J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kato, K.
Right arrow Articles by Hirai, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kato, K.
Right arrow Articles by Hirai, K.
Agricola
Right arrow Articles by Kato, K.
Right arrow Articles by Hirai, K.
Journal of General Virology (2001), 82, 1457-1463.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Epstein–Barr virus-encoded protein kinase BGLF4 mediates hyperphosphorylation of cellular elongation factor 1{delta} (EF-1{delta}): EF-1{delta} is universally modified by conserved protein kinases of herpesviruses in mammalian cells

Kentaro Kato1,2, Yasushi Kawaguchi1, Michiko Tanaka1, Mie Igarashi1, Akihiko Yokoyama1, Go Matsuda1, Mikiko Kanamori1, Kaori Nakajima1, Yorihiro Nishimura2, Masayuki Shimojima2, Hang T. T. Phung2, Eiji Takahashi2 and Kanji Hiraib,1

Department of Tumor Virology, Division of Virology and Immunology, Medical Research Institute, Tokyo Medical and Dental University, 1-5-45, Yushima, Bunkyo-ku, Tokyo 113-8510, Japan1
Department of Veterinary Microbiology, Graduate School of Agricultural and Life Science, University of Tokyo, 1-1-1, Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan2

Author for correspondence: Yasushi Kawaguchi. Fax +81 3 5803 0241. e-mail kawagchi.creg{at}mri.tmd.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Translation elongation factor 1{delta} (EF-1{delta}) is hyperphosphorylated in various mammalian cells infected with alpha-, beta- and gammaherpesviruses and EF-1{delta} modification is mediated by viral protein kinases, including UL13 of herpes simplex virus type 1 and UL97 of human cytomegalovirus. In this study, the following is reported. (i) BGLF4 encoded by the prototype gammaherpesvirus Epstein–Barr virus was purified as a fusion protein that was labelled with [{gamma}-32P]ATP and labelling was eliminated by phosphatase. (ii) The ratio of the hyperphosphorylated form of human EF-1{delta} was increased both in Sf9 cells after infection with baculoviruses expressing GST–BGLF4 fusion proteins and in COS-7 cells after transfection with a BGLF4 expression plasmid. These results indicate that purified BGLF4 possesses protein kinase activity and mediates EF-1{delta} hyperphosphorylation. These data also support the hypothesis that the protein kinases that are conserved by herpesviruses universally mediate EF-1{delta} modification in mammalian cells.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Previous studies (described below) suggested that herpesviruses interact with the host cellular translation elongation factor 1{delta} (EF-1{delta}), which plays a key role in the regulation of host cell protein synthesis (Merrick, 1992Down ; Morales et al., 1992Down ; Riis et al., 1990Down ; Van Damme et al., 1990Down ). Thus, (i) the involvement of EF-1{delta} was first highlighted by our observations that a regulatory protein of herpes simplex virus type 1 (HSV-1), the prototype alphaherpesvirus, interacts with EF-1{delta} (Kawaguchi et al., 1997aDown ). The regulatory protein ICP0, which is known primarily for its function as a promiscuous transactivator (Everett et al., 1991Down ; Roizman & Sears, 1996Down ), was shown to interact with EF-1{delta}, and the domain of ICP0 that interacts with EF-1{delta} was shown to affect translational efficiency in vitro (Kawaguchi et al., 1997aDown ). This observation was subsequently confirmed by a study of an unrelated virus, human immunodeficiency virus type 1 (HIV-1). A regulatory protein of HIV-1, Tat, also interacts with EF-1{delta}, and the domain of Tat that interacts with EF-1{delta} mediates the shut-off of host cell mRNA translation both in vitro and in vivo (Xiao et al., 1998Down ). Interestingly, this domain of Tat shows a weak but consistent similarity to the region of ICP0 that interacts with EF-1{delta}, suggesting that HSV-1 ICP0 and HIV-1 Tat modulate cellular protein synthesis in a similar way. (ii) In the course of studying the interaction between ICP0 and EF-1{delta}, we also found that HSV-1 infection causes extensive hyperphosphorylation of EF-1{delta} (Kawaguchi et al., 1997aDown ). Subsequent experiments revealed that a viral protein kinase encoded by the UL13 gene mediates EF-1{delta} modification (Kawaguchi et al., 1998Down ). The observation that HSV-1 has evolved two viral regulatory proteins for the optimization of EF-1{delta} function suggests that EF-1{delta} plays an important role in its life cycle. (iii) The amino acid sequence of the UL13 protein kinase is conserved in all members of the Herpesviridae subfamilies (Chee et al., 1989Down ; Smith & Smith, 1989Down ) and this led us to investigate whether herpesviruses other than HSV-1 possess the ability to induce EF-1{delta} hyperphosphorylation. Recently, we demonstrated that various alpha-, beta- and gammaherpesviruses commonly induce EF-1{delta} modification in cells from various mammalian species (Kawaguchi et al., 1999Down ). Furthermore, human cytomegalovirus (HCMV) UL97, a betaherpesvirus homologue of UL13, mediates EF-1{delta} hyperphosphorylation. These observations suggested that EF-1{delta} is modified in mammalian cells infected with any herpesviruses subfamily member and that EF-1{delta} is universally important in herpesvirus infection.

Although HSV-1 UL13 and HCMV UL97 have been shown to mediate modification of EF-1{delta} (Kawaguchi et al., 1998Down , 1999Down ), it is not yet known whether conserved protein kinases of herpesviruses (HSV-1 UL13 homologues) are commonly involved in modification of EF-1{delta} because (i) the modification has not been shown by gammaherpesvirus protein kinases and (ii) conserved protein kinases sometimes show other biological activities (Heineman & Cohen, 1995Down ; Moffat et al., 1998Down ; Ng et al., 1994Down , 1998Down ; Ogle et al., 1997Down ; Purves & Roizman, 1992Down ). We wished, therefore, to examine whether a gammaherpesvirus protein kinase hyperphosphorylates EF-1{delta}. This would further support the hypothesis that EF-1{delta} modification is a conserved function that is expressed by all herpesviruses subfamily members in mammalian cells and that conserved protein kinases encoded by herpesviruses universally mediate this modification. In this report, we present evidence that this is in fact the case. We report here that BGLF4, a viral protein kinase of Epstein–Barr virus (EBV), mediates EF-1{delta} modification at a cellular level.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells.
Spodoptera frugiperda Sf9 cells were maintained in TC100 (GibcoBRL) with 10% foetal calf serum (FCS), 0·26% tryptose phosphate broth and 50 µg/ml kanamycin. B95-8 cells, an EBV-producing simian cell line, were maintained in RPMI 1640 medium supplemented with 10% FCS. The monkey kidney epithelial cell line COS-7 was maintained in Dulbecco’s modified Eagle’s medium supplemented with 5% FCS.

{blacksquare} Plasmids.
EBV DNA was isolated from B95-8 cells as described previously (Horimoto et al., 1992Down ). The entire EBV BGLF4 open reading frame (ORF) was amplified by PCR using viral DNA as a template and the primers GCGAATTCGGAACATGGATGTGAATATG and GCGGATCCTCATCCACGTCGGCCATCTG. The amplified fragments were digested with EcoRI/BamHI and cloned into the EcoRI and BamHI sites of pBluescript II KS+ (Stratagene). The resultant plasmid was designated pBS-BGLF4-stop. pAcGHLT-BGLF4 (Fig. 1CDown) was generated by inserting an EcoRI–NotI fragment of pBS-BGLF4-stop into pAcGHLT-B (Pharmingen). The entire EF-1{delta} ORF without the stop codon was amplified from pBH1003 (Kawaguchi et al., 1997aDown ) by PCR using the primers GCGAATTCAGAAAAATGGCTACAAACTT and GCGGATCCGATCTTGTTGAAAGCTGCGA. The amplified fragments were digested with EcoRI/BamHI and cloned into the EcoRI and BamHI sites of pBS-Flag-Stop (Kawaguchi et al., 2000Down ). The resultant plasmid was designated pBS-EF-1{delta}(F)-Stop. The EcoRI–NotI fragment of EF-1{delta}(F) was inserted into pFASTBAC DUAL (GibcoBRL) to generate pFASTBAC-EF-1{delta}(F). To construct pBS-BGLF4(F), a fragment of EBV viral DNA encoding the entire coding sequence of BGLF4 without the stop codon was amplified by PCR using the primers GCGAATTCGGAACATGGATGTGAATATG and GCGGATCCTCCACGTCGGCCATCTGGAC. This fragment was then cloned into pBS-Flag-Stop in-frame with the Flag epitope. The EcoRI–NotI fragment of pBS-BGLF4(F) was inserted into the EcoRI and NotI sites of pME18S (kindly provided by K. Maruyama, Tokyo Medical and Dental University, Bunkyo-ku, Tokyo, Japan) to yield pME-BGLF4(F) (Fig. 1DDown). In pME-BGLF4(F), the expression of the 3' Flag epitope-tagged BGLF4 was driven by the SR{alpha} promoter (Takebe et al., 1988Down ).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. (A) Schematic diagram of the EBV genome. Five unique sequences are indicated as U1–U5. The terminal (TR) and internal (IR) repeats flanking the unique sequences are shown as open rectangles. (B) Expanded view of the domain encoding the BGLF4 gene. The direction of ORFs is shown by arrows. (C) The transfer plasmid pAcGHLT-BGLF4, which was used for the construction of recombinant baculovirus expressing GST–BGLF4. (D) The expression plasmid pME-BGLF4, which was used for the expression of BGLF4 in COS-7 cells.

 
{blacksquare} Generation of recombinant baculoviruses.
Either pAcGHLT-BGLF4 or pAcGHLT-B was cotransfected with linearized baculovirus DNA BaculoGold (Pharmingen) into Sf9 cells using Lipofectin (GibcoBRL), as described previously (Kawaguchi et al., 1997bDown ), to generate recombinant baculoviruses designated either Bac-GST-BGLF4 or Bac-GST. A recombinant baculovirus that expresses human EF-1{delta} (Bac-hEF-1{delta}) was also constructed using the BAC-TO-BAC Baculovirus Expression System, according to the manufacturer’s instructions (GibcoBRL). pFASTBAC-EF-1{delta}(F) was transfected into E. coli strain DH10BAC (GibcoBRL) and recombinant bacmid DNA was isolated and transfected into Sf9 cells using Lipofectin. The recombinant viruses were subsequently amplified in Sf9 cells.

{blacksquare} Purification of EBV BGLF4 protein.
Sf9 cells (1·0x106) infected with each baculovirus (Bac-GST-BGLF4 or Bac-GST) in 0·5 ml of ice-cold buffer C (50 mM Tris–HCl, pH 7·5, 100 mM NaCl, 5 mM MgCl2, 0·1% Nonidet P-40, 10% glycerol and 1 mM PMSF) were lysed by sonication. After insoluble material was removed by centrifugation, the supernatants were mixed with 50 µl of a 50% slurry of glutathione–Sepharose beads (Amersham Pharmacia) for 2 h. The beads were extensively washed with buffer C and eluted with elution buffer (10 mM glutathione and 500 mM Tris–HCl, pH 8·0). Next, the eluted supernatants were reacted with Ni2+–NTA agarose beads (Qiagen) for 1 h. The beads were then washed three times with buffer C. Purified protein captured on the beads was separated by 10% SDS–PAGE and either silver-stained (Fig. 2ADown) or immunoblotted (Fig. 2BDown) with rabbit antiserum containing anti-GST antibody, as described previously (Kawaguchi et al., 1997bDown ).



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2. Silver-stained gels (A) and immunoblots (B) of purified GST or GST–BGLF4 from Sf9 cells infected with the recombinant baculovirus Bac-GST (lanes 1–3) or Bac-GST-BGLF4 (lanes 4–6). Total cell extracts (lanes 1 and 4) were subjected to affinity chromatography on glutathione–Sepharose (lanes 2 and 5) or Ni2+–NTA agarose (lanes 3 and 6), as described in Methods. The proteins were separated on a denaturing gel and either silver-stained or transferred onto a nitrocellulose sheet and reacted with the antibody to EF-1{delta}–GST. Molecular masses (kDa) are indicated on the left.

 
{blacksquare} In vitro kinase assays.
Purified GST–BGLF4 or GST captured on Ni2+–NTA agarose beads was rinsed twice with washing buffer (50 mM Tris–HCl, pH 9·0 and 2 mM DTT). Kinase assay reactions were performed with the purified GST proteins at 37 °C for 30 min in a total volume of 50 µl of kinase buffer (50 mM Tris–HCl, pH 8·0, 200 mM NaCl, 50 mM MgCl2, 0·1% Nonidet P-40 and 1 mM DTT) containing 5 µCi [{gamma}-32P]ATP. After incubation, samples were washed with TNE buffer (20 mM Tris–HCl, pH 8·0, 100 mM NaCl and 1 mM EDTA) three times and the phosphorylated proteins were separated by 12% SDS–PAGE. The proteins were then transferred onto nitrocellulose sheets, stained with Ponceau S and exposed to X-ray film.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Purification and characterization of EBV BGLF4 protein
Chen et al. (2000)Down used an immune complex kinase assay to demonstrate a protein kinase activity associated with the BGLF4 protein. However, these results could not completely exclude the possibility that a contaminating protein(s) in the immune complex was responsible for this protein kinase activity. As the goal of this study was to determine whether or not BGLF4 mediates EF-1{delta} hyperphosphorylation, it would be necessary to purify BGLF4 and to show that the purified protein by itself exhibits protein kinase activity.

The objective of the first series of experiments was to purify the EBV BGLF4 gene product. We expressed and purified BGLF4 as a histidine-tagged GST fusion protein using the baculovirus system, as described in Methods. Purified protein was then electrophoretically separated in a denaturing gel and either silver-stained (Fig. 2AUp) or immunoblotted with rabbit antiserum containing anti-GST antibody (Fig. 2BUp).

The purified supernatants from Sf9 cells infected with either Bac-GST or Bac-GST-BGLF4 each contained one major purified protein with an Mr of 32000 or 78000, as detected by silver staining (Fig. 2AUp), and these proteins reacted with antiserum containing anti-GST antibody (Fig. 2BUp). These results indicated that we had purified the desired GST fusion proteins.

Protein kinase activity of purified BGLF4
Many protein kinases have autophosphorylating activity (Edelman et al., 1987Down ). To determine whether purified BGLF4 does in fact possess kinase activity, we examined the ability of purified BGLF4 to autophosphorylate itself in the kinase assay, as described in Methods. The results (Fig. 3Down) were as follows: (i) electrophoretically separated purified GST protein, which was incubated in kinase buffer, did not contain any labelled bands (Fig. 3ADown, BDown). However, in the autoradiographic image of purified BGLF4, a protein band with an apparent Mr of 78000 was labelled (Fig. 3BDown). The electrophoretic mobility of labelled BGLF4 was the same as that of purified BGLF4 stained with Ponceau S (Fig. 3ADown, BDown). (ii) To determine if the labelling of BGLF4 with [{gamma}-32P]ATP was due to phosphorylation, labelled BGLF4 was boiled to inactivate kinases and incubated with 50 units of alkaline phosphatase at 37 °C for 30 min. As shown in Fig. 3(D)Down, the band of labelled BGLF4 was eliminated by phosphatase treatment, indicating that BGLF4 was labelled with [{gamma}-32P]ATP by phosphorylation. Fig. 3(C)Down shows the results of Ponceau S staining of the same blot used in the experiment of Fig. 3(D)Down. These data showed that BGLF4 levels remained relatively unchanged after boiling and indicated that boiling did not result in the loss of BGLF4. Thus, BGLF4 autophosphorylates itself and possesses protein kinase activity.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. In vitro kinase assays of purified GST and GST–BGLF4 proteins. (A) Purified GST (lane 1) or GST–BGLF4 (lane 2) were incubated in kinase buffer containing [{gamma}-32P]ATP, separated on a denaturing gel, transferred onto a nitrocellulose sheet and stained with Ponceau S. (B) Autoradiograph of the nitrocellulose sheet described in (A). (C) Purified GST–BGLF4 incubated in kinase buffer containing [{gamma}-32P]ATP (lane 2) and the labelled protein treated with alkaline phosphatase (CIP) (lane 1) were separated on a denaturing gel, transferred onto a nitrocellulose sheet and stained with Ponceau S. (D) Autoradiograph of the nitrocellulose sheet described in (C). Molecular masses are indicated on the left.

 
BGLF4 protein mediates post-translational modification of EF-1{delta}
To address the question of whether or not BGLF4 is involved in EF-1{delta} modification, we performed two series of experiments. In the first we constructed a recombinant baculovirus expressing human EF-1{delta} (Bac-hEF-1{delta}), as described in Methods. The expression of EF-1{delta} was confirmed by immunoblotting with Bac-hEF-1{delta} (Fig. 4ADown). Using the baculoviruses expressing GST–BGLF4 and human EF-1{delta}, we examined whether human EF-1{delta} was modified by BGLF4 in insect cells. As reported previously (Kawaguchi et al., 1997aDown ), EF-1{delta} consists of two predominant forms: a hypophosphorylated form (apparent Mr of 38000) and a hyperphosphorylated form (apparent Mr of 40000). The polyclonal antibody (Kawaguchi et al., 1997aDown ) used in this study can readily detect both forms of EF-1{delta} and the pattern of bands of EF-1{delta} radiolabelled by 32P was exactly the same as that of EF-1{delta} detected by immunoblotting (Kawaguchi et al., 1998Down ). Immunoblotting using the anti-EF-1{delta} antibody can, therefore, be used to monitor modification of EF-1{delta}. As shown in Fig. 4(A)Down, when human EF-1{delta} was expressed in Sf9 cells two predominant forms of protein with an Mr of 38000 and 40000 were produced. The pattern of protein expression was similar to that in mammalian COS-7 cells (Fig. 4ADown). In Sf9 cells either infected with Bac-hEF-1{delta} or coinfected with Bac-GST and Bac-hEF-1{delta}, the hypophosphorylated form of EF-1{delta} was dominant (Fig. 4BDown, lane 2). In contrast, the ratio of proteins (upper:lower bands) was significantly increased by coinfection with Bac-GST-BGLF4 and Bac-hEF-1{delta} (Fig. 4BDown, lane 3), although the total amount of EF-1{delta} expressed in COS-7 cells decreased compared with the amount expressed in Sf9 infected with Bac-hEF-1{delta} and Bac-GST. This change of EF-1{delta} is very similar to that observed in HFF cells infected with HSV-1(F) (Kawaguchi et al., 1997aDown ) and, presumably, overexpression of BGLF4 is toxic to the cells as reported for other UL13 homologues (Ng et al., 1996Down ). Supporting this hypothesis, the levels of the other cellular proteins slightly decreased when BGLF4 was overexpressed in baculovirus-infected cells (Fig. 4CDown, lanes 2 and 3). Fig. 4(C)Down also provides evidence that the levels of the other cellular proteins in baculovirus-infected cells were apparently less than those in mock-infected cells. This would be due to the shutting-off of host cell protein synthesis induced by baculovirus infection (Miller, 1996Down ), but not due to the overexpression of EF-1{delta}: overexpression of EF-1{delta} did not affect the expression of the other cellular proteins in COS-7 cells, as described below (Fig. 5CDown).



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4. (A) Immunoblots of electrophoretically separated lysates of Sf9 cells infected with recombinant baculoviruses and COS-7 cells. Lysates from Sf9 cells either mock-infected (lane 1) or infected with Bac-hEF-1{delta} (lane 2) and COS-7 cells (lane 3) were separated in denaturing gels, transferred onto nitrocellulose sheets and reacted with a rabbit polyclonal antibody to EF-1{delta}. (B) Lysates from Sf9 cells mock-infected (lane 1) or coinfected with either Bac-hEF-1{delta} and Bac-GST (lane 2) or Bac-hEF-1{delta} and Bac-GST-BGLF4 (lane 3) were immunoblotted with the antibody to EF-1{delta}. (C) Ponceau S staining of the nitrocellulose membrane described in (B). Molecular masses are indicated on the left.

 


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. (A) Immunoblot of electrophoretically separated lysates of transfected COS-7 cells. Lysates of COS-7 cells mock-transfected (lane 1) or transfected with pME-BGLF4(F) (lane 2) were separated on a denaturing gel, transferred onto a nitrocellulose sheet and reacted with mouse monoclonal antibody to Flag epitope (M2). (B) Lysates of COS-7 cells mock-transfected (lane 1) or transfected with either pME18S (lane 2) or pME-BGLF4(F) (lane 3) were immunoblotted with the antibody to EF-1{delta}. (C) Ponceau S staining of the nitrocellulose membrane described in (B). Molecular masses are indicated on the left.

 
In the second series of experiments, we constructed a BGLF4 mammalian cell expression vector, pME-BGLF4(F) (Fig. 1DUp), to examine whether or not BGLF4 protein mediates modification of endogenous EF-1{delta}. COS-7 cells were transfected with the indicated plasmids using the DEAE-dextran method (Kawaguchi et al., 2000Down ). Cells were harvested 3 days post-transfection and the same amount of protein (as measured by Bio-Rad protein assay kit according to manufacturer’s instructions) was separated in a denaturing gel and immunoblotted using either the anti-Flag epitope antibody M2 (Sigma) or the anti-EF-1{delta} antibody. In COS-7 cells transfected with pME-BGLF4(F), Flag epitope-tagged BGLF4 was efficiently and specifically expressed (Fig. 5AUp). As shown in Fig. 5(B)Up, in COS-7 cells either mock-transfected or transfected with pME18S, the hypophosphorylated form of EF-1{delta} was dominant (Fig. 5BUp, lanes 1 and 2), whereas the amount of the hyperphosphorylated form of the protein was markedly increased after transfection with pME-BGLF4(F) (Fig. 5BUp, lane 3). In the same immunoblot shown in Fig. 5(CUp), the cellular proteins that were stained with Ponceau S served as a loading control for this experiment, eliminating the possibility that overexpression of EF-1{delta} had an effect on the expression of the other cellular proteins.

We concluded from these results that BGLF4 protein mediates EF-1{delta} hyperphosphorylation at a cellular level in mammalian cells.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In the present study, we purified EBV-encoded protein kinase BGLF4 and showed that the purified kinase by itself possesses protein kinase activity in vitro. Furthermore, we identified EF-1{delta} as an in vivo target of the BGLF4 protein. This is the first identification of a cellular target for BGLF4. These results support our hypothesis that EF-1{delta} modification in infected mammalian cells is a conserved function that is expressed by all subfamilies of herpesviruses and that the conserved protein kinases encoded by herpesviruses universally mediate modification.

Our knowledge regarding the requirements of viruses with respect to host cell biosynthetic processes depends in part on the identification of cellular proteins that interact with viral proteins. Therefore, if many viral proteins commonly interact with the same cellular protein, this protein would be suggested to be important in the life cycle of viruses, as viruses sometimes use similar strategies regardless of their large diversity in size, structure and genome arrangement. For instance, most DNA tumour viruses encode proteins (e.g. adenovirus E1A and E1B, simian virus 40 T antigen and papillomavirus E6 and E7) that interact with and modify key cellular proteins such as retinoblastoma protein and p53, and transform host cells by a common strategy (i.e. by interaction with the cellular regulatory proteins) (Knipe, 1996Down ). Our current studies (Kawaguchi et al., 1997aDown , 1998Down , 1999Down ) together with reports from other laboratories, which show that HIV Tat also interacts functionally with a cellular protein and affects translation in vivo (Xiao et al., 1998Down ) and that the RNA polymerase of vesicular stomatis virus associates with the EF-1 complex for its activity (Das et al., 1998Down ), suggest that EF-1{delta} is one of the cellular proteins that is universally important in various virus replication systems.

This study also provides important information for the field of EBV research. (i) We expressed enzymatically active BGLF4 using the baculovirus expression system and purified it to near homogeneity. The purified protein was labelled with [{gamma}-32P]ATP in vitro and the labelling was eliminated by phosphatase treatment, indicating that BGLF4 has the ability to autophosphorylate itself. Our experiments using purified BGLF4 also suggested that it functions, without any cofactors, as a protein kinase. These results supplement those of the study by Chen et al. (2000)Down in which purification and phosphatase treatment were not performed, and confirm the conclusion that BGLF4 protein is a serine/threonine protein kinase. (ii) It is known that HSV-1 UL13 protein kinase and its HCMV counterpart, UL97, regulate viral gene expression by phosphorylation of various viral and cellular proteins (He et al., 1997Down ; Kawaguchi et al., 1998Down ; Ng et al., 1998Down ; Ogle et al., 1997Down ; Prichard et al., 1999Down ; Purves et al., 1992Down , 1993Down ). Furthermore, ORF36 of human herpesvirus-8 (HHV-8), another gammaherpesvirus UL13 homologue, and HCMV UL97 have been reported to phosphorylate ganciclovir and thus induce ganciclovir-mediated cell death (Cannon et al., 1999Down ; Litter et al., 1992Down ; Sullivan et al., 1992Down ). The similarity of BGLF4 to HSV-1 UL13, HCMV UL97 and HHV-8 ORF36 (Cannon et al., 1999Down ; Chee et al., 1989Down ; Smith & Smith, 1989Down ) suggests that BGLF4 plays a role in EBV replication in a manner similar to HSV-1 UL13 and HCMV UL97 and, like HHV-8 ORF36 and HCMV UL97, is a target of anti-viral drugs. Supporting this hypothesis, Chen et al. (2000)Down reported that an EBV regulatory protein, EA-D, is a potential substrate of BGLF4. As it is easy to express large amounts of enzymatically active BGLF4 and to obtain highly purified BGLF4 using our system, this method will be useful for the further characterization of BGLF4. For example, to identify additional cellular and viral targets of the protein and to analyse its sensitivity to anti-viral drugs.


   Acknowledgments
 
We thank Dr K. Maruyama for pME18S. This study was supported in part by grants for Scientific Research (Y.K., E.T. and K.H.) and a grant for Scientific Research in Priority Areas (K.H.) from the Ministry of Education, Science, Sports and Culture of Japan. Y.K. was supported by a grant from the Inamori Foundation.


   Footnotes
 
b This article is dedicated to the memory of Kanji Hirai. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Cannon, J. S., Hamzeh, F., Moore, S., Nicholas, J. & Ambinder, R. F. (1999). Human herpesvirus 8-encoded thymidine kinase and phosphotransferase homologues confer sensitivity to ganciclovir. Journal of Virology 73, 4786-4793.[Abstract/Free Full Text]

Chee, M. S., Lawrence, G. L. & Barrell, B. G. (1989). Alpha-, beta- and gammaherpesviruses encode a putative phosphotransferase. Journal of General Virology 70, 1151-1160.[Abstract/Free Full Text]

Chen, M. R., Chang, S. J., Huang, H. & Chen, J. Y. (2000). A protein kinase activity associated with Epstein–Barr virus BGLF4 phosphorylates the viral early antigen EA-D in vitro. Journal of Virology 74, 3093-3104.[Abstract/Free Full Text]

Das, T., Mathur, M., Gupta, A. K., Janssen, G. M. & Banerjee, A. K. (1998). RNA polymerase of vesicular stomatitis virus specifically associates with translation elongation factor-1 alphabetagamma for its activity. Proceedings of the National Academy of Sciences, USA 95, 1449-1454.[Abstract/Free Full Text]

Edelman, A. M., Blumenthal, D. K. & Krebs, E. G. (1987). Protein serine/threonine kinases. Annual Review of Biochemistry 56, 567-613.[Medline]

Everett, R. D., Preston, C. M. & Stow, N. D. (1991). Functional and genetic analysis of the role of Vmw 110 in herpes simplex virus replication. In Herpesvirus Transcription and its Replication , pp. 50-76. Edited by E. K. Wagner. Boston, MA:CRC Press.

He, Z., He, Y.-S., Kim, Y., Chu, L., Ohmstede, C., Biron, K. K. & Coen, D. M. (1997). The human cytomegalovirus UL97 protein is a protein kinase that autophosphorylates on serines and threonine. Journal of Virology 71, 405-411.[Abstract]

Heineman, T. C. & Cohen, J. I. (1995). The varicella-zoster virus (VZV) open reading frame 47 (ORF47) protein kinase is dispensable for viral replication and is not required for phosphorylation of ORF63 protein, the VZV homolog of herpes simplex virus ICP22. Journal of Virology 69, 7367-7370.[Abstract]

Horimoto, T., Limcumpao, J. A., Xuan, X., Ono, M., Maeda, K., Kawaguchi, Y., Kai, C., Takahashi, E. & Mikami, T. (1992). Heterogeneity of feline herpesvirus type 1 strains. Archives of Virology 126, 283-292.[Medline]

Kawaguchi, Y., Bruni, R. & Roizman, B. (1997a). Interaction of herpesvirus simplex virus 1 alpha regulatory protein ICP0 with elongation factor 1delta: ICP0 affects translational machinery. Journal of Virology 71, 1019-1024.[Abstract]

Kawaguchi, Y., Van Sant, C. & Roizman, B. (1997b). Herpesvirus simplex virus 1{alpha} regulatory protein ICP0 interacts with and stabilized the cell cycle regulator cyclin D3. Journal of Virology 71, 7328-7336.[Abstract]

Kawaguchi, Y., Van Sant, C. & Roizman, B. (1998). Eukaryotic elongation factor 1{delta} is hyperphosphorylated by the protein kinase encoded by the UL13 gene of herpes simplex virus 1. Journal of Virology 72, 1731-1736.[Abstract/Free Full Text]

Kawaguchi, Y., Matsumura, T., Roizman, B. & Hirai, K. (1999). Cellular elongation factor 1{delta} is modified in cells infected with representative alpha-, beta-, or gammaherpesvirus. Journal of Virology 73, 4456-4460.[Abstract/Free Full Text]

Kawaguchi, Y., Nakajima, K., Igarashi, M., Morita, T., Tanaka, M., Suzuki, M., Yokoyama, A., Matsuda, G., Kato, K. & Hirai, K. (2000). Interaction of Epstein–Barr virus nuclear antigen leader protein (EBNA-LP) with HS1-associated protein X-1: implication of cytoplasmic function of EBNA-LP. Journal of Virology 74, 10104-10111.[Abstract/Free Full Text]

Knipe, D. K. (1996). Virus–host cell interactions. In Fields Virology , pp. 273-299. Edited by B. N. Fields, D. M. Knipe & P. Howley. Philadelphia:Lippincott–Raven.

Litter, E., Stuart, A. D. & Chee, M. S. (1992). Human cytomegalovirus UL97 open reading frame encodes a protein that phosphorylates the antiviral nucleoside analogue ganciclovir. Nature 358, 160-162.[Medline]

Merrick, W. C. (1992). Mechanism and regulation of eukaryotic protein synthesis. Microbiological Reviews 56, 291-315.[Abstract/Free Full Text]

Miller, L. K. (1996). Insect viruses. In Fields Virology , pp. 533-556. Edited by B. N. Fields, D. M. Knipe & P. Howley. Philadelphia:Lippincott–Raven.

Moffat, J. F., Zerboni, L., Sommer, M. H., Heineman, T. C., Cohen, J. I., Kaneshima, H. & Arvin, A. M. (1998). The ORF47 and ORF66 putative protein kinases of varicella-zoster virus determine tropism for human T cells and skin in the SCID-hu mouse. Proceedings of the National Academy of Sciences, USA 95, 11969-11974.[Abstract/Free Full Text]

Morales, J., Corminer, P., Mulner-Lorillon, O., Poulhe, R. & Belle, R. (1992). Molecular cloning of a new guanine-nucleotide exchange protein. Nucleic Acids Research 20, 4091.[Free Full Text]

Ng, T. I., Keenan, L., Kinchington, P. R. & Grose, C. (1994). Phosphorylation of varicella-zoster virus open reading frame (ORF) 62 regulatory product by viral ORF47-associated protein kinase. Journal of Virology 68, 1350-1359.[Abstract/Free Full Text]

Ng, T. I., Talarico, C., Burnette, T. C., Biron, K. & Roizman, B. (1996). Partial substitution of the functions of the herpes simplex virus 1 UL13 gene by the human cytomegalovirus UL97 gene. Virology 225, 347-358.[Medline]

Ng, T. I., Ogle, W. O. & Roizman, B. (1998). UL13 protein kinase of herpes simplex virus 1 complexes with glycoprotein E and mediates the phosphorylation of the viral Fc receptor: glycoproteins E and I. Virology 241, 37-48.[Medline]

Ogle, W. O., Ng, T. I., Carter, K. L. & Roizman, B. (1997). The UL13 protein kinase and the infected cell type are determinants of posttranslational modification of ICP0. Virology 235, 406-413.[Medline]

Prichard, M. N., Gao, N., Jairath, S., Mulamba, G., Krosky, P., Coen, D. M., Parker, B. O. & Pari, G. S. (1999). A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. Journal of Virology 73, 5663-5670.[Abstract/Free Full Text]

Purves, F. C. & Roizman, B. (1992). The UL13 gene of herpes simplex virus 1 encodes the functions for posttranslational processing associated with phosphorylation of the regulatory protein {alpha}22. Proceedings of the National Academy of Sciences, USA 89, 7310-7314.[Abstract/Free Full Text]

Purves, F. C., Ogle, W. O. & Roizman, B. (1993). Processing of the herpes simplex virus regulatory protein {alpha}22 mediated by the UL13 protein kinase determines the accumulation of a subset of {alpha} and {gamma} mRNAs and proteins in infected cells. Proceedings of the National Academy of Sciences, USA 90, 6701-6705.[Abstract/Free Full Text]

Riis, B., Rattan, S. I. S., Clark, B. F. C. & Merrick, W. C. (1990). Eukaryotic protein elongation factors. Trends in Biochemical Sciences 15, 420-424.[Medline]

Roizman, B. & Sears, A. E. (1996). The replication of the herpes simplex viruses. In Fields Virology , pp. 2231-2295. Edited by B. N. Fields, D. M. Knipe & P. Howley. Philadelphia:Lippincott–Raven.

Smith, R. F. & Smith, T. F. (1989). Identification of new protein kinase-related genes in three herpesviruses, herpes simplex virus, Varicella-Zoster virus, and Epstein–Barr virus. Journal of Virology 63, 450-455.[Abstract/Free Full Text]

Sullivan, V., Talarico, C. L., Stanat, S. C., Davis, M., Coen, D. M. & Biron, K. K. (1992). A protein kinase homologue controls phosphorylation of ganciclovir in human cytomegalovirus-infected cells. Nature 358, 162-164.[Medline]

Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M. & Arai, N. (1988). SR alpha promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecular and Cellular Biology 8, 466-472.[Abstract/Free Full Text]

Van Damme, H. T. F., Amons, R., Karssie, R., Timmers, C. J., Janssen, G. M. C. & Moller, W. (1990). Elongation factor EF-1{beta} of artemia: localization of functional sites and homology to elongation factor 1{delta}. Biochimica et Biophysica Acta 1050, 241-247.[Medline]

Xiao, H., Neuveut, C., Benkirane, M. & Jeang, K. T. (1998). Interaction of the second coding exon of Tat with human EF-1 delta delineates a mechanism for HIV-1-mediated shut-off of host mRNA translation. Biochemical and Biophysical Research Communications 244, 384-389.[Medline]

Received 14 September 2000; accepted 15 January 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
P.-W. Yang, S.-S. Chang, C.-H. Tsai, Y.-H. Chao, and M.-R. Chen
Effect of phosphorylation on the transactivation activity of Epstein-Barr virus BMRF1, a major target of the viral BGLF4 kinase
J. Gen. Virol., April 1, 2008; 89(4): 884 - 895.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Gershburg, S. Raffa, M. R. Torrisi, and J. S. Pagano
Epstein-Barr Virus-Encoded Protein Kinase (BGLF4) Is Involved in Production of Infectious Virus
J. Virol., May 15, 2007; 81(10): 5407 - 5412.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Kudoh, T. Daikoku, Y. Ishimi, Y. Kawaguchi, N. Shirata, S. Iwahori, H. Isomura, and T. Tsurumi
Phosphorylation of MCM4 at Sites Inactivating DNA Helicase Activity of the MCM4-MCM6-MCM7 Complex during Epstein-Barr Virus Productive Replication.
J. Virol., October 1, 2006; 80(20): 10064 - 10072.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Asai, A. Kato, K. Kato, M. Kanamori-Koyama, K. Sugimoto, T. Sairenji, Y. Nishiyama, and Y. Kawaguchi
Epstein-Barr Virus Protein Kinase BGLF4 Is a Virion Tegument Protein That Dissociates from Virions in a Phosphorylation-Dependent Process and Phosphorylates the Viral Immediate-Early Protein BZLF1.
J. Virol., June 1, 2006; 80(11): 5125 - 5134.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Kato, M. Yamamoto, T. Ohno, M. Tanaka, T. Sata, Y. Nishiyama, and Y. Kawaguchi
Herpes Simplex Virus 1-Encoded Protein Kinase UL13 Phosphorylates Viral Us3 Protein Kinase and Regulates Nuclear Localization of Viral Envelopment Factors UL34 and UL31
J. Virol., February 1, 2006; 80(3): 1476 - 1486.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Kato, M. Yamamoto, T. Ohno, H. Kodaira, Y. Nishiyama, and Y. Kawaguchi
Identification of Proteins Phosphorylated Directly by the Us3 Protein Kinase Encoded by Herpes Simplex Virus 1
J. Virol., July 15, 2005; 79(14): 9325 - 9331.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Yue, E. Gershburg, and J. S. Pagano
Hyperphosphorylation of EBNA2 by Epstein-Barr Virus Protein Kinase Suppresses Transactivation of the LMP1 Promoter
J. Virol., May 1, 2005; 79(9): 5880 - 5885.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Gershburg, M. Marschall, K. Hong, and J. S. Pagano
Expression and Localization of the Epstein-Barr Virus-Encoded Protein Kinase
J. Virol., November 15, 2004; 78(22): 12140 - 12146.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. S. Hamza, R. A. Reyes, Y. Izumiya, R. Wisdom, H.-J. Kung, and P. A. Luciw
ORF36 Protein Kinase of Kaposi's Sarcoma Herpesvirus Activates the c-Jun N-terminal Kinase Signaling Pathway
J. Biol. Chem., September 10, 2004; 279(37): 38325 - 38330.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
E. Gershburg, K. Hong, and J. S. Pagano
Effects of Maribavir and Selected Indolocarbazoles on Epstein-Barr Virus Protein Kinase BGLF4 and on Viral Lytic Replication
Antimicrob. Agents Chemother., May 1, 2004; 48(5): 1900 - 1903.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Hagglund and B. Roizman
Role of ICP0 in the Strategy of Conquest of the Host Cell by Herpes Simplex Virus 1
J. Virol., March 1, 2004; 78(5): 2169 - 2178.
[Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Kato, A. Yokoyama, Y. Tohya, H. Akashi, Y. Nishiyama, and Y. Kawaguchi
Identification of protein kinases responsible for phosphorylation of Epstein-Barr virus nuclear antigen leader protein at serine-35, which regulates its coactivator function
J. Gen. Virol., December 1, 2003; 84(12): 3381 - 3392.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Kawaguchi, K. Kato, M. Tanaka, M. Kanamori, Y. Nishiyama, and Y. Yamanashi
Conserved Protein Kinases Encoded by Herpesviruses and Cellular Protein Kinase cdc2 Target the Same Phosphorylation Site in Eukaryotic Elongation Factor 1{delta}
J. Virol., February 15, 2003; 77(4): 2359 - 2368.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
E. Gershburg and J. S. Pagano
Phosphorylation of the Epstein-Barr Virus (EBV) DNA Polymerase Processivity Factor EA-D by the EBV-Encoded Protein Kinase and Effects of the L-Riboside Benzimidazole 1263W94
J. Virol., February 1, 2002; 76(3): 998 - 1003.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kato, K.
Right arrow Articles by Hirai, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kato, K.