J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takemoto, Y.
Right arrow Articles by Hibi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takemoto, Y.
Right arrow Articles by Hibi, T.
Agricola
Right arrow Articles by Takemoto, Y.
Right arrow Articles by Hibi, T.
Journal of General Virology (2001), 82, 1481-1489.
© 2001 Society for General Microbiology


Plant

Genes Ia, II, III, IV and V of Soybean chlorotic mottle virus are essential but the gene Ib product is non-essential for systemic infection

Yutaka Takemoto1 and Tadaaki Hibi1

Laboratory of Plant Pathology, Department of Agricultural and Environmental Biology, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan1

Author for correspondence: Yutaka Takemoto. Fax +81 3 5841 5090. e-mail aa09301{at}mail.ecc.u-tokyo.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Soybean chlorotic mottle virus (SbCMV) is the type species of the genus ‘Soybean chlorotic mottle-like viruses’, within the family Caulimoviridae. The double-stranded DNA genome of SbCMV (8178 bp) contains eight major open reading frames (ORFs). Viral genes essential and non-essential for the replication and movement of SbCMV were investigated by mutational analysis of an infectious 1·3-mer DNA clone. The results indicated that ORFs Ia, II, III, IV and V were essential for systemic infection. The product of ORF Ib was non-essential, although the putative tRNAMet primer-binding site in ORF Ib was proved to be essential. Immunoselection PCR revealed that an ORF Ia deletion mutant was encapsidated in primarily infected cells, indicating that ORF Ia is required for virus movement but not for replication. ORF IV was confirmed to encode a capsid protein by peptide sequencing of the capsid. Analysis of the viral transcripts showed that the SbCMV DNA genome gives rise to a pregenomic RNA and an ORF VI mRNA, as shown in the case of Cauliflower mosaic virus.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Soybean chlorotic mottle virus (SbCMV) is the type species of the genus ‘ Soybean chlorotic mottle-like viruses’, in the family Caulimoviridae (Hull et al., 2000Down ). The virus has been found exclusively in soybean and only in Japan. It is readily transmitted by mechanical inoculation to a few other species of the family Leguminosae, but the natural vector remains unknown (Iwaki et al., 1984Down ; Hibi & Kameya-Iwaki, 1988Down ). The double-stranded DNA genome of SbCMV (8178 bp) contains eight open reading frames (ORFs) and one large non-coding region (NCR) (Hibi et al., 1986Down ; Verver et al., 1987Down ; Hasegawa et al., 1989Down ; Conci et al., 1993Down ).

Caulimoviruses are members of the pararetroviruses. The genome of these viruses is composed of a circular double-stranded DNA molecule ca. 8 kbp in length containing one or more single-stranded discontinuities. The DNA is encapsidated into isometric virions, ca. 50  nm in diameter (for reviews see Hohn & Fütterer, 1997Down ; Schoelz & Bourque, 1999Down ; Hohn, 1999Down ; Reddy & Richins, 1999Down ). Gene functions in caulimoviruses have been investigated, particularly in Cauliflower mosaic virus (CaMV), Figwort mosaic virus (FMV) and Peanut chlorotic streak virus (PClSV). The products of ORF I of CaMV and PClSV are involved in cell-to-cell movement (Thomas et al., 1993Down ; Ducasse et al., 1995Down ). ORF II of CaMV encodes an aphid transmission factor (Blanc et al., 1993Down ). ORF III of CaMV and ORF C of PClSV are essential for infectivity (Daubert et al., 1983Down ; Mushegian et al., 1995Down ). The CaMV ORF III product has DNA-binding activity (Mougeot et al., 1993Down ), associates with virus particles (Dautel et al., 1994Down ), forms a tetramer through an N-terminal coiled-coil (Leclerc et al., 1998Down ) and participates in aphid transmission (Leh et al., 1999Down ). In CaMV, ORF IV encodes the capsid protein (Daubert et al., 1982Down ), and ORF V protein possesses aspartic protease and reverse transcriptase activities (Torruella et al., 1989Down ; Takatsuji et al., 1986Down ). The ORF VI product of CaMV, a major constituent of the virus inclusion body matrix, is translated from monocistronic mRNA (Odell & Howell, 1980Down ) and plays an important role in host range determination and symptom development (Schoelz & Shepherd, 1988Down ; Baughman et al., 1988Down ; Goldberg et al., 1991Down ). A crucial function of the ORF VI products of CaMV, FMV and PClSV is translational transactivation to facilitate polycistronic translation by a reinitiation mechanism from pregenomic RNA (Bonneville et al., 1989Down ; Gowda et al., 1989Down ; Maiti et al., 1998Down ; Scholthof et al., 1992Down ). ORF VII is dispensable for PClSV infectivity (Mushegian et al., 1995Down ), but in FMV it is required as a cis-acting element for the expression of downstream genes on the pregenomic RNA (Gowda et al., 1991Down ).

