J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konishi, K.
Right arrow Articles by Takada, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konishi, K.
Right arrow Articles by Takada, K.
Agricola
Right arrow Articles by Konishi, K.
Right arrow Articles by Takada, K.
Journal of General Virology (2001), 82, 1451-1456.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Role of Epstein–Barr virus-encoded latent membrane protein 2A on virus-induced immortalization and virus activation

Kazuya Konishi1,2, Seiji Maruo1, Hiroyuki Kato2 and Kenzo Takada1

Department of Tumor Virology, Institute for Genetic Medicine, Hokkaido University, N15 W7, Kita-ku, 060-8638 Sapporo, Japan1
Second Department of Surgery, Hokkaido University School of Medicine, Sapporo, Japan2

Author for correspondence: Kenzo Takada. Fax +81 11 717 1128. e-mail kentaka{at}med.hokudai.ac.jp


   Abstract
TOP
Abstract
Main text
References
 
To quantitatively evaluate the role of Epstein-Barr virus (EBV)-encoded latent membrane protein 2A (LMP2A) in immortalization of peripheral B-lymphocytes, we used the Akata cell system to generate an EBV recombinant in which the first exon of the LMP2A gene was disrupted. The results indicated that deletion of the LMP2A gene did not affect the immortalization efficiency of EBV in B-lymphocytes. Deletion of the LMP2A gene made EBV-transformed lymphocytes more permissive for virus replication in response to surface immunoglobulin cross-linking. On the other hand Akata cells, in which LMP2A expression was much lower than in EBV-transformed lymphocytes, were equally permissive for virus replication whether they were infected with wild EBV or LMP2A-knockout EBV. The results raise a question as to the role of LMP2A in inhibition of disruption of virus latency in vivo, where LMP2A expression has been expected to be low as in Akata cells.


   Main text
TOP
Abstract
Main text
References
 
Epstein–Barr virus (EBV), a human herpesvirus, is the causative agent of infectious mononucleosis, and is associated with various malignancies such as Burkitt’s lymphoma and nasopharyngeal carcinoma (Rickinson & Kieff, 1996Down ). EBV is ubiquitous in humans, establishes latent infection in peripheral B-lymphocytes following primary infection, and persists for the remainder of the host’s lifetime. In vitro, EBV transforms peripheral B-lymphocytes into indefinitely growing lymphoblastoid cells (LCL). LCL maintain the entire viral genome mostly in a plasmid form and express a limited number of virus gene products, including six nuclear antigens (EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C and EBNALP), three latent membrane proteins (LMP1, LMP2A and LMP2B), two small nonpolyadenylated RNAs (EBER1 and EBER2) and the transcripts from the BamHI-A region (BARF0) (Kieff, 1996Down ).

LMP2A and LMP2B are transcribed from unique and common exons (Laux et al., 1988Down ; Sample et al., 1989Down ). The first exon is unique to LMP2A and encodes a 119 amino acid cytoplasmic amino-terminal domain. The remaining eight exons are common with LMP2B, and encode 12 hydrophobic membrane-spanning domains and a 27 amino acid cytoplasmic carboxy-terminal domain. The amino-terminal part of LMP2A is associated with src family protein tyrosine kinases (Burkhardt et al., 1992Down ; Longnecker et al., 1991Down ). LMP2A is a substrate for these protein kinases, acts as a dominant negative regulator of lyn and fyn protein kinase activities, and interferes with signal transduction after cross-linking of cell surface immunoglobulin (sIg) (Miller et al., 1993Down , 1994aDown , 1995Down ). Cross-linking of sIg efficiently activates a switch to lytic EBV gene expression in latently EBV-infected cells (Takada, 1984Down ; Takada & Ono, 1989Down ). LMP2A prevents lytic reactivation in response to sIg cross-linking in EBV-immortalized B-lymphocytes (Miller et al., 1994bDown ), and is thought to maintain a latent state of EBV infection in vivo, because only EBNA1 and LMP2A were reported to be expressed in latently EBV-infected B-cells in vivo (Chen et al., 1995Down ; Miyashita et al., 1997Down ; Qu & Rowe, 1992Down ; Tierney et al., 1994Down ).

Concerning the role of LMP2A in B-cell immortalization, there have been reports from two groups. R. Longnecker and colleagues reported that LMP2A was dispensable for B-cell immortalization. Two EBV mutants were generated: one a knockout of the first exon of the LMP2A gene (Longnecker et al., 1992Down ; Speck et al., 1999Down ), and the other of the last seven transmembrane and carboxy-terminal cytoplasmic domains (Longnecker et al., 1993Down ), which are shared with LMP2B, and therefore the latter mutant is deficient in both LMP2A and LMP2B genes. An EBV recombinant was generated in EBV-producing P3HR-1 cells and B95-8 cells as a mixture of wild EBV and mutant EBV, which was then used to immortalize primary B-lymphocytes. LMP2A- or LMP2A/2B-knockout EBV released from immortalized B-cells was demonstrated to have an ability to immortalize primary B-lymphocytes. However, the assays were not quantitative because the virus preparations always contained both wild and mutant EBV. On the other hand, W. Hammerschmidt and colleagues (Brielmeier et al., 1996Down ) reported that LMP2 was important for efficient B-cell immortalization. Knockout EBV was generated in an E. coli F-factor-based plasmid and packaged in P3HR-1 cells, which were infected with EBNA2-deleted, transformation-incompetent EBV. This assay, however, could not evaluate the function of LMP2A, because the knocked-out LMP2 regions were common to both LMP2A and LMP2B.

Our present study aimed to quantitatively determine the role of LMP2A in B-cell immortalization by using a pure recombinant EBV preparation generated by an Akata cell system (Shimizu et al., 1996Down ). We also studied whether the small amount of LMP2A expressed in Akata cells, which must be similar to that in latently EBV-infected B cells in vivo, had any effect on preventing activation of latent EBV.

The Akata cell line, derived from Burkitt’s lymphoma, was originally 100% EBV-positive (Takada et al., 1991Down ). We isolated EBV-positive and -negative subclones from the parental Akata cell culture by the limiting dilution method. EBV-positive Akata cells (Akata+ cells) have ~20 copies of EBV plasmid per cell. The first exon of the LMP2A gene of an EBV plasmid was disrupted by insertion of the neomycin resistance gene (neor) by homologous recombination (Fig. 1ADown). The targeting plasmid was the BglII fragment encompassing the first exon of LMP2A (Sample et al., 1989Down ), disrupted by insertion of neor. The plasmid was transfected into Akata+ cells by the electroporation method. Transfected Akata cells were cultured in 96-well, flat-bottom plates at 5000 cells per well in complete culture medium containing 700 µg/ml of G418 (Life Technologies).



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1. (A) Schematic representation of the plasmid construct used to generate LMP2A-knockout EBV. The structures of LMP2A and LMP2B mRNAs are shown above the map of wild EBV. The targeting plasmid is the BglII fragment encompassing the first exon of LMP2A, which is disrupted by insertion of the neomycin resistance gene (neor). When the plasmid recombines into the targeting site, novel 8·3 kb EcoRI–BamHI and 11·3 kb EcoRI–SacII fragments will appear. Probes used for Southern blot analysis are indicated at the bottom. B, BamHI; E, EcoRI; Bg, BglII; M, MunI; S, SacII; TR, terminal repeat. (B, C) Southern blot analysis of a targeted Akata cell clone and LMP2A-knockout EBV-infected Akata- clones. Two µg of cellular DNA was doubly digested with EcoRI/BamHI (B) or EcoRI/SacII (C), blotted, and hybridized with the EcoRI/BamHI or neor probe (B) or SacII or neor probe (C) by the procedure described previously (Shimizu et al., 1994Down ) (see Fig. 1A). (D) LMP2A expression in LMP2A-knockout EBV-infected Akata cell clones by RT–PCR analysis. Total cellular RNA was isolated by guanidium isothiocyanate–phenol extraction using TRIzol reagent (GibcoBRL) according to the manufacturer’s protocol. One µg of total RNA was treated with DNase I (GibcoBRL) and incubated with Moloney murine leukaemia virus reverse transcriptase (GibcoBRL). The cDNA (corresponding to 100 ng of total RNA) was subjected to PCR using primers 5’ CCCTAGAAATGGTGCCAATG 3’ and 5’ CATGTTAGGCAAATTGCAAA 3’. One-tenth of the PCR product was electrophoresed in a 2% agarose gel, blotted, and hybridized with a 32P-labelled oligonucleotide probe (5’ ATCCAGTATGCCTGCCTGTA 3’). LCL immortalized by Akata EBV were used as a positive control. The EBV-negative B-lymphoma line BJAB was used as a negative control. (E) LMP2A expression in LMP2A-knockout EBV-immortalized LCL by immunoblot analysis. Protein samples (corresponding to 4x105 cells) were separated in 10% polyacrylamide gels and transferred to nitrocellulose membranes (Schleicher and Schuell). LMP2A was detected with a rabbit polyclonal antibody. LCL immortalized by LMP2A-positive Akata EBV were used as a positive control. BJAB cells were used as a negative control.

 
A total of 984 G418-resistant Akata cell clones appeared from 2880 wells tested. Southern blot analysis indicated that two clones contained homologously recombined EBV. Fig. 1(BUp, CUp) shows a clone that contained an EBV recombinant with the neor DNA recombined into the expected LMP2A site, as well as non-recombinant (wild) Akata EBV. On the EcoRI/BamHI double-digested blot (Fig. 1BUp), the 6·8 kb EcoRI–BamHI subfragment of the EBV BamHI-A fragment was used as a probe and identified a 6·8 kb wild EBV band as well as an 8·3 kb recombinant EBV band, which hybridized to the neor probe also (see Fig. 1AUp). On the EcoRI/SacII double-digested blot (Fig. 1CUp), the 3·7 kb SacII subfragment of the EBV BamHI-Nhet fragment was used as a probe and identified a 3·7 kb wild EBV band as well as an 11·8 kb recombinant EBV band that hybridized to the neor probe also (see Fig. 1AUp).

Then, EBV-negative Akata cells (Akata-, 5x106) (Shimizu et al., 1994Down ) were infected with the virus preparation from G418-resistant Akata cells, which contained a mixture of wild-type EBV and recombined EBV. Two days after infection, cells were plated in 96-well, flat-bottom plates at 5000 cells per well with complete medium containing 700 µg G418/ml. Twelve G418-resistant clones were examined and proved to be infected with recombinant EBV only. Southern blot analysis indicated that the recombinant EBV-infected Akata- cells had the neor DNA exactly recombined into the first exon of the LMP2A gene (Fig. 1BUp, CUp). RT–PCR analysis indicated that LMP2A-knockout EBV-infected Akata cells were negative for LMP2A mRNA expression (Fig. 1DUp). Furthermore, immunoblot analysis indicated that LCLs immortalized by LMP2A-knockout EBV were negative for LMP2A expression (Fig. 1EUp).

At first, we compared virus production by Akata cells harbouring the LMP2A-knockout EBV with that of Akata cells harbouring recombinant EBV with insertion of the neor gene at the BXLF1 gene (referred to as wild EBV), which is known to be non-essential for EBV infection and replication. In three cell clones, LMP2A-knockout EBV-infected Akata cells produced 4·2, 4·5 and 5·3 µg of viral DNA per litre of culture supernatant, and wild EBV-infected Akata cells produced 2·9, 4·0 and 5·8 µg of viral DNA per litre of culture. Equal amounts of virus (corresponding to 4 ng of viral DNA) from both wild-type EBV and LMP2A-knockout EBV preparations were diluted 10-fold, inoculated to cord blood mononuclear cells (106 cells), and their ability to immortalize primary B-lymphocytes was assessed. In two separate experiments, the 50% immortalization doses per 4 ng of viral DNA were 104·8 and 105·2 for LMP2A-knockout EBV, and 105·2 and 104·6 for wild EBV. These results indicated that there was no difference in immortalization efficiency between wild EBV and LMP2A-knockout EBV.

Akata cells express a small amount of LMP2A that is detectable by RT–PCR but not by immunoblot analysis. We examined whether this amount of LMP2A expression had any effect on sIg-mediated calcium mobilization. Wild EBV-infected and LMP2A-knockout EBV-infected Akata cells were treated with anti-Ig, and their intracellular free calcium levels were measured by flow cytometry (Table 1Down). Both wild EBV-infected and LMP2A-knockout EBV-infected Akata cells exhibited similar changes in intracellular calcium.


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of LMP2A expression on calcium mobilization and EBV lytic antigen expression after surface immunoglobulin cross-linking

 
As compared with LMP2A expression in Akata cells, LCL expresses a higher level of LMP2A, and it has been reported that LMP2A in LCL blocks sIg-mediated signalling (Miller et al., 1993Down , 1994bDown ). The responses to anti-Ig treatment of LCLs immortalized with wild EBV and LMP2A-knockout EBV were compared. (Table 1Up). LCLs immortalized by LMP2A-knockout EBV displayed increased calcium mobilization in response to anti-Ig compared with LCL immortalized by wild EBV. Both the percentage of cells responding and the percentage change in the intracellular calcium level increased in LCL transformed by LMP2A-knockout EBV compared with wild EBV.

Next we examined whether high-level expression of LMP2A comparable to the level in LCL could inhibit calcium mobilization induced by anti-Ig treatment. The LMP2A expression plasmid was generated from cDNA of Akata EBV-immortalized LCL by a PCR-based strategy. Total cellular RNA was reverse-transcribed using the 3’LMP2A primer (GCACATTGGGTTTATTGTAGTGTTTGTAAATAC). The cDNA was then subjected to 35 cycles of PCR using primers 3’LMP2A and 5’LMP2A (TTAGCGCTGCTGCAGCTATGGGGTCCCTAG). The amplified DNA was sequenced to confirm the absence of any mutations introduced by PCR. Compared with the nucleotide sequence of the B95-8 strain (Baer et al., 1984Down ), there were three base changes, which resulted in three amino acid changes (tyrosine-23 to aspartate, and serine-348 and -444 to isoleucine). Tyrosine-23 has been reported to be dispensable for blocking B-cell signal transduction (Fruehling et al., 1996Down ). The cDNA of LMP2A was further cloned into the pSG5 vector containing neor and transfected into BJAB, Akata- and Akata+ cells. Cell clones that had LMP2A levels similar to those of LCL were isolated (Fig. 2ADown, BDown, CDown) and examined for their calcium mobilization response to anti-Ig treatment. In all three cell lines, LMP2A-transfected cell clones showed reduced numbers of cells responding, as well as a reduction in the degree to which responding cells mobilized calcium, compared with those of vector-transfected clones (Table 1Up).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. Western blot analysis of LMP2A expression in LMP2A-transfected Akata+ (A), BJAB (B) and Akata- (C) cell clones. Akata+, BJAB and Akata- cells were transfected with the LMP2A expression plasmid carrying the neomycin resistance gene (neor). Cell clones that stably expressed LMP2A protein were selected and analysed. Protein samples (corresponding to 4x105 cells) were separated in 10% polyacrylamide gels and transferred to a nitrocellulose membrane (Schleicher and Schuell). LMP2A was detected with a rabbit polyclonal antibody. LCL immortalized by LMP2A-positive Akata EBV were used as a positive control. BJAB cells were used as a negative control.

 
It is well known that Ig receptor signalling induces activation of latently infected EBV (Takada, 1984Down ). Therefore, we compared the levels of lytic antigen expression after anti-Ig treatment between wild EBV-infected and LMP2A-knockout EBV-infected Akata cells. The results are shown in Table 1Up. There was no difference in the frequency of lytic antigen-positive cells. These results suggest that a small amount of LMP2A in type I latency does not block sIg-mediated signalling.

We then compared the level of lytic antigen expression after anti-Ig treatment between wild EBV-infected and LMP2A-knockout EBV-infected LCL. The results indicated that wild EBV-infected LCLs showed very little or no induction of EBV lytic antigens, while LMP2A-knockout EBV-infected LCLs produced EBV early antigens (EA) and viral capsid antigens (VCA) in 5% and 1% of cells, respectively, after anti-Ig treatment.

Next Akata+ cells, which expressed a small amount of LMP2A, were transfected with the LMP2A plasmid, and cell clones that constitutively expressed LMP2A at a level similar to LCL were isolated. These cell clones became less permissive for virus replication as compared with Akata+ cell clones transfected with the neor plasmid as a control.

Our results showed clearly that deletion of the LMP2A gene did not affect the immortalization efficiency of EBV in peripheral lymphocytes. Brielmeier et al. (1996)Down reported that the deletion of both LMP2A and LMP2B genes from EBV lowered the lymphocyte immortalization efficiency remarkably. It remains to be studied whether LMP2B plays some role in lymphocyte immortalization.

LCL express a high level of LMP2A protein, which can be detected by Western blot. The high-level expression of LMP2A in LCL is caused by transactivation of the EBNA2 protein (Zimber et al., 1993Down ). On the other hand, Akata cells are negative for EBNA2 expression and express little LMP2A. The analysis of peripheral blood lymphocytes by PCR showed that only EBNA1 and LMP2A were expressed in EBV latency in vivo (Chen et al., 1995Down ; Miyashita et al., 1997Down ; Qu & Rowe, 1992Down ; Tierney et al., 1994Down ). Although the level of LMP2A expression in peripheral lymphocytes has not been measured quantitatively, the absence of EBNA2 expression suggests a low level of LMP2A expression in these cells. Our results showed that the low level of LMP2A expressed in Akata cells could not block the EBV activation by cross-linking of sIg, suggesting that a low level of LMP2A expression in in vivo latency could not block EBV activation.


   Acknowledgments
 
We thank R. Longnecker for anti-LMP2A antibody. This work was supported in part by grants-in-aid from the Ministry of Education, Science, Sports, and Culture, Japan, and from the Princess Takamatsu Research Fund.


   References
TOP
Abstract
Main text
References
 
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hutfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein–Barr virus genomes. Nature 310, 207-211.[Medline]

Brielmeier, M., Mautner, J., Laux, G. & Hammerschmidt, W. (1996). The latent membrane protein 2 gene of Epstein–Barr virus is important for efficient B cell immortalization. Journal of General Virology 77, 2807-2818.[Abstract/Free Full Text]

Burkhardt, A. L., Bolen, J. B., Kieff, E. & Longnecker, R. (1992). An Epstein–Barr virus transformation-associated membrane protein interacts with src family tyrosine kinases. Journal of Virology 66, 5161-5167.[Abstract/Free Full Text]

Chen, F., Zou, J., di Renzo, L., Winberg, G., Hu, L., Klein, E., Klein, G. & Ernberg, I. (1995). A subpopulation of normal B cells latently infected with Epstein–Barr virus resembles Burkitt lymphoma cells in expressing EBNA-1 but not EBNA-2 or LMP1. Journal of Virology 69, 3752-3758.[Abstract]

Fruehling, S., Lee, S., Herrold, R., Frech, B., Laux, G., Kremmer, E., Grasser, F. A. & Longnecker, R. (1996). Identification of latent membrane protein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B-lymphocyte surface immunoglobulin signal transduction. Journal of Virology 70, 6216-6226.[Abstract]

Kieff, E. (1996). Epstein–Barr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Laux, G., Perricaudet, M. & Farrell, P. J. (1988). A spliced Epstein–Barr virus gene expressed in immortalized lymphocytes is created by circularization of the linear viral genome. EMBO Journal 7, 769-774.[Medline]

Longnecker, R., Durker, B., Roberts, T. M. & Kieff, E. (1991). An Epstein–Barr virus protein associated with cell growth transformation interacts with a tyrosine kinase. Journal of Virology 65, 3681-3692.[Abstract/Free Full Text]

Longnecker, R., Miller, C. L., Miao, X.-Q., Marchini, A. & Kieff, E. (1992). The only domain which distinguishes Epstein–Barr virus latent membrane protein 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro; LMP2A is therefore nonessential. Journal of Virology 66, 6461-6469.[Abstract/Free Full Text]

Longnecker, R., Miller, C. L., Miao, X.-Q., Tomkinson, B. & Kieff, E. (1993). The last seven transmembrane and carboxy-terminal cytoplasmic domains of Epstein–Barr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. Journal of Virology 67, 2006-2013.[Abstract/Free Full Text]

Miller, C. L., Longnecker, R. & Kieff, E. (1993). Epstein–Barr virus latent membrane protein 2A blocks calcium mobilization in B lymphocytes. Journal of Virology 67, 3087-3094.[Abstract/Free Full Text]

Miller, C. L., Lee, J. H., Kieff, E., Burkhardt, A. L., Bolen, J. B. & Longnecker, R. (1994a). Epstein–Barr virus protein LMP2A regulates reactivation from latency by negatively regulating tyrosine kinases involved in sIg-mediated signal transduction. Infectious Agents and Disease 3, 128-136.[Medline]

Miller, C. L., Lee, J. H., Kieff, E. & Longnecker, R. (1994b). An integral membrane protein (LMP2) blocks reactivation of Epstein–Barr virus from latency following surface immunoglobulin crosslinking. Proceedings of the National Academy of Sciences, USA 91, 772-776.[Abstract/Free Full Text]

Miller, C. L., Burkhardt, A. L., Lee, J. H., Stealey, B., Longnecker, R. & Kieff, E. (1995). Integral membrane protein 2 of Epstein–Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity 2, 155-166.[Medline]

Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of Epstein–Barr virus persistence in vivo as a resting B cells. Journal of Virology 71, 4882-4891.[Abstract]

Qu, L. & Rowe, D. (1992). Epstein–Barr virus latent gene expression in uncultured peripheral blood lymphocytes. Journal of Virology 66, 3715-3724.[Abstract/Free Full Text]

Rickinson, A. B. & Kieff, E. (1996). In Fields Virology, 3rd edn, pp. 2397–2446. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: Lippincott–Raven.

Sample, J., Liebowitz, D. & Kieff, E. (1989). Two related Epstein–Barr virus membrane proteins are encoded by separate genes. Journal of Virology 63, 933-937.[Abstract/Free Full Text]

Shimizu, N., Tanabe-Tochikura, A., Kuroiwa, Y. & Takada, K. (1994). Isolation of Epstein–Barr virus (EBV)-negative cell clones from the EBV-positive Burkitt’s lymphoma (BL) line Akata: malignant phenotypes of BL cells are dependent on EBV. Journal of Virology 68, 6069-6073.[Abstract/Free Full Text]

Shimizu, N., Yoshiyama, H. & Takada, K. (1996). Clonal propagation of Epstein–Barr virus (EBV) recombinants in EBV-negative Akata cells. Journal of Virology 70, 7260-7263.[Abstract/Free Full Text]

Speck, P., Kline, K. A., Cheresh, P. & Longnecker, R. (1999). Epstein–Barr virus lacking latent membrane protein 2 immortalizes B cells with efficiency indistinguishable from that of wild-type virus. Journal of General Virology 80, 2193-2203.[Abstract/Free Full Text]

Takada, K. (1984). Cross-linking of cell surface immunoglobulins induces Epstein–Barr virus in Burkitt lymphoma lines. International Journal of Cancer 33, 27-32.

Takada, K. & Ono, Y. (1989). Synchronous and sequential activation of latently infected Epstein–Barr virus genomes. Journal of Virology 63, 445-449.[Abstract/Free Full Text]

Takada, K., Horinouchi, K., Ono, Y., Aya, T., Osato, T., Takahashi, M. & Hayasaka, S. (1991). An Epstein–Barr virus-producer line Akata: establishment of the cell line and analysis of virus genomes. Virus Genes 5, 147-156.[Medline]

Tierney, R. J., Steven, N., Young, L. S. & Rickinson, A. B. (1994). Epstein–Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. Journal of Virology 68, 7374-7385.[Abstract/Free Full Text]

Zimber, S. U., Kremmer, E., Grasser, F., Marschall, G., Laux, G. & Bornkamm, G. W. (1993). The Epstein–Barr virus nuclear antigen 2 interacts with an EBNA2 responsive cis-element of the terminal protein 1 gene promoter. EMBO Journal 12, 167-175.[Medline]

Received 29 November 2000; accepted 1 February 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
L. J. Anderson and R. Longnecker
EBV LMP2A provides a surrogate pre-B cell receptor signal through constitutive activation of the ERK/MAPK pathway
J. Gen. Virol., July 1, 2008; 89(7): 1563 - 1568.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. P. Rechsteiner, C. Berger, L. Zauner, J. A. Sigrist, M. Weber, R. Longnecker, M. Bernasconi, and D. Nadal
Latent Membrane Protein 2B Regulates Susceptibility to Induction of Lytic Epstein-Barr Virus Infection
J. Virol., February 15, 2008; 82(4): 1739 - 1747.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. P. Rechsteiner, C. Berger, M. Weber, J. A. Sigrist, D. Nadal, and M. Bernasconi
Silencing of latent membrane protein 2B reduces susceptibility to activation of lytic Epstein-Barr virus in Burkitt's lymphoma Akata cells
J. Gen. Virol., May 1, 2007; 88(5): 1454 - 1459.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
E. Schaadt, B. Baier, J. Mautner, G. W. Bornkamm, and B. Adler
Epstein-Barr virus latent membrane protein 2A mimics B-cell receptor-dependent virus reactivation
J. Gen. Virol., March 1, 2005; 86(3): 551 - 559.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Stewart, C. W. Dawson, K. Takada, J. Curnow, C. A. Moody, J. W. Sixbey, and L. S. Young
Epstein-Barr virus-encoded LMP2A regulates viral and cellular gene expression by modulation of the NF-{kappa}B transcription factor pathway
PNAS, November 2, 2004; 101(44): 15730 - 15735.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Yang, M. Hakoda, K. Iwabuchi, T. Takeda, T. Koike, N. Kamatani, and K. Takada
Rheumatoid Factors Induce Signaling from B Cells, Leading to Epstein-Barr Virus and B-Cell Activation
J. Virol., September 15, 2004; 78(18): 9918 - 9923.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Iwakiri and K. Takada
Phosphatidylinositol 3-Kinase Is a Determinant of Responsiveness to B Cell Antigen Receptor-Mediated Epstein-Barr Virus Activation
J. Immunol., February 1, 2004; 172(3): 1561 - 1566.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. V. Gordadze, D. Poston, and P. D. Ling
The EBNA2 Polyproline Region Is Dispensable for Epstein-Barr Virus-Mediated Immortalization Maintenance
J. Virol., June 14, 2002; 76(14): 7349 - 7355.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
D. T. Lynch, J. S. Zimmerman, and D. T. Rowe
Epstein-Barr virus latent membrane protein 2B (LMP2B) co-localizes with LMP2A in perinuclear regions in transiently transfected cells
J. Gen. Virol., May 1, 2002; 83(5): 1025 - 1035.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Speck, M. Ikeda, A. Ikeda, H. M. Lederman, and R. Longnecker
Signal Transduction through the B Cell Antigen Receptor Is Normal in Ataxia-Telangiectasia B Lymphocytes
J. Biol. Chem., February 1, 2002; 277(6): 4123 - 4127.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konishi, K.
Right arrow Articles by Takada, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konishi, K.
Right arrow Articles by Takada, K.
Agricola
Right arrow Articles by Konishi, K.
Right arrow Articles by Takada, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS