available, it should be possible to generate rapidly a large collection of genetically modified coronaviruses; for example, intra- and interspecific chimeric viruses, viruses with gene inactivations or deletions and viruses with attenuating modifications or supplementary functions. The phenotypes associated with these modifications, at least those that are not lethal, can then be tested in animal models of infection. In particular, this should provide important insights into the relationship between coronavirus infection and the immune response.
Finally, the results we present should also encourage the development of coronavirus vectors for the expression of heterologous proteins. In the long term, we believe that the expression of multiple subgenomic mRNAs in coronavirus-infected cells could form the basis of a vector system that allows the expression of multiple transcriptional units, each encoding a heterologous protein. These features and the autonomy of coronavirus RNA replication could then be exploited in the development of a new class of RNA vaccine vectors (Bredenbeek & Rice, 1992
; Mandl et al., 1998
).
| Acknowledgments |
|---|
| Footnotes |
|---|
b Present address: SWITCH-Biotech AG, Fraunhofer Straße 10, 82152 Martinsried, Germany. ![]()
| References |
|---|
|
|
|---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. D., Smith, J. A. & Struhl, K. (editors) (1987). Current Protocols in Molecular Biology. New York: John Wiley.
Bredenbeek, P. J. & Rice, C. M. (1992). Animal RNA virus expression systems. Seminars in Virology 3, 297-310.
Cowley, J. A., Dimmock, C. M., Spann, K. M. & Walker, P. J. (2000). Gill-associated virus of Penaeus monodon prawns: an invertebrate virus with ORF1a and ORF1b genes related to arteri- and coronaviruses. Journal of General Virology 81, 1473-1484.
Fischer, F., Stegen, C. F., Koetzner, C. A. & Masters, P. S. (1997). Analysis of a recombinant mouse hepatitis virus expressing a foreign gene reveals a novel aspect of coronavirus transcription. Journal of Virology 71, 5148-5160.[Abstract]
Herold, J., Raabe, T., Schelle-Prinz, B. & Siddell, S. G. (1993). Nucleotide sequence of the human coronavirus 229E RNA polymerase locus. Virology 195, 680-691.[Medline]
Herold, J., Thiel, V. & Siddell, S. G. (1998). A strategy for the generation of infectious RNAs and autonomously replicating RNAs based on the HCV 229E genome. Advances in Experimental Medicine and Biology 440, 265-268.[Medline]
Hsue, B. & Masters, P. S. (1999). Insertion of a new transcriptional unit into the genome of mouse hepatitis virus. Journal of Virology 73, 6128-6135.
Izeta, A., Smerdou, C., Alonso, S., Pénzes, Z., Mendez, A., Plana-Durán, J. & Enjuanes, L. (1999). Replication and packaging of transmissible gastroenteritis coronavirus-derived synthetic minigenomes. Journal of Virology 73, 1535-1545.
Kuo, L., Godeke, G. J., Raamsman, M. J., Masters, P. S. & Rottier, P. J. (2000). Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier. Journal of Virology 74, 1393-1406.
Lai, M. M. C. & Cavanagh, D. (1997). The molecular biology of coronaviruses. Advances in Virus Research 48, 1-100.
McIntosh, K. (1996). Coronaviruses. In Fields Virology , pp. 1095-1103. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterisation of vaccinia virus recombinants expressing foreign genes. In DNA Cloning: a Practical Approach , pp. 191-211. Edited by D. M. Glover. Oxford:IRL Press.
Mandl, C. W., Aberle, J. H., Aberle, S. W., Holzmann, H., Allison, S. L. & Heinz, F. X. (1998). In vitro-synthesized infectious RNA as an attenuated live vaccine in a flavivirus model. Nature Medicine 4, 1438-1440.[Medline]
Masters, P. S. (1999). Reverse genetics of the largest RNA viruses. Advances in Virus Research 53, 245-264.[Medline]
Mawassi, M., Satyanarayana, T., Gowda, S., Albiach-Marti, M. R., Robertson, C. & Dawson, W. O. (2000). Replication of heterologous combinations of helper and defective RNA of citrus tristeza virus. Virology 267, 360-369.[Medline]
Mayr, A. & Malicki, K. (1966). Attenuation of virulent fowlpox virus in tissue culture and characteristics of the attenuated virus. Zentralblatt für Veterinärmedizin 13, 113 (in German).
Meinkoth, J. & Wahl, G. (1984). Hybridization of nucleic acids immobilized on solid supports. Analytical Biochemistry 138, 267-284.[Medline]
Merchlinsky, M. & Moss, B. (1992). Introduction of foreign DNA into the vaccinia virus genome by in vitro ligation: recombination-independent selectable cloning vectors. Virology 190, 522-526.[Medline]
Moss, B. (1996). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2637-2671. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Myint, S., Harmsen, D., Raabe, T. & Siddell, S. G. (1990). Characterization of a nucleic acid probe for the diagnosis of human coronavirus 229E infections. Journal of Medical Virology 31, 165-172.[Medline]
Raabe, T. & Siddell, S. (1989a). Nucleotide sequence of the human coronavirus HCV 229E mRNA 4 and mRNA 5 unique regions. Nucleic Acids Research 17, 6387.
Raabe, T. & Siddell, S. G. (1989b). Nucleotide sequence of the gene encoding the membrane protein of human coronavirus 229 E. Archives of Virology 107, 323-328.[Medline]
Raabe, T., Schelle-Prinz, B. & Siddell, S. G. (1990). Nucleotide sequence of the gene encoding the spike glycoprotein of human coronavirus HCV 229E. Journal of General Virology 71, 1065-1073.
Repass, J. F. & Makino, S. (1998). Importance of the positive-strand RNA secondary structure of a murine coronavirus defective interfering RNA internal replication signal in positive-strand RNA synthesis. Journal of Virology 72, 7926-7933.
Ruggli, N. & Rice, C. M. (1999). Functional cDNA clones of the Flaviviridae: strategies and applications. Advances in Virus Research 53, 183-207.[Medline]
Sawicki, S. G. & Sawicki, D. L. (1998). A new model for coronavirus transcription. Advances in Experimental Medicine and Biology 440, 215-219.[Medline]
Siddell, S. G. & Snijder, E. J. (1998). Coronaviruses, toroviruses and arteriviruses. In Topley & Wilsons Microbiology and Microbial Infections , pp. 463-484. Edited by B. W. J. Mahy & L. Collier. London:Arnold.
Smith, G. L. & Moss, B. (1983). Infectious poxvirus vectors have capacity for at least 25000 base pairs of foreign DNA. Gene 25, 21-28.[Medline]
Spaan, W., Delius, H., Skinner, M., Armstrong, J., Rottier, P., Smeekens, S., van der Zeijst, B. A. & Siddell, S. G. (1983). Coronavirus mRNA synthesis involves fusion of non-contiguous sequences. EMBO Journal 2, 1839-1844.[Medline]
Stalcup, R. P., Baric, R. S. & Leibowitz, J. L. (1998). Genetic complementation among three panels of mouse hepatitis virus gene 1 mutants. Virology 241, 112-121.[Medline]
Thiel, V., Rashtchian, A., Herold, J., Schuster, D. M., Guan, N. & Siddell, S. G. (1997). Effective amplification of 20-kb DNA by reverse transcription PCR. Analytical Biochemistry 252, 62-70.[Medline]
van Marle, G., Dobbe, J. C., Gultyaev, A. P., Luytjes, W., Spaan, W. J. & Snijder, E. J. (1999). Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences. Proceedings of the National Academy of Sciences, USA 96, 12056-12061.
Williams, G. D., Chang, R. Y. & Brian, D. A. (1999). A phylogenetically conserved hairpin-type 3' untranslated region pseudoknot functions in coronavirus RNA replication. Journal of Virology 73, 8349-8355.
Yount, B., Curtis, K. M. & Baric, R. S. (2000). Strategy for systematic assembly of large RNA and DNA genomes: transmissible gastroenteritis virus model. Journal of Virology 74, 10600-10611.
Ziebuhr, J., Snijder, E. J. & Gorbalenya, A. E. (2000). Virus-encoded proteinases and proteolytic processing in the Nidovirales. Journal of General Virology 81, 853-879.
Received 8 February 2001;
accepted 12 March 2001.
This article has been cited by other articles:
![]() |
G. Tekes, R. Hofmann-Lehmann, I. Stallkamp, V. Thiel, and H.-J. Thiel Genome Organization and Reverse Genetic Analysis of a Type I Feline Coronavirus J. Virol., February 15, 2008; 82(4): 1851 - 1859. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ziebuhr, B. Schelle, N. Karl, E. Minskaia, S. Bayer, S. G. Siddell, A. E. Gorbalenya, and V. Thiel Human Coronavirus 229E Papain-Like Proteases Have Overlapping Specificities but Distinct Functions in Viral Replication J. Virol., April 15, 2007; 81(8): 3922 - 3932. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Almazan, M. L. DeDiego, C. Galan, D. Escors, E. Alvarez, J. Ortego, I. Sola, S. Zuniga, S. Alonso, J. L. Moreno, et al. Construction of a Severe Acute Respiratory Syndrome Coronavirus Infectious cDNA Clone and a Replicon To Study Coronavirus RNA Synthesis J. Virol., November 1, 2006; 80(21): 10900 - 10906. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. O. Pasternak, W. J. M. Spaan, and E. J. Snijder Nidovirus transcription: how to make sense...? J. Gen. Virol., June 1, 2006; 87(6): 1403 - 1421. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. St-Jean, M. Desforges, F. Almazan, H. Jacomy, L. Enjuanes, and P. J. Talbot Recovery of a Neurovirulent Human Coronavirus OC43 from an Infectious cDNA Clone. J. Virol., April 1, 2006; 80(7): 3670 - 3674. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Minskaia, T. Hertzig, A. E. Gorbalenya, V. Campanacci, C. Cambillau, B. Canard, and J. Ziebuhr Discovery of an RNA virus 3'->5' exoribonuclease that is critically involved in coronavirus RNA synthesis PNAS, March 28, 2006; 103(13): 5108 - 5113. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Weiss and S. Navas-Martin Coronavirus Pathogenesis and the Emerging Pathogen Severe Acute Respiratory Syndrome Coronavirus Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 635 - 664. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Putics, W. Filipowicz, J. Hall, A. E. Gorbalenya, and J. Ziebuhr ADP-Ribose-1"-Monophosphatase: a Conserved Coronavirus Enzyme That Is Dispensable for Viral Replication in Tissue Culture J. Virol., October 15, 2005; 79(20): 12721 - 12731. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Casais, M. Davies, D. Cavanagh, and P. Britton Gene 5 of the Avian Coronavirus Infectious Bronchitis Virus Is Not Essential for Replication J. Virol., July 1, 2005; 79(13): 8065 - 8078. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Baric and A. C. Sims Humanized mice develop coronavirus respiratory disease PNAS, June 7, 2005; 102(23): 8073 - 8074. [Full Text] [PDF] |
||||
![]() |
C. Lassnig, C. M. Sanchez, M. Egerbacher, I. Walter, S. Majer, T. Kolbe, P. Pallares, L. Enjuanes, and M. Muller From The Cover: Development of a transgenic mouse model susceptible to human coronavirus 229E PNAS, June 7, 2005; 102(23): 8275 - 8280. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schelle, N. Karl, B. Ludewig, S. G. Siddell, and V. Thiel Selective Replication of Coronavirus Genomes That Express Nucleocapsid Protein J. Virol., June 1, 2005; 79(11): 6620 - 6630. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. R. Yang Mining SARS-CoV protease cleavage data using non-orthogonal decision trees: a novel method for decisive template selection Bioinformatics, June 1, 2005; 21(11): 2644 - 2650. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Coley, E. Lavi, S. G. Sawicki, L. Fu, B. Schelle, N. Karl, S. G. Siddell, and V. Thiel Recombinant Mouse Hepatitis Virus Strain A59 from Cloned, Full-Length cDNA Replicates to High Titers In Vitro and Is Fully Pathogenic In Vivo J. Virol., March 1, 2005; 79(5): 3097 - 3106. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, A. Gill, B. K. Dove, S. R. Emmett, C. F. Kemp, M. A. Ritchie, M. Dee, and J. A. Hiscox Mass Spectroscopic Characterization of the Coronavirus Infectious Bronchitis Virus Nucleoprotein and Elucidation of the Role of Phosphorylation in RNA Binding by Using Surface Plasmon Resonance J. Virol., January 15, 2005; 79(2): 1164 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Almazan, C. Galan, and L. Enjuanes The Nucleoprotein Is Required for Efficient Coronavirus Genome Replication J. Virol., November 15, 2004; 78(22): 12683 - 12688. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Prentice, J. McAuliffe, X. Lu, K. Subbarao, and M. R. Denison Identification and Characterization of Severe Acute Respiratory Syndrome Coronavirus Replicase Proteins J. Virol., September 15, 2004; 78(18): 9977 - 9986. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Ivanov, T. Hertzig, M. Rozanov, S. Bayer, V. Thiel, A. E. Gorbalenya, and J. Ziebuhr Major genetic marker of nidoviruses encodes a replicative endoribonuclease PNAS, August 24, 2004; 101(34): 12694 - 12699. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. St-Jean, H. Jacomy, M. Desforges, A. Vabret, F. Freymuth, and P. J. Talbot Human Respiratory Coronavirus OC43: Genetic Stability and Neuroinvasion J. Virol., August 15, 2004; 78(16): 8824 - 8834. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hertzig, E. Scandella, B. Schelle, J. Ziebuhr, S. G. Siddell, B. Ludewig, and V. Thiel Rapid identification of coronavirus replicase inhibitors using a selectable replicon RNA J. Gen. Virol., June 1, 2004; 85(6): 1717 - 1725. [Abstract] [Full Text] [PDF] |
||||
|
|