The genus ‘Soybean chlorotic mottle-like viruses’, which includes SbCMV, PClSV and Cestrum yellow leaf curling virus, is distinguished from other caulimoviruses by the occurrence of three ORFs between ORF I and ORF IV instead of two (ORF II and III) (Hasegawa et al., 1989Down ; Mushegian et al., 1995Down ; Stavolone et al., 1999Down ). These three ORFs, designated Ib, II and III in SbCMV or A, B and C in PClSV, show little or no similarity to the two ORFs of caulimoviruses. In the case of PClSV, ORF B was shown to be dispensable, whereas ORFs A and C were essential for systemic infection. Since ORF A contains a putative tRNA primer-binding site (PBS) for minus-strand DNA synthesis and additional cis-sequences required for efficient priming, it is not clear whether the protein product of ORF A is essential or not (Mushegian et al., 1995Down ). However these three ORFs of PClSV show no significant similarity to those of SbCMV.

In SbCMV, on the other hand, no analysis to determine the genes requisite for infection has been performed as yet, although based on amino acid sequence similarities in the core of each gene, ORFs Ia, IV, V and VI of SbCMV were predicted to encode a movement protein, capsid protein, protease/reverse transcriptase and inclusion body, respectively (Hasegawa et al., 1989Down ). In this study, genes essential and non-essential for infection were determined by mutational analysis of a SbCMV 1·3-mer infectious DNA clone. Also the viral transcripts were characterized.


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Virus purification and DNA isolation.
SbCMV was propagated in kidney bean (Phaseolus vulgaris cv. Honkintoki). The virus was extracted from infected leaves and finally purified by CsCl equilibrium density gradient centrifugation (Iwaki et al., 1984Down ; Reddy et al., 1993Down ). Viral DNA was extracted from infected leaves by the method of Verver et al. (1987)Down .

{blacksquare} Construction of an infectious 1·3-mer SbCMV DNA clone.
Cloning of an infectious 1·3-mer SbCMV DNA (pSbCMV1.3) clone was performed by the procedure described by Ducasse et al. (1995)Down for PClSV. A full-length clone of SbCMV DNA (pSbCMV1.0) was generated by cutting the viral DNA at the unique ClaI site and inserting it into the ClaI site of pBluescript II SK+ (Stratagene) in which the SalI site had been previously disrupted. The chloramphenicol resistance gene of pKF3 (Takara) was amplified by PCR using CmR-F primer (5' GAGCTCGTCGACGAATTTCTGCCATTCATCCG 3'; SalI site is underlined) and CmR-R primer (5' GAGCTCGTCGACACGGAAGATCACTTCGCAGA 3'; SalI site is underlined). The PCR product was inserted into the SalI site of pSbCMV1.0, and the plasmid obtained was designated pSbCMV1.0::CmR. To generate a 0·3-mer clone (pSbCMV0.3) which has a silent mutation in the SalI site of pSbCMV1.0, a ClaI–SnaBI fragment was prepared by overlap extension PCR (Ho et al., 1989Down ) using four primers (Table 1Down), and the PCR product was digested with both ClaI and SnaBI, and then cloned into the ClaI–SmaI site of pBluescript II SK+ (Stratagene) in which the SalI site had been previously disrupted. Finally, to construct pSbCMV1.3, the larger ClaI fragment of pSbCMV1.0::CmR was inserted into the ClaI site of pSbCMV0.3 and then the chloramphenicol resistance gene was removed by SalI digestion followed by religation of the plasmid. pSbCMV1.3 includes a redundant part between the end of ORF V and the front half of ORF VII (nucleotide positions 5462 to 6747) (Fig. 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used for overlap extension PCR

 


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1. A linearized schematic of the genome structure of pSbCMV1.3 and the mutants used in this study. Shaded boxes indicate ORFs. Horizontal bold arrows indicate the NCR promoter for pregenomic RNA. The broken lines indicate deletions. The numbers above each box indicate the amino acid positions of deletion sites. Vertical arrowheads indicate base substitution sites. Primer-binding nucleotides of PBS mutants are indicated by asterisks, nucleotides causing substitution of two amino acid residues are underlined in pDISPBS2. The positions of restriction enzyme cleavage sites used are indicated above the pSbCMV1.3 map. Black bars with letters ‘a’ to ‘f’ represent the gene-specific DNA probes used in Northern analysis. DNA probes: a (full-length genome), b (nt 6721–7875), c (nt 6909–659), d (nt 570–844), e (nt 1163–3627), f (nt 4708–6089). Horizontal arrowheads indicate the positions of primers used for IS–PCR (closed arrowheads), and for 5'- and 3'-RACE PCR (open arrowheads). In the case of the mutants, the redundant regions are abbreviated for convenient display.

 
{blacksquare} Construction of SbCMV DNA mutants.
The structures of the mutants used in this study are indicated in Fig. 1Up. Deletions were introduced in-frame into ORFs Ia, II, III and IV (p{Delta}Ia, p{Delta}II 1, p{Delta}II 2, p{Delta}III and p{Delta}IV) or not in-frame into ORF V (p{Delta}V). In ORF Ib, the ATG start codon was replaced by a TAG stop codon (pDISIb) and the putative PBS was modified by base substitutions (pDISPBS1 and pDISPBS2). To construct p{Delta}Ia and p{Delta}V, pSbCMV1.3 was digested with StuI and MluI, and BstEII and BsmI, respectively. Subsequently, each large fragment was treated with T4 DNA polymerase to generate blunt ends and religated. To construct pDISIb, pDISPBS1, pDISPBS2, p{Delta}II 1, p{Delta}II 2, p{Delta}III and p{Delta}IV, overlap extension PCR was performed using appropriate primers (Table 1Up), and each PCR product was ligated into the MluI–NcoI site (for pDISIb, pDISPBS1, pDISPBS2, p{Delta}II 1, p{Delta}II 2 and p{Delta}III) and the AflII–BstEII site (for p{Delta}IV) of pSbCMV1.3, respectively. The constructed mutants were verified by nucleotide sequencing.

{blacksquare} Infectivity assay, dot blot hybridization assay and immunoselection assay.
P. vulgaris cv. Honkintoki, which is highly susceptible to SbCMV, was grown from seeds in a greenhouse. Two primordial leaves were dusted with Celite abrasive and inoculated with 25 µl DNA (500 µg/ml) in 0·05 M phosphate buffer (pH 7·0) by rubbing with a fingerstall. The inoculated leaves were rinsed immediately with water, and plants were transferred to a growth chamber at 70% relative humidity at 32 °C during the 14 h light period (ca. 20000 lx) and at 28 °C during the 10 h dark period. Symptoms were scored visually at various periods after inoculation. The accumulation of viral DNA in the infected leaves was verified by a dot blot hybridization assay (Maule et al., 1983Down ) 14 or 30 days after inoculation in the case of the inoculated or upper leaves, respectively, using full-length SbCMV DNA prepared from pSbCMV1.0 as a probe. To detect virus infection restricted to the initially infected cells, 10 g of inoculated leaves was subjected to immunoselection PCR (IS–PCR) 12 to 15 days after inoculation according to the protocol described by Ducasse et al. (1995)Down using anti-SbCMV antiserum, Ia-F primer (5' 6909-CCAAACGGAATATAGGATGG-6928 3') and Ia-R primer (5' 7894-GAGTTTGTCCAGTTATCTCC-7875 3').

{blacksquare} Sequencing of the capsid protein.
The purified virus was dissolved in 30 µl of 62·5 mM Tris–HCl (pH 6·8) containing 3·5% SDS, 100 mM dithiothreitol and 10% glycerol, and then heated at 100 °C for 5 min. The protein sample was partially digested with 2 µg of V8 protease (PIERCE) for 1 h at room temperature, electrophoresed through an SDS–polyacrylamide gel (17%) by the method of Cleveland et al. (1977)Down , and then blotted onto an Immobilon P membrane (Millipore) (Hirano, 1989Down ). The appropriate bands were excised from the membrane and sequenced directly by sequential Edman degradation using a protein sequencer (ABI 492).

{blacksquare} Analysis of viral transcripts.
Total RNA was extracted from young infected leaves of P. vulgaris by the phenol/SDS method and then purified by CsCl equilibrium density gradient centrifugation. The purified total RNA was fractionated by oligo(dT)-cellulose chromatography according to the protocol of Ausubel et al. (1995)Down . The polyadenylated RNA fraction was collected as mRNA. Approximately 2 µg of mRNA was electrophoresed in a 1% agarose gel containing 2·2 M formaldehyde and then transferred onto a BIODYNE PLUS membrane (Pall), and hybridized with several kinds of probes as shown in Fig. 1Up using the ECL system (Amersham Pharmacia).

To map the 5'-end of the SbCMV pregenomic RNA, 5' RACE PCR was performed. cDNA was synthesized with VII-R primer (5' 7142-AACTTCTCCTGTCATTAGTC-7123 3') and incubated with terminal deoxynucleotidyl transferase (TdT) and dCTP. The dCTP-tailed cDNA was amplified by PCR using Sb-GSP primer (5' 6305-TAGAGTCTCTCGACTTTGCCGTCC-6281 3') and oligo(dG) anchor primer [5' GGCCACGCGTCGACTAGTAC(G)16 3']. For accurate identification of the 5'-end, the first strand cDNA was incubated with TdT and dATP, and then dATP-tailed cDNA was amplified by PCR using Sb-GSP primer and oligo(dT)Sph anchor primer [5' AACTGGAAGAATTGCATGCAGGAA(T)18 3'; SphI site is underlined]. To determine the poly(A) site, 3' RACE PCR was performed. cDNA was synthesized with oligo(dT)Sph anchor primer and the 3' end sequence was amplified by PCR using VI-F primer (5' 4687-GGAGGGAGGAAGTTACAAAAGG-4708 3') and TSP primer [5' TGGAAGAATTGCATGCAGGAA 3'; homologous to the anchor sequence of oligo(dT)Sph anchor primer] and sequenced.


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Infectivity of the 1·3-mer DNA clone pSbCMV1.3
To verify the infectivity of pSbCMV1.3, primary leaves of P. vulgaris were inoculated with this construct. All of the upper leaves of inoculated plants showed typical mottling and leaf roll symptoms of SbCMV infection at 10 to 14 days post-inoculation. The viral DNA and virus particles were detected in these plants by dot blot hybridization assay and electron microscopy (Fig. 2Down, Table 2Down).



View larger version (115K):
[in this window]
[in a new window]
 
Fig. 2. Infectivity of the pSbCMV1.3 DNA clone. Symptoms of the upper leaves of P. vulgaris: mock inoculated (a), inoculated with SbCMV particles (b), and with pSbCMV1.3 (c). An electron micrograph of progeny virions purified from pSbCMV1.3-infected leaves (d). Scale bar represents 100 nm.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Characteristics of the progeny of SbCMV mutants

 
The ORF Ib product is not essential but the putative PBS is essential for infection
In PClSV, ORF A contains a putative tRNA PBS for first strand DNA synthesis and additional cis-sequences required for efficient priming extend beyond the PBS, but the role of the ORF A product could not be independently determined (Mushegian et al., 1995Down ). In the case of SbCMV, ORF Ib contains the PBS. To determine independently the role of the Ib product, pDISIb was constructed by substituting a TAG stop codon for the start codon so as not to perturb the function of the PBS. This mutant was predicted to be unable to express the Ib product because ORF Ib contains no other endogenous start codon (Fig. 1Up). The infectivity of this construct was assayed with P. vulgaris and shown to be highly infectious. The symptoms appeared on the upper leaves as early as seen in the case of plants inoculated with pSbCMV1.3 (wild-type clone) and were identical to those shown by the wild-type. Viral DNA and virus particles were also detected by dot blot hybridization assay and by electron microscopy in all plants tested (Table 2Up).

The direct sequencing of PCR products of the progeny viral DNA extracted from the upper leaves showed that the mutation was conserved completely (data not shown).

Subsequently, to confirm that the putative PBS is essential for viral DNA replication, we constructed two clones with base substitution mutations in the PBS sequence: pDISPBS1, in which the amino acid sequence encoded was unaltered, and pDISPBS2, in which the coding sequence was changed to result in substitutions of two amino acid residues (Leu-104 to His, Val-105 to His) (Fig. 1Up). Both mutations in PBS were found to abolish virus infectivity (Table 2Up). Also, no viral DNA could be amplified from the inoculated leaves by IS–PCR in the case of either clone (Fig. 3Down). These results indicate that the ORF Ib product is not essential for infection whereas the PBS in this ORF is essential for virus replication, as previously shown for a similar PBS located in ORF A of PClSV (Mushegian et al., 1995Down ).



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 3. Agarose gel electrophoresis of IS–PCR products. PCR products amplified from immunoselected templates from inoculated leaves were electrophoresed in a 1·5% agarose gel. Marker, 100 bp DNA ladder (New England Biolabs). pSbCMV1.3 and each SbCMV mutant examined are shown above the lanes. The amplified fragment of {Delta}Ia was ca. 220 bp shorter than that of SbCMV1.3.

 
ORF Ia is essential for virus movement and ORFs II, III, IV and V are essential for virus replication or assembly
The infectivity of ORF Ia, II, III, IV and V mutants (p{Delta}Ia, p{Delta}II 1, p{Delta}II 2, p{Delta}III, p{Delta}IV and p{Delta}V; Fig. 1Up) was assayed with P. vulgaris. As shown in Table 2Up, none of these mutants caused any symptoms. Moreover the DNA of these mutants was not detectable in the upper leaves or the inoculated leaves by dot blot hybridization assay. These results show that ORFs Ia, II, III, IV and V were essential for systemic infection. To investigate the capacity of these mutants to direct virus replication in initially infected cells, IS–PCR was performed. As shown in Fig. 3Up, viral DNA could be amplified from the plant infected with p{Delta}Ia, whereas no amplified products could be detected in the case of the plants infected with the other constructs. As the primers for IS–PCR were designed to amplify the region containing ORF Ia, the amplified product was confirmed to be mutant viral DNA on the basis of its smaller size (Fig. 3Up). These results indicate that ORF Ia is not required for replication and encapsidation, but is essential for virus movement. This argument is supported by its partial amino acid sequence homology to the sequences of movement proteins of CaMV (Hasegawa et al., 1989Down ) and PClSV (data not shown).

ORFs II, III, IV and V were found to be required for virus replication or assembly. The in-frame deletion mutants of ORF II (p{Delta}II 1 and 2) were lethal, although no homologue of SbCMV ORF II is found in other caulimoviruses. These deletions did not change the reading frame and therefore would not interfere with the continuity of translation of downstream ORFs of the pregenomic RNA. We could not predict the function of the product of ORF II because no significant homology to any known protein was detected in the DNA and protein databases. Further research is necessary to determine the function of this gene product in the life-cycle of SbCMV. Like ORF C of PClSV (Mushegian et al., 1995Down ), ORF III of SbCMV might correspond to ORF III of the other caulimoviruses as it was found to be indispensable for infection and its product contains a basic/proline-rich domain in the C-terminal region and a putative coiled-coil domain in the N-terminal region (Leclerc et al., 1998Down ). In construction of p{Delta}III, the N-terminal coiled-coil domain was deleted. The deletion of 20 amino acid residues in the coiled-coil of CaMV ORF III was shown to lead to a non-infectious virus (Jacquot et al., 1998Down ). Our data confirