|
|
||||||||
Animal: DNA Viruses |
Institute for Molecular Pathology, Dr Bohr-Gasse 7, A-1030 Vienna, Austria1
Division of Immunologic and Infectious Diseases, Childrens Hospital of Philadelphia, Philadelphia, USA2
Author for correspondence: Matt Cotten. Present address: Türkenstrasse 50, 80799 Munich, Germany. Fax +49 89 740 165 20. e-mail cotten{at}axxima.com
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The coxsackievirus and adenovirus receptor (CAR) is the high affinity receptor used by adenovirus serotypes 2 and 5 in subgroup C (Bergelson et al., 1997
, 1998
; Tomko et al., 1997
; reviewed in Bergelson, 1999
). CAR is also used as a receptor for a variety of mastadenovirus serotypes (Roelvink et al., 1998
). Adenovirus subgroup C transduction, where transduction is defined as the ability of a virus to bind to, enter and direct expression of a transgene in a target cell, correlates well with CAR expression in cultured cells (Hemmi et al., 1998
; Nalbantoglu et al., 1999
; Li et al., 1999a
, b
; McDonald et al., 1999
; Rebel et al., 2000
; Turturro et al., 2000
; Pearson et al., 1999
). However, additional barriers to adenovirus exist in vivo and CAR expression is not the sole determinant of adenovirus subgroup C transduction (Walters et al., 1999
; Schachtner et al., 1999
; Fechner et al., 1999
; Pickles et al., 2000
). There is also evidence that adenovirus subgroup C can employ other cell surface molecules during entry, including integrins (reviewed in Nemerow & Stewart, 1999
), MHC class I molecules (Hong et al., 1997
) and proteoglycans (Dechecchi et al., 2000
). Other adenovirus serotypes may use other receptors. Thus, CAR-independent transduction is observed with adenovirus type 35 for CD34+ cells (Shayakhmetov et al., 2000
) and the fibre of subgroup D adenovirus (e.g. Ad17) may have a useful receptor on lung and nervous system targets (Zabner et al., 1999
; Chillon et al., 1999
). Subgroup B adenoviruses appear to use a receptor distinct from CAR (Defer et al., 1990
; Roelvink et al., 1998
). The structure of CAR and the details of CARfibre interaction are now available (van Raaij et al., 1999
; Freimuth et al., 1999
; Santis et al., 1999
; Kirby et al., 1999
, 2000
; Roelvink et al., 1999
; Bewley et al., 1999
; Tomko et al., 2000
).
The adenovirus fibre molecule bears the high affinity cell binding domain of Ad5, allowing virions to attach to CAR. It was thus logical to expect that the cell binding functions of CELO might also reside in one or both of the fibre molecules present on the CELO virion. It is demonstrated here that CELO, like Ad5, transduces CAR-deficient CHO cells poorly and, as observed for Ad5, transduction is 100-fold greater with CHO cells modified to express CAR. A genetic analysis was performed to determine if one or both of the CELO fibres plays a role in CAR binding. Mutations were introduced into the CELO genome to disrupt either the long fibre 1 or the short fibre 2. A CELO genome with disrupted fibre 2 did not generate virus, suggesting that fibre 2 is essential for some stage of virus propagation. However, a CELO genome with the fibre 1 gene disrupted produced virus (CELOdF1) that was capable of infecting chicken cells, but had lost its ability to efficiently infect all tested human cells. An analysis of CHO and CHO-CAR transduction demonstrated that removal of fibre 1 resulted in loss of the CAR-specific transduction displayed by wild-type CELO. The ability of CELOdF1 to infect chicken cells suggests that CELOdF1 may still bind to a receptor expressed specifically on avian cells, probably via fibre 2.
| Methods |
|---|
|
|
|---|
Deletion of fibre 1 from the CELO genome (CELOdF1).
-globin expression cassette and CELO nt 4368543804 (Fig. 1a
|
Deletion of fibre 2 from the CELO genome (CELOdF2).
pAIM76 was linearized at the unique MluI site and recombined with CELO DNA in E. coli BJ5183 to generate pAIM78, a plasmid with ampicillin resistance bearing a SpeI-flanked CELO mutant genome with the following features: CELO nt 130563, nt 3056331325 are deleted (within the fibre 2 coding sequence), CELO nt 3132641730, a luciferase expression cassette and CELO nt 4368543804 (Fig. 1b
).
Other viruses.
The luciferase-expressing viruses with wild-type capsid have been described previously (Michou et al., 1999
). These include the Ad5-based (AdLuc) or CELO-based CELOwt (CELO with wild-type capsid, AIM46). Both viruses contain the same CMV/luciferase/
-globin cassette that is present in the CELOdF1 and CELOdF2 genomes.
Cell lines and culture.
Chinese hamster ovary (CHO) cell lines stably transfected to express human CAR (CHO-CAR) or a control CHO cell line stably transfected with pCDNA3.1 (CHO-pCDNA3.1) were previously described (Bergelson et al., 1998
). Primary chicken embryonic kidney and liver cells were prepared as previously described (Chiocca et al., 1996
).
The A549 (human lung carcinoma) and TIB73 (murine hepatocyte, BNL CL.2) cell lines were from the ATCC, the chicken hepatocyte LMH cell line (Leghorn male hepatoma) was described previously (Kawaguchi et al., 1987
), the chicken fibroblast CEF38 cell line was obtained from Martin Zenke (MDC, Berlin, Germany) and normal human dermal fibroblasts were obtained from Clonetics and were used between passage 5 and 15; all five cell types were cultured in DMEM10% FCS. The 293 cell line (Graham et al., 1977
) was from the ATCC and was cultured in MEMalpha with 10% newborn calf serum.
Virus infections.
Infections were performed in 24-well plates with a defined cell number at approximately 70% confluence. Cells were infected with AdLuc or CELOLuc or CELOdF1 at 10000, 3000, 1000, 300 or 100 virus particles per cell. Cell lysates were prepared at 24 h post-infection and luciferase gene expression was measured in equal protein aliquots.
Analysis of CELOdF1 and CELOdF2 growth.
The mutant plasmid-borne genomes (pCELOdF1 and pCELOdF2) were linearized with SpeI and transfected into LMH cells in 24-well plates (0·75 µg DNA per well transfected using polyethylenimine, PEI; Michou et al., 1999
). After 1 week, the cells were harvested and freezethawed/sonicated to release virus progeny. Aliquots of the resulting lysate (passage 0) were analysed for luciferase activity in triplicate and a second set of aliquots was applied to fresh LMH cells. This process was repeated until passage 3.
PCR analysis of the fibre 1 deletion.
Template DNA was prepared by proteinase K treatment of LMH infected with passage 4 material in 6-well plates. Control DNAs were plasmids carrying either wild-type or truncated fibre 1. Oligonucleotide OTPK57 (5' AACGAGGAGGTTCCCCTAAAGC 3', sense oligo hybridizing at positions 2811728138 in the CELO genome) and OTPK58 (5' TGTTCACCTGCATGGTGTTGG 3', antisense oligo hybridizing at positions 2882928849 in CELO genome) were used.
PCR analysis of the fibre 2 deletion.
Template DNA was prepared by proteinase K treatment of LMH cells infected with passage 4 material. Control DNAs were plasmids carrying either wild-type or truncated fibre 2. Oligonucleotide OTPK61 (5' TCTTGGGAGTGCTTCTGAAAGG 3', sense oligo hybridizing at positions 3093330954 in the CELO genome) and OTPK62 (5' TCTGGCGGGTTCAAAAGAGG 3', antisense oligo hybridizing at positions 3145231471 in CELO genome) were used.
Electrophoresis and Western blot analysis of CELO mutants.
Electrophoresis was performed on 6% or 10% polyacrylamide gels in the presence of SDS and, after transfer to nitrocellulose membranes, viral proteins were analysed by immunoblotting with a polyclonal antibody recognizing CELO capsid proteins (Michou et al., 1999
). Antibody binding was revealed with a peroxidase-conjugated secondary antibody (rabbit anti-mouse HRP; Dako) followed by ECL (Amersham).
| Results and Discussion |
|---|
|
|
|---|
Based on mastadenovirus studies, it was hypothesized that CAR binding would be a property of one or both of the two CELO fibres. To test this hypothesis, CELO genome mutants lacking either fibre 1 (CELOdF1) or fibre 2 (CELOdF2) were constructed within a CELO backbone (Michou et al., 1999
) which bears a luciferase expression cassette to facilitate monitoring of virus growth and transduction.
LMH cells were transfected with the linearized plasmid-borne CELO genomes pCELOdF1 (deleted for fibre 1) and pCELOdF2 (deleted for fibre 2). At 1 week intervals, the cells were harvested, freezethawed and sonicated to release potential viruses and the cleared lysates were used to infect fresh LMH monolayers. Luciferase activity was monitored at each passage.
Luciferase was clearly present at passage 0, indicating successful transfection of the modified viral genomes (Fig. 1d
). Luciferase activity was maintained in subsequent passages of CELOdF1, consistent with virus replication and demonstrating that the presence of fibre 1 was not essential for either virus assembly or infection. In contrast, the CELOdF2 genome produced luciferase at passage 0, indicating successful transfection, but luciferase activity was not observed in subsequent passages, indicating that fibre 2 was essential for virus assembly or infection (Fig. 1d
). This pattern was observed in several transfection attempts, supporting the conclusion that it is the lack of fibre 2 and not a technical problem that was responsible for the absence of passageable material.
Further evidence that CELO fibre 1 is dispensable for virus growth was obtained by amplifying the CELOdF1 material and isolating virions in a pure form for analysis. The CELOdF1 virus yield was reduced compared to that of CELO with a wild-type capsid. Purified CELOdF1 was obtained at approximately 3x109 particles per 107 cells. CELO with a wild-type capsid (e.g. CELOAIM46; Michou et al., 1999
) yields approximately 3x1010 particles per 107 cells. Analysis of the protein content of purified virions showed that a single protein with the predicted molecular mass of fibre 1 (78 kDa) was present in CELO wild-type virions but absent from virions of CELOdF1 (Fig. 2a
, b
). Assuming a capsid structure similar to Ad5, a molecular stoichiometry of one fibre 1 to 20 hexons would be expected; the observed ratio of fibre 1 to other capsid proteins is consistent with this (Fig. 2a
, b
). Analysis of the DNA of CELOdF1 confirmed that the virus had the expected fibre 1 open reading frame deletion (Fig. 2c
).
|
|
|
|
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bergelson, J. M. (1999). Receptors mediating adenovirus attachment and internalization. Biochemical Pharmacology 57, 975-979.[Medline]
Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L. & Finberg, R. W. (1997). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323.
Bergelson, J. M., Krithivas, A., Celi, L., Droguett, G., Horwitz, M. S., Wickham, T., Crowell, R. L. & Finberg, R. W. (1998). The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. Journal of Virology 72, 415-419.
Bewley, M. C., Springer, K., Zhang, Y. B., Freimuth, P. & Flanagan, J. M. (1999). Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science 286, 1579-1583.
Chillon, M., Bosch, A., Zabner, J., Law, L., Armentano, D., Welsh, M. J. & Davidson, B. L. (1999). Group D adenoviruses infect primary central nervous system cells more efficiently than those from group C. Journal of Virology 73, 2537-2540.
Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V. & Cotten, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. Journal of Virology 70, 2939-2949.
Davison, A. J., Telford, E. A., Watson, M. S., McBride, K. & Mautner, V. (1993). The DNA sequence of adenovirus type 40. Journal of Molecular Biology 234, 1308-1316.[Medline]
Dechecchi, M. C., Tamanini, A., Bonizzato, A. & Cabrini, G. (2000). Heparan sulfate glycosaminoglycans are involved in adenovirus type 5 and 2host cell interactions. Virology 268, 382-390.[Medline]
Defer, C., Belin, M. T., Caillet-Boudin, M. L. & Boulanger, P. (1990). Human adenovirushost cell interactions: comparative study with members of subgroups B and C. Journal of Virology 64, 3661-3673.
Fechner, H., Haack, A., Wang, H., Wang, X., Eizema, K., Pauschinger, M., Schoemaker, R., Veghel, R., Houtsmuller, A., Schultheiss, H. P., Lamers, J. & Poller, W. (1999). Expression of coxsackie adenovirus receptor and alpha v-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Therapy 6, 1520-1535.[Medline]
Freimuth, P., Springer, K., Berard, C., Hainfeld, J., Bewley, M. & Flanagan, J. (1999). Coxsackievirus and adenovirus receptor amino-terminal immunoglobulin V-related domain binds adenovirus type 2 and fiber knob from adenovirus type 12. Journal of Virology 73, 1392-1398.
Gelderblom, H. & Maichle-Lauppe, I. (1982). The fibers of fowl adenoviruses. Archives of Virology 72, 289-298.[Medline]
Graham, F. L., Smiley, J., Russell, W. C. & Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. Journal of General Virology 36, 59-72.
Hemmi, S., Geertsen, R., Mezzacasa, A., Peter, I. & Dummer, R. (1998). The presence of human coxsackievirus and adenovirus receptor is associated with efficient adenovirus-mediated transgene expression in human melanoma cell cultures. Human Gene Therapy 9, 2363-2373.[Medline]
Hess, M., Cuzange, A., Ruigrok, R. W., Chroboczek, J. & Jacrot, B. (1995). The avian adenovirus penton: two fibres and one base. Journal of Molecular Biology 252, 379-385.[Medline]
Hong, S. S., Karayan, L., Tournier, J., Curiel, D. T. & Boulanger, P. A. (1997). Adenovirus type 5 fiber knob binds to MHC class I alpha2 domain at the surface of human epithelial and B lymphoblastoid cells. EMBO Journal 16, 2294-2306.[Medline]
Kawaguchi, T., Nomura, K., Hirayama, Y. & Kitagawa, T. (1987). Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH. Cancer Research 47, 4460-4464.
Kidd, A. H., Chroboczek, J., Cusack, S. & Ruigrok, R. W. (1993). Adenovirus type 40 virions contain two distinct fibers. Virology 192, 73-84.[Medline]
Kirby, I., Davison, E., Beavil, A. J., Soh, C. P., Wickham, T. J., Roelvink, P. W., Kovesdi, I., Sutton, B. J. & Santis, G. (1999). Mutations in the DG loop of adenovirus type 5 fiber knob protein abolish high-affinity binding to its cellular receptor CAR. Journal of Virology 73, 9508-9514.
Kirby, I., Davison, E., Beavil, A. J., Soh, C. P., Wickham, T. J., Roelvink, P. W., Kovesdi, I., Sutton, B. J. & Santis, G. (2000). Identification of contact residues and definition of the CAR-binding site of adenovirus type 5 fiber protein. Journal of Virology 74, 2804-2813.
Laver, W. G., Younghusband, H. B. & Wrigley, N. G. (1971). Purification and properties of chick embryo lethal orphan virus (an avian adenovirus). Virology 45, 598-614.[Medline]
Li, Y., Pong, R. C., Bergelson, J. M., Hall, M. C., Sagalowsky, A. I., Tseng, C. P., Wang, Z. & Hsieh, J. T. (1999a). Loss of adenoviral receptor expression in human bladder cancer cells: a potential impact on the efficacy of gene therapy. Cancer Research 59, 325-330.
Li, D., Duan, L., Freimuth, P. & OMalley, B. W. (1999b). Variability of adenovirus receptor density influences gene transfer efficiency and therapeutic response in head and neck cancer. Clinical Cancer Research 5, 4175-4181.
McDonald, D., Stockwin, L., Matzow, T., Zajdel, M. B. & Blair, G. (1999). Coxsackie and adenovirus receptor (CAR)-dependent and major histocompatibility complex (MHC) class I-independent uptake of recombinant adenoviruses into human tumour cells. Gene Therapy 6, 1512-1519.[Medline]
McFerran, J. B. & Adair, B. M. (1977). Avian adenoviruses a review. Avian Pathology 6, 189-217.
Michou, A. I., Lehrmann, H., Saltik, M. & Cotten, M. (1999). Mutational analysis of the avian adenovirus CELO, which provides a basis for gene delivery vectors. Journal of Virology 73, 1399-1410.
Nalbantoglu, J., Pari, G., Karpati, G. & Holland, P. C. (1999). Expression of the primary coxsackie and adenovirus receptor is downregulated during skeletal muscle maturation and limits the efficacy of adenovirus-mediated gene delivery to muscle cells. Human Gene Therapy 10, 1009-1019.[Medline]
Nemerow, G. R. & Stewart, P. L. (1999). Role of alpha(v) integrins in adenovirus cell entry and gene delivery. Microbiology and Molecular Biology Reviews 63, 725-734.
Pearson, A. S., Koch, P. E., Atkinson, N., Xiong, M., Finberg, R. W., Roth, J. A. & Fang, B. (1999). Factors limiting adenovirus-mediated gene transfer into human lung and pancreatic cancer cell lines. Clinical Cancer Research 5, 4208-4213.
Pickles, R. J., Fahrner, J. A., Petrella, J. M., Boucher, R. C. & Bergelson, J. M. (2000). Retargeting the coxsackievirus and adenovirus receptor to the apical surface of polarized epithelial cells reveals the glycocalyx as a barrier to adenovirus-mediated gene transfer. Journal of Virology 74, 6050-6057.
Rebel, V. I., Hartnett, S., Denham, J., Chan, M., Finberg, R. & Sieff, C. A. (2000). Maturation and lineage-specific expression of the coxsackie and adenovirus receptor in hematopoietic cells. Stem Cells 18, 176-182.[Medline]
Roelvink, P. W., Lizonova, A., Lee, J. G., Li, Y., Bergelson, J. M., Finberg, R. W., Brough, D. E., Kovesdi, I. & Wickham, T. J. (1998). The coxsackievirusadenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F. Journal of Virology 72, 7909-7915.
Roelvink, P. W., Lee, G. M., Einfeld, D. A., Kovesdi, I. & Wickham, T. J. (1999). Identification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-1571.
Santis, G., Legrand, V., Hong, S. S., Davison, E., Kirby, I., Imler, J.-L., Finberg, R. W., Bergelson, J. M., Mehtali, M. & Boulanger, P. (1999). Molecular determinants of adenovirus serotype 5 fibre binding to its cellular receptor CAR. Journal of General Virology 80, 1519-1527.[Abstract]
Schachtner, S., Buck, C., Bergelson, J. & Baldwin, H. (1999). Temporally regulated expression patterns following in utero adenovirus-mediated gene transfer. Gene Therapy 6, 1249-1257.[Medline]
Shayakhmetov, D. M., Papayannopoulou, T., Stamatoyannopoulos, G. & Lieber, A. (2000). Efficient gene transfer into human CD34(+) cells by a retargeted adenovirus vector. Journal of Virology 74, 2567-2583.
Tomko, R. P., Xu, R. & Philipson, L. (1997). HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proceedings of the National Academy of Sciences, USA 94, 3352-3356.
Tomko, R. P., Johansson, C. B., Totrov, M., Abagyan, R., Frisen, J. & Philipson, L. (2000). Expression of the adenovirus receptor and its interaction with the fiber knob. Experimental Cell Research 255, 47-55.[Medline]
Turturro, F., Seth, P. & Link, C. J. (2000). In vitro adenoviral vector p53-mediated transduction and killing correlates with expression of coxsackieadenovirus receptor and alpha(nu)beta5 integrin in SUDHL-1 cells derived from anaplastic large-cell lymphoma. Clinical Cancer Research 6, 185-192.
van Raaij, M. J., Louis, N., Chroboczek, J. & Cusack, S. (1999). Structure of the human adenovirus serotype 2 fiber head domain at 1·5
resolution. Virology 262, 333-343.[Medline]
Walters, R. W., Grunst, T., Bergelson, J. M., Finberg, R. W., Welsh, M. J. & Zabner, J. (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia. Journal of Biological Chemistry 274, 10219-10226.
Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R. & Armentano, D. (1999). A chimeric type 2 adenovirus vector with a type 17 fiber enhances gene transfer to human airway epithelia. Journal of Virology 73, 8689-8695.
Received 30 November 2001;
accepted 7 March 2001.
This article has been cited by other articles:
![]() |
D. Y. Logunov, O. V. Zubkova, A. S. Karyagina-Zhulina, E. A. Shuvalova, A. P. Karpov, M. M. Shmarov, I. L. Tutykhina, Y. S. Alyapkina, N. M. Grezina, N. A. Zinovieva, et al. Identification of HI-Like Loop in CELO Adenovirus Fiber for Incorporation of Receptor Binding Motifs J. Virol., September 15, 2007; 81(18): 9641 - 9652. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Guardado-Calvo, A. L. Llamas-Saiz, G. C. Fox, P. Langlois, and M. J. van Raaij Structure of the C-terminal head domain of the fowl adenovirus type 1 long fiber J. Gen. Virol., September 1, 2007; 88(9): 2407 - 2416. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang and J. M. Bergelson Adenovirus Receptors J. Virol., October 1, 2005; 79(19): 12125 - 12131. [Full Text] [PDF] |
||||
![]() |
M. Schrenzel, J. L. Oaks, D. Rotstein, G. Maalouf, E. Snook, C. Sandfort, and B. Rideout Characterization of a New Species of Adenovirus in Falcons J. Clin. Microbiol., July 1, 2005; 43(7): 3402 - 3413. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Petrella, C. J. Cohen, J. Gaetz, and J. M. Bergelson A Zebrafish Coxsackievirus and Adenovirus Receptor Homologue Interacts with Coxsackie B Virus and Adenovirus J. Virol., October 15, 2002; 76(20): 10503 - 10506. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Cohen, Z. Q. Xiang, G.-P. Gao, H. C. J. Ertl, J. M. Wilson, and J. M. Bergelson Chimpanzee adenovirus CV-68 adapted as a gene delivery vector interacts with the coxsackievirus and adenovirus receptor J. Gen. Virol., January 1, 2002; 83(1): 151 - 155. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |