J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tan, P. K.
Right arrow Articles by Cotten, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tan, P. K.
Right arrow Articles by Cotten, M.
Agricola
Right arrow Articles by Tan, P. K.
Right arrow Articles by Cotten, M.
Journal of General Virology (2001), 82, 1465-1472.
© 2001 Society for General Microbiology


Animal: DNA Viruses

Defining CAR as a cellular receptor for the avian adenovirus CELO using a genetic analysis of the two viral fibre proteins

Poi Kiang Tan1, Anne-Isabelle Michou1, Jeffrey M. Bergelson2 and Matt Cotten1

Institute for Molecular Pathology, Dr Bohr-Gasse 7, A-1030 Vienna, Austria1
Division of Immunologic and Infectious Diseases, Children’s Hospital of Philadelphia, Philadelphia, USA2

Author for correspondence: Matt Cotten. Present address: Türkenstrasse 50, 80799 Munich, Germany. Fax +49 89 740 165 20. e-mail cotten{at}axxima.com


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
The coxsackievirus and adenovirus receptor (CAR) is a high affinity receptor used by adenoviruses, including adenovirus type 5 (Ad5). The adenovirus fibre molecule bears the high affinity cell binding domain of Ad5, allowing virions to attach to CAR. The avian adenovirus CELO displays two fibre molecules on its capsid and it was logical to expect that the cell binding functions of CELO might also reside in one or both of these fibres. We had previously shown that the cell binding properties of CELO resemble Ad5, suggesting that the two viruses use similar receptors. Experiments with CAR-deficient CHO cells and CHO cells modified to express CAR demonstrated that CELO has CAR-dependent transduction behaviour like Ad5. Mutations were introduced into the CELO genome to disrupt either the long fibre 1 or the short fibre 2. A CELO genome with fibre 2 disrupted did not generate virus, demonstrating that fibre 2 is essential for some stage in virus growth, assembly or spread. However, a CELO genome with disrupted fibre 1 gene produced virus (CELOdF1) that was capable of entering chicken cells, but had lost both the ability to efficiently transduce human cells and the CAR-specific transduction displayed by wild-type CELO. The ability of CELOdF1 to transduce chicken cells suggests that CELOdF1 may still bind, probably via fibre 2, to a receptor expressed on avian but not mammalian cells. CELOdF1 replication was dramatically impaired in chicken embryos, demonstrating that fibre 1 is important for the in vivo biology of CELO.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
This manuscript describes efforts to understand the functions of the two fibres of the avian adenovirus CELO, the prototype member of the fowl adenovirus type 1 species. Early observations of CELO by electron microscopy revealed a two-fibred capsid (Laver et al., 1971Down ; Gelderblom & Maichle-Lauppe, 1982Down ), clearly different from the capsids of human adenoviruses 2 and 5, which present a single fibre. Subgroup F adenoviruses (Ad40 and 41) also display two types of fibres on their capsids (Kidd et al., 1993Down ; Davison et al., 1993Down ). However, with Ad40/41, only one type of fibre is inserted in each penton, whereas with CELO, each penton displays one short and one long, bent fibre (Laver et al., 1971Down ; Gelderblom & Maichle-Lauppe, 1982Down ; Hess et al., 1995Down ).

The coxsackievirus and adenovirus receptor (CAR) is the high affinity receptor used by adenovirus serotypes 2 and 5 in subgroup C (Bergelson et al., 1997Down , 1998Down ; Tomko et al., 1997Down ; reviewed in Bergelson, 1999Down ). CAR is also used as a receptor for a variety of mastadenovirus serotypes (Roelvink et al., 1998Down ). Adenovirus subgroup C transduction, where transduction is defined as the ability of a virus to bind to, enter and direct expression of a transgene in a target cell, correlates well with CAR expression in cultured cells (Hemmi et al., 1998Down ; Nalbantoglu et al., 1999Down ; Li et al., 1999aDown , bDown ; McDonald et al., 1999Down ; Rebel et al., 2000Down ; Turturro et al., 2000Down ; Pearson et al., 1999Down ). However, additional barriers to adenovirus exist in vivo and CAR expression is not the sole determinant of adenovirus subgroup C transduction (Walters et al., 1999Down ; Schachtner et al., 1999Down ; Fechner et al., 1999Down ; Pickles et al., 2000Down ). There is also evidence that adenovirus subgroup C can employ other cell surface molecules during entry, including integrins (reviewed in Nemerow & Stewart, 1999Down ), MHC class I molecules (Hong et al., 1997Down ) and proteoglycans (Dechecchi et al., 2000Down ). Other adenovirus serotypes may use other receptors. Thus, CAR-independent transduction is observed with adenovirus type 35 for CD34+ cells (Shayakhmetov et al., 2000Down ) and the fibre of subgroup D adenovirus (e.g. Ad17) may have a useful receptor on lung and nervous system targets (Zabner et al., 1999Down ; Chillon et al., 1999Down ). Subgroup B adenoviruses appear to use a receptor distinct from CAR (Defer et al., 1990Down ; Roelvink et al., 1998Down ). The structure of CAR and the details of CAR–fibre interaction are now available (van Raaij et al., 1999Down ; Freimuth et al., 1999Down ; Santis et al., 1999Down ; Kirby et al., 1999Down , 2000Down ; Roelvink et al., 1999Down ; Bewley et al., 1999Down ; Tomko et al., 2000Down ).

The adenovirus fibre molecule bears the high affinity cell binding domain of Ad5, allowing virions to attach to CAR. It was thus logical to expect that the cell binding functions of CELO might also reside in one or both of the fibre molecules present on the CELO virion. It is demonstrated here that CELO, like Ad5, transduces CAR-deficient CHO cells poorly and, as observed for Ad5, transduction is 100-fold greater with CHO cells modified to express CAR. A genetic analysis was performed to determine if one or both of the CELO fibres plays a role in CAR binding. Mutations were introduced into the CELO genome to disrupt either the long fibre 1 or the short fibre 2. A CELO genome with disrupted fibre 2 did not generate virus, suggesting that fibre 2 is essential for some stage of virus propagation. However, a CELO genome with the fibre 1 gene disrupted produced virus (CELOdF1) that was capable of infecting chicken cells, but had lost its ability to efficiently infect all tested human cells. An analysis of CHO and CHO-CAR transduction demonstrated that removal of fibre 1 resulted in loss of the CAR-specific transduction displayed by wild-type CELO. The ability of CELOdF1 to infect chicken cells suggests that CELOdF1 may still bind to a receptor expressed specifically on avian cells, probably via fibre 2.


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Deletion of fibre 1 from the CELO genome (CELOdF1).
The CELO HindIII fragment from nt 27061 to 33921 was cloned into a modified pSP65 plasmid containing no SspI site to generate pTPK91. The CELO fibre 1 sequences between the unique SspI (28094) and HpaI (30503) sites were replaced by a chloramphenicol-resistance cassette to generate pTPK92. The plasmid pTPK93, which contains the CELO SmaI fragments from nt 26156 to 36818 cloned into a pUC19 derivative, was linearized at the unique MluI site and recombined in E. coli BJ5183 with the HindIII fragment from pTPK92 to generate pTPK94. Finally, the SmaI fragment bearing the disrupted CELO fibre 1 region from pTPK94 was introduced into partially digested (AflII) pAIM46 (Michou et al., 1999Down ) by homologous recombination in E. coli BJ5183 to generate pCELOTPK10, a plasmid with ampicillin resistance bearing a SpeI-flanked CELO mutant genome with the following features: CELO nt 1–28094, a chloramphenicol-resistance cassette, CELO nt 30503–40064, a CMV/luciferase/{beta}-globin expression cassette and CELO nt 43685–43804 (Fig. 1aDown).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 1. (a, b) Diagrams showing the construction of CELO genomes with disrupted fibre 1 or fibre 2. (c) CELO can transduce via CAR. CHO-CAR and CHOpDNA3.1 cells were infected with Ad5 (left panel; AdLuc with wt Ad5 capsid), CELOdF1 (middle panel) or CELOwt (right panel) at 102, 3x102, 103, 3x103 or 104 particles per cell (indicated by the triangle under each set of bars, increasing width indicates increasing virus). Forty-eight hours after infection, cells were lysed and assayed for luciferase activity, expressed as relative light units per µg of cellular protein. The data are the mean of triplicate samples with a standard deviation indicated, background measurement from uninfected cell lysates has been subtracted from all values. Open bars, CHO-pCAR; hatched bars, CHO-pCDNA3.1. (d) CELOdF1 is viable, CELOdF2 is not. As described in Methods, LMH cells were transfected with the luciferase-bearing CELO genomes pCELOdF1 or pCELOdF2. Luciferase values (average of three measurements with a standard deviation indicated) are presented for the lysate after each passage.

 
{blacksquare} Deletion of fibre 2 from the CELO genome (CELOdF2).
PCR was performed with OAIM38 (AACAGACGCGTCACCCTGAACTATC, which hybridizes at position 29399 in the CELO genome and introduces an MluI site, underlined) and OAIM37 (TTCTTGGCGCGCCAGCTTCCTTTTC, which hybridizes at position 30562 in the CELO genome and introduces an AscI site, underlined). Meanwhile, CELO genome plasmid pAIM69 (which bears a deletion of CELO nt 41520–43682 and an insertion of a luciferase expression cassette; Michou et al., 1999Down ) was digested with HpaI, the internal HpaI fragments were removed and the fragment bearing the bacterial plasmid sequence and the two CELO ends was religated to generate pAIM73. The OAIM37/38 PCR product was digested with MluI and AscI and subcloned into pAIM73 cut with MluI. The plasmid obtained, pAIM76, has the following features: CELO left end nt 1–4896, CELO right end nt 29399–30562, nt 31326–41730, luciferase expression cassette and CELO right extremity 43685–43812.

pAIM76 was linearized at the unique MluI site and recombined with CELO DNA in E. coli BJ5183 to generate pAIM78, a plasmid with ampicillin resistance bearing a SpeI-flanked CELO mutant genome with the following features: CELO nt 1–30563, nt 30563–31325 are deleted (within the fibre 2 coding sequence), CELO nt 31326–41730, a luciferase expression cassette and CELO nt 43685–43804 (Fig. 1bUp).

{blacksquare} Other viruses.
The luciferase-expressing viruses with wild-type capsid have been described previously (Michou et al., 1999Down ). These include the Ad5-based (AdLuc) or CELO-based CELOwt (CELO with wild-type capsid, AIM46). Both viruses contain the same CMV/luciferase/{beta}-globin cassette that is present in the CELOdF1 and CELOdF2 genomes.

{blacksquare} Cell lines and culture.
Chinese hamster ovary (CHO) cell lines stably transfected to express human CAR (CHO-CAR) or a control CHO cell line stably transfected with pCDNA3.1 (CHO-pCDNA3.1) were previously described (Bergelson et al., 1998Down ). Primary chicken embryonic kidney and liver cells were prepared as previously described (Chiocca et al., 1996Down ).

The A549 (human lung carcinoma) and TIB73 (murine hepatocyte, BNL CL.2) cell lines were from the ATCC, the chicken hepatocyte LMH cell line (Leghorn male hepatoma) was described previously (Kawaguchi et al., 1987Down ), the chicken fibroblast CEF38 cell line was obtained from Martin Zenke (MDC, Berlin, Germany) and normal human dermal fibroblasts were obtained from Clonetics and were used between passage 5 and 15; all five cell types were cultured in DMEM–10% FCS. The 293 cell line (Graham et al., 1977Down ) was from the ATCC and was cultured in MEMalpha with 10% newborn calf serum.

{blacksquare} Virus infections.
Infections were performed in 24-well plates with a defined cell number at approximately 70% confluence. Cells were infected with AdLuc or CELOLuc or CELOdF1 at 10000, 3000, 1000, 300 or 100 virus particles per cell. Cell lysates were prepared at 24 h post-infection and luciferase gene expression was measured in equal protein aliquots.

{blacksquare} Analysis of CELOdF1 and CELOdF2 growth.
The mutant plasmid-borne genomes (pCELOdF1 and pCELOdF2) were linearized with SpeI and transfected into LMH cells in 24-well plates (0·75 µg DNA per well transfected using polyethylenimine, PEI; Michou et al., 1999Down ). After 1 week, the cells were harvested and freeze–thawed/sonicated to release virus progeny. Aliquots of the resulting lysate (passage 0) were analysed for luciferase activity in triplicate and a second set of aliquots was applied to fresh LMH cells. This process was repeated until passage 3.

{blacksquare} PCR analysis of the fibre 1 deletion.
Template DNA was prepared by proteinase K treatment of LMH infected with passage 4 material in 6-well plates. Control DNAs were plasmids carrying either wild-type or truncated fibre 1. Oligonucleotide OTPK57 (5' AACGAGGAGGTTCCCCTAAAGC 3', sense oligo hybridizing at positions 28117–28138 in the CELO genome) and OTPK58 (5' TGTTCACCTGCATGGTGTTGG 3', antisense oligo hybridizing at positions 28829–28849 in CELO genome) were used.

{blacksquare} PCR analysis of the fibre 2 deletion.
Template DNA was prepared by proteinase K treatment of LMH cells infected with passage 4 material. Control DNAs were plasmids carrying either wild-type or truncated fibre 2. Oligonucleotide OTPK61 (5' TCTTGGGAGTGCTTCTGAAAGG 3', sense oligo hybridizing at positions 30933–30954 in the CELO genome) and OTPK62 (5' TCTGGCGGGTTCAAAAGAGG 3', antisense oligo hybridizing at positions 31452–31471 in CELO genome) were used.

{blacksquare} Electrophoresis and Western blot analysis of CELO mutants.
Electrophoresis was performed on 6% or 10% polyacrylamide gels in the presence of SDS and, after transfer to nitrocellulose membranes, viral proteins were analysed by immunoblotting with a polyclonal antibody recognizing CELO capsid proteins (Michou et al., 1999Down ). Antibody binding was revealed with a peroxidase-conjugated secondary antibody (rabbit anti-mouse HRP; Dako) followed by ECL (Amersham).


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
The similarity of transduction levels of various cell types suggested that Ad5 and CELO might use similar receptors for infection. To test this idea more directly, control cells (CHO-pcDNA3.1) lacking functional levels of CAR and CHO-CAR which have been engineered to express high levels of human CAR were used to examine the role of CAR in CELO transduction. CHO-pcDNA3.1 and CHO-CAR were infected with adenovirus or CELO over a range of multiplicities of infection. Both virus types bear the same CMV/luciferase expression cassette; thus transduction efficiencies could be measured by monitoring luciferase activity. CELO transduction was found to be approximately 100-fold higher when the target cells expressed CAR (Fig. 1cUp), similar to the behaviour previously reported for Ad5. The substantial improvement of CELO transduction with CAR-bearing cells demonstrates that CAR can function as a receptor for CELO.

Based on mastadenovirus studies, it was hypothesized that CAR binding would be a property of one or both of the two CELO fibres. To test this hypothesis, CELO genome mutants lacking either fibre 1 (CELOdF1) or fibre 2 (CELOdF2) were constructed within a CELO backbone (Michou et al., 1999Down ) which bears a luciferase expression cassette to facilitate monitoring of virus growth and transduction.

LMH cells were transfected with the linearized plasmid-borne CELO genomes pCELOdF1 (deleted for fibre 1) and pCELOdF2 (deleted for fibre 2). At 1 week intervals, the cells were harvested, freeze–thawed and sonicated to release potential viruses and the cleared lysates were used to infect fresh LMH monolayers. Luciferase activity was monitored at each passage.

Luciferase was clearly present at passage 0, indicating successful transfection of the modified viral genomes (Fig. 1dUp). Luciferase activity was maintained in subsequent passages of CELOdF1, consistent with virus replication and demonstrating that the presence of fibre 1 was not essential for either virus assembly or infection. In contrast, the CELOdF2 genome produced luciferase at passage 0, indicating successful transfection, but luciferase activity was not observed in subsequent passages, indicating that fibre 2 was essential for virus assembly or infection (Fig. 1dUp). This pattern was observed in several transfection attempts, supporting the conclusion that it is the lack of fibre 2 and not a technical problem that was responsible for the absence of passageable material.

Further evidence that CELO fibre 1 is dispensable for virus growth was obtained by amplifying the CELOdF1 material and isolating virions in a pure form for analysis. The CELOdF1 virus yield was reduced compared to that of CELO with a wild-type capsid. Purified CELOdF1 was obtained at approximately 3x109 particles per 107 cells. CELO with a wild-type capsid (e.g. CELOAIM46; Michou et al., 1999Down ) yields approximately 3x1010 particles per 107 cells. Analysis of the protein content of purified virions showed that a single protein with the predicted molecular mass of fibre 1 (78 kDa) was present in CELO wild-type virions but absent from virions of CELOdF1 (Fig. 2aDown, bDown). Assuming a capsid structure similar to Ad5, a molecular stoichiometry of one fibre 1 to 20 hexons would be expected; the observed ratio of fibre 1 to other capsid proteins is consistent with this (Fig. 2aDown, bDown). Analysis of the DNA of CELOdF1 confirmed that the virus had the expected fibre 1 open reading frame deletion (Fig. 2cDown).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Characterization of CELOdF1 virions. (a, b) Analysis of proteins in the virus particles. LMH cells were infected with CeloTPK10 (dF1) or CELOAIM46 (wt) and the resulting particles were purified on CsCl gradients. Aliquots of purified virus (7x109 particles) were resolved on 10% or 6% polyacrylamide gels and immunoblotted using a polyclonal antiserum raised against the CELO capsid proteins (a, 10% gel; b, 6% gel). (c) PCR analysis of CELOdF1. PCR analysis was used to verify the CELO fibre 1 deletion. TPK57/58 primers were annealed to the CELO fibre 1 region and yielded a PCR fragment of 733 bp. TPK61/62 primers were annealed to the CELO fibre 2 region and yielded a PCR fragment of 539 bp. Lane 2, DNA template was from non-infected LMH cells; lane 3, DNA template was pCELOTPK10 (dF1); lane 4, DNA template was from CELOdF1; lane 5, DNA template was pAIM46 (CELOwt); lane 6, DNA template was pTPK94; lane 7, DNA template was pAdLuc. A 100 bp molecular mass marker is shown in lane 1 (GibcoBRL).

 
We considered that removal of one fibre might alter the structural properties of the CELO capsid. A striking structural feature of the CELO virion is its elevated temperature stability compared to Ad5 (reviewed in McFerran & Adair, 1977Down ; Michou et al., 1999Down ), thus an examination of the thermal stability of CELOdF1 infectivity might reveal subtle changes in capsid structure. Because all three virus types (Ad5, CELOwt and CELOdF1) can infect chicken cells (see below), the CEF line was used for this analysis. When Ad5, CELOwt and CELOdF1 were examined for heat stability, the behaviour of Ad5 and CELOwt was as previously reported: Ad5 was compromised by exposure to temperatures above 50 °C, while CELOwt required exposure to temperatures above 60 °C to disrupt infectivity (Fig. 3Down). CELOdF1 behaved like CELOwt, displaying the same profile of heat inactivation (Fig. 3Down). Thus the removal of fibre 1 did not compromise the capsid structure as measured by heat-resistant infectivity.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 3. Removal of fibre 1 does not alter the heat stability of CELO. Infectivity of purified virions after heat treatment was determined. Aliquots of AdLuc, CELOdF1 or CELOwt were diluted to 400 µl in HEPES buffered saline (150 mM NaCl, 20 mM HEPES, pH 7·5) and subjected to heating for 30 min at the indicated temperatures. CEF were infected with the viruses at 104 particles per cell. Forty-eight hours after infection, cells were lysed and assayed for luciferase activity, expressed as relative light units per µg of lysate protein. Results are the mean of triplicate samples with a standard deviation indicated.

 
It was next determined if the removal of fibre 1 altered the transduction range of CELO. An analysis of CELOdF1 transduction of CHO and CHO-CAR cells showed that the efficient CAR-dependent transduction activity of wild-type CELO was not displayed by CELOdF1 (Fig. 1cUp), demonstrating that fibre 1 is essential for CELO transduction via CAR. Consistent with this conclusion, CELOdF1 was inactive for transducing any of the mammalian cells tested, including 293, A549, HepG2 and TIB73 (Fig. 4Down). In contrast, CELOdF1 was capable of transducing a variety of chicken cells, including the CEF and LMH chicken cell lines and primary embryonic chicken hepatocytes and kidney cells, with only modest declines in the efficiency (Fig. 4Down). Thus, it appears that the CELO fibre 1 is responsible for CAR binding activity of CELO and for the high level transduction of mammalian cells obtained with CELO. Fibre 1-independent transduction, presumably via fibre 2, appears to involve a receptor that is present on chicken but not mammalian cells.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 4. CELO fibre 1 is important for mammalian cell transduction and fibre 2 interacts with receptor on avian cells. Infectivity of wild-type vs CELOdF1 on various cell lines was determined. Cells were infected with AdLucTPK (wt Ad5 capsid), CELOdF1 or CELOwt (AIM46, wild-type capsid) at 102, 3x102, 103, 3x103 or 104 particles per cell (indicated by the triangle below each set of bars, increasing width indicates increasing virus). Twenty-four hours after infection, cells were lysed and assayed for luciferase activity, expressed as relative light units per µg of cellular protein. The data are the mean of triplicate samples with a standard deviation indicated; background measurement from uninfected cell lysates has been subtracted from all values.

 
As a further measure of the role of fibre 1 and CAR binding in CELO transduction, the infectivity of CELOwt and of CELOdF1 was compared by measuring virus yield from infected chicken embryos. Embryonic infection via the allantoic cavity involves an initial infection of cells lining the cavity followed by lysis and spread of the virus throughout organs of the developing chicken embryo. CELOwt was especially effective for embryo infection, with full yields of virus obtained with as few as 40 virus particles injected per embryo (Fig. 5Down). Removal of fibre 1 compromised, but did not completely block, the growth of CELO in embryos, with maximum yields of virus obtained only when 4x107 or more virus particles were injected per embryo (Fig. 5Down). Thus it appears that the infection and spread of CELO in chicken embryos is primarily facilitated by fibre 1, although inefficient infection and spread can occur in a manner independent of fibre 1.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Growth of CELOwt and CELOdF1 in chicken embryos. The indicated particle numbers of either CELOwt or CELOdF1 were injected into the allantoic cavity of 9-day-old embryos. After a 4 day incubation at 37 °C, the virus present in cleared lysates of allantoic fluid was measured by luciferase transduction in CEF cells. Each value represents the average of at least five independent embryo infections with luciferase transduction measured in triplicate for the allantoic fluid of each embryo.

 
As a control to demonstrate that the removal of fibre 1 impairs only receptor utilization and does not alter other entry functions of the CELO virion, CELOdF1 was assembled into PEI–DNA complexes which serve to target material via charge interactions with the cell surface (Baker et al., 1997Down ). CELOdF1 was capable of efficient mammalian cell transduction when assembled into such complexes (Fig. 6Down). Thus the function of CELO fibre 1 can be replaced by artificial methods of cell targeting.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 6. Loss of fibre 1 can be compensated by bypassing the need for receptor interaction. CELOwt or CELOdF1 were either applied directly to HepG2 or A549 cells or the viruses were assembled into PEI–DNA complexes as previously described (Baker et al., 1997Down ). The plasmid pSP65 was used as the DNA. Equal virus particle per cell ratios (300, 1000, 3000 or 10000 particles per cell) were used with either free virus (open bars) or virus–DNA–PEI complexes (hatched bars). At 48 h post-infection equal aliquots of lysates were measured for luciferase activity (averages plus a standard deviation indicated).

 
In conclusion, it is demonstrated here that of the two fibre molecules encoded by CELO, the longer fibre 1 is responsible for a CAR-dependent infection pathway. Deletion of fibre 1 is tolerated by the virus presumably because CELO possesses a second mode of cell interaction, likely to involve the shorter fibre 2. Deletion of fibre 1 results in a virus that can still be propagated with reasonable efficiency in avian cells, but which has lost the ability to infect mammalian cells. This virus may provide a useful backbone vector for strategies to target adenovirus to specific mammalian cell types.


   Acknowledgments
 
J.M.B. was supported by a grant from the NIH (HL54734).


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Baker, A., Saltik, M., Lehrmann, H., Killisch, I., Mautner, V., Lamm, G., Christofori, G. & Cotten, M. (1997). Polyethylenimine (PEI) is a simple, inexpensive and effective reagent for condensing and linking plasmid DNA to adenovirus for gene delivery. Gene Therapy 4, 773-782.[Medline]

Bergelson, J. M. (1999). Receptors mediating adenovirus attachment and internalization. Biochemical Pharmacology 57, 975-979.[Medline]

Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L. & Finberg, R. W. (1997). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323.[Abstract/Free Full Text]

Bergelson, J. M., Krithivas, A., Celi, L., Droguett, G., Horwitz, M. S., Wickham, T., Crowell, R. L. & Finberg, R. W. (1998). The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. Journal of Virology 72, 415-419.[Abstract/Free Full Text]

Bewley, M. C., Springer, K., Zhang, Y. B., Freimuth, P. & Flanagan, J. M. (1999). Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science 286, 1579-1583.[Abstract/Free Full Text]

Chillon, M., Bosch, A., Zabner, J., Law, L., Armentano, D., Welsh, M. J. & Davidson, B. L. (1999). Group D adenoviruses infect primary central nervous system cells more efficiently than those from group C. Journal of Virology 73, 2537-2540.[Abstract/Free Full Text]

Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V. & Cotten, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. Journal of Virology 70, 2939-2949.[Abstract]

Davison, A. J., Telford, E. A., Watson, M. S., McBride, K. & Mautner, V. (1993). The DNA sequence of adenovirus type 40. Journal of Molecular Biology 234, 1308-1316.[Medline]

Dechecchi, M. C., Tamanini, A., Bonizzato, A. & Cabrini, G. (2000). Heparan sulfate glycosaminoglycans are involved in adenovirus type 5 and 2–host cell interactions. Virology 268, 382-390.[Medline]

Defer, C., Belin, M. T., Caillet-Boudin, M. L. & Boulanger, P. (1990). Human adenovirus–host cell interactions: comparative study with members of subgroups B and C. Journal of Virology 64, 3661-3673.[Abstract/Free Full Text]

Fechner, H., Haack, A., Wang, H., Wang, X., Eizema, K., Pauschinger, M., Schoemaker, R., Veghel, R., Houtsmuller, A., Schultheiss, H. P., Lamers, J. & Poller, W. (1999). Expression of coxsackie adenovirus receptor and alpha v-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Therapy 6, 1520-1535.[Medline]

Freimuth, P., Springer, K., Berard, C., Hainfeld, J., Bewley, M. & Flanagan, J. (1999). Coxsackievirus and adenovirus receptor amino-terminal immunoglobulin V-related domain binds adenovirus type 2 and fiber knob from adenovirus type 12. Journal of Virology 73, 1392-1398.[Abstract/Free Full Text]

Gelderblom, H. & Maichle-Lauppe, I. (1982). The fibers of fowl adenoviruses. Archives of Virology 72, 289-298.[Medline]

Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology 36, 59-72.[Abstract/Free Full Text]

Hemmi, S., Geertsen, R., Mezzacasa, A., Peter, I. & Dummer, R. (1998). The presence of human coxsackievirus and adenovirus receptor is associated with efficient adenovirus-mediated transgene expression in human melanoma cell cultures. Human Gene Therapy 9, 2363-2373.[Medline]

Hess, M., Cuzange, A., Ruigrok, R. W., Chroboczek, J. & Jacrot, B. (1995). The avian adenovirus penton: two fibres and one base. Journal of Molecular Biology 252, 379-385.[Medline]

Hong, S. S., Karayan, L., Tournier, J., Curiel, D. T. & Boulanger, P. A. (1997). Adenovirus type 5 fiber knob binds to MHC class I alpha2 domain at the surface of human epithelial and B lymphoblastoid cells. EMBO Journal 16, 2294-2306.[Medline]

Kawaguchi, T., Nomura, K., Hirayama, Y. & Kitagawa, T. (1987). Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH. Cancer Research 47, 4460-4464.[Abstract/Free Full Text]

Kidd, A. H., Chroboczek, J., Cusack, S. & Ruigrok, R. W. (1993). Adenovirus type 40 virions contain two distinct fibers. Virology 192, 73-84.[Medline]

Kirby, I., Davison, E., Beavil, A. J., Soh, C. P., Wickham, T. J., Roelvink, P. W., Kovesdi, I., Sutton, B. J. & Santis, G. (1999). Mutations in the DG loop of adenovirus type 5 fiber knob protein abolish high-affinity binding to its cellular receptor CAR. Journal of Virology 73, 9508-9514.[Abstract/Free Full Text]

Kirby, I., Davison, E., Beavil, A. J., Soh, C. P., Wickham, T. J., Roelvink, P. W., Kovesdi, I., Sutton, B. J. & Santis, G. (2000). Identification of contact residues and definition of the CAR-binding site of adenovirus type 5 fiber protein. Journal of Virology 74, 2804-2813.[Abstract/Free Full Text]

Laver, W. G., Younghusband, H. B. & Wrigley, N. G. (1971). Purification and properties of chick embryo lethal orphan virus (an avian adenovirus). Virology 45, 598-614.[Medline]

Li, Y., Pong, R. C., Bergelson, J. M., Hall, M. C., Sagalowsky, A. I., Tseng, C. P., Wang, Z. & Hsieh, J. T. (1999a). Loss of adenoviral receptor expression in human bladder cancer cells: a potential impact on the efficacy of gene therapy. Cancer Research 59, 325-330.[Abstract/Free Full Text]

Li, D., Duan, L., Freimuth, P. & O’Malley, B. W. (1999b). Variability of adenovirus receptor density influences gene transfer efficiency and therapeutic response in head and neck cancer. Clinical Cancer Research 5, 4175-4181.[Abstract/Free Full Text]

McDonald, D., Stockwin, L., Matzow, T., Zajdel, M. B. & Blair, G. (1999). Coxsackie and adenovirus receptor (CAR)-dependent and major histocompatibility complex (MHC) class I-independent uptake of recombinant adenoviruses into human tumour cells. Gene Therapy 6, 1512-1519.[Medline]

McFerran, J. B. & Adair, B. M. (1977). Avian adenoviruses – a review. Avian Pathology 6, 189-217.

Michou, A. I., Lehrmann, H., Saltik, M. & Cotten, M. (1999). Mutational analysis of the avian adenovirus CELO, which provides a basis for gene delivery vectors. Journal of Virology 73, 1399-1410.[Abstract/Free Full Text]

Nalbantoglu, J., Pari, G., Karpati, G. & Holland, P. C. (1999). Expression of the primary coxsackie and adenovirus receptor is downregulated during skeletal muscle maturation and limits the efficacy of adenovirus-mediated gene delivery to muscle cells. Human Gene Therapy 10, 1009-1019.[Medline]

Nemerow, G. R. & Stewart, P. L. (1999). Role of alpha(v) integrins in adenovirus cell entry and gene delivery. Microbiology and Molecular Biology Reviews 63, 725-734.[Abstract/Free Full Text]

Pearson, A. S., Koch, P. E., Atkinson, N., Xiong, M., Finberg, R. W., Roth, J. A. & Fang, B. (1999). Factors limiting adenovirus-mediated gene transfer into human lung and pancreatic cancer cell lines. Clinical Cancer Research 5, 4208-4213.[Abstract/Free Full Text]

Pickles, R. J., Fahrner, J. A., Petrella, J. M., Boucher, R. C. & Bergelson, J. M. (2000). Retargeting the coxsackievirus and adenovirus receptor to the apical surface of polarized epithelial cells reveals the glycocalyx as a barrier to adenovirus-mediated gene transfer. Journal of Virology 74, 6050-6057.[Abstract/Free Full Text]

Rebel, V. I., Hartnett, S., Denham, J., Chan, M., Finberg, R. & Sieff, C. A. (2000). Maturation and lineage-specific expression of the coxsackie and adenovirus receptor in hematopoietic cells. Stem Cells 18, 176-182.[Abstract/Free Full Text]

Roelvink, P. W., Lizonova, A., Lee, J. G., Li, Y., Bergelson, J. M., Finberg, R. W., Brough, D. E., Kovesdi, I. & Wickham, T. J. (1998). The coxsackievirus–adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F. Journal of Virology 72, 7909-7915.[Abstract/Free Full Text]

Roelvink, P. W., Lee, G. M., Einfeld, D. A., Kovesdi, I. & Wickham, T. J. (1999). Identification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-1571.[Abstract/Free Full Text]

Santis, G., Legrand, V., Hong, S. S., Davison, E., Kirby, I., Imler, J.-L., Finberg, R. W., Bergelson, J. M., Mehtali, M. & Boulanger, P. (1999). Molecular determinants of adenovirus serotype 5 fibre binding to its cellular receptor CAR. Journal of General Virology 80, 1519-1527.[Abstract]

Schachtner, S., Buck, C., Bergelson, J. & Baldwin, H. (1999). Temporally regulated expression patterns following in utero adenovirus-mediated gene transfer. Gene Therapy 6, 1249-1257.[Medline]

Shayakhmetov, D. M., Papayannopoulou, T., Stamatoyannopoulos, G. & Lieber, A. (2000). Efficient gene transfer into human CD34(+) cells by a retargeted adenovirus vector. Journal of Virology 74, 2567-2583.[Abstract/Free Full Text]

Tomko, R. P., Xu, R. & Philipson, L. (1997). HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proceedings of the National Academy of Sciences, USA 94, 3352-3356.[Abstract/Free Full Text]

Tomko, R. P., Johansson, C. B., Totrov, M., Abagyan, R., Frisen, J. & Philipson, L. (2000). Expression of the adenovirus receptor and its interaction with the fiber knob. Experimental Cell Research 255, 47-55.[Medline]

Turturro, F., Seth, P. & Link, C. J. (2000). In vitro adenoviral vector p53-mediated transduction and killing correlates with expression of coxsackie–adenovirus receptor and alpha(nu)beta5 integrin in SUDHL-1 cells derived from anaplastic large-cell lymphoma. Clinical Cancer Research 6, 185-192.[Abstract/Free Full Text]

van Raaij, M. J., Louis, N., Chroboczek, J. & Cusack, S. (1999). Structure of the human adenovirus serotype 2 fiber head domain at 1·5  resolution. Virology 262, 333-343.[Medline]

Walters, R. W., Grunst, T., Bergelson, J. M., Finberg, R. W., Welsh, M. J. & Zabner, J. (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia. Journal of Biological Chemistry 274, 10219-10226.[Abstract/Free Full Text]

Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R. & Armentano, D. (1999). A chimeric type 2 adenovirus vector with a type 17 fiber enhances gene transfer to human airway epithelia. Journal of Virology 73, 8689-8695.[Abstract/Free Full Text]

Received 30 November 2001; accepted 7 March 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
D. Y. Logunov, O. V. Zubkova, A. S. Karyagina-Zhulina, E. A. Shuvalova, A. P. Karpov, M. M. Shmarov, I. L. Tutykhina, Y. S. Alyapkina, N. M. Grezina, N. A. Zinovieva, et al.
Identification of HI-Like Loop in CELO Adenovirus Fiber for Incorporation of Receptor Binding Motifs
J. Virol., September 15, 2007; 81(18): 9641 - 9652.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Guardado-Calvo, A. L. Llamas-Saiz, G. C. Fox, P. Langlois, and M. J. van Raaij
Structure of the C-terminal head domain of the fowl adenovirus type 1 long fiber
J. Gen. Virol., September 1, 2007; 88(9): 2407 - 2416.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Zhang and J. M. Bergelson
Adenovirus Receptors
J. Virol., October 1, 2005; 79(19): 12125 - 12131.
[Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
M. Schrenzel, J. L. Oaks, D. Rotstein, G. Maalouf, E. Snook, C. Sandfort, and B. Rideout
Characterization of a New Species of Adenovirus in Falcons
J. Clin. Microbiol., July 1, 2005; 43(7): 3402 - 3413.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Petrella, C. J. Cohen, J. Gaetz, and J. M. Bergelson
A Zebrafish Coxsackievirus and Adenovirus Receptor Homologue Interacts with Coxsackie B Virus and Adenovirus
J. Virol., September 11, 2002; 76(20): 10503 - 10506.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. J. Cohen, Z. Q. Xiang, G.-P. Gao, H. C. J. Ertl, J. M. Wilson, and J. M. Bergelson
Chimpanzee adenovirus CV-68 adapted as a gene delivery vector interacts with the coxsackievirus and adenovirus receptor
J. Gen. Virol., January 1, 2002; 83(1): 151 - 155.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tan, P. K.
Right arrow Articles by Cotten, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tan, P. K.
Right arrow Articles by Cotten, M.
Agricola
Right arrow Articles by Tan, P. K.
Right arrow Articles by Cotten, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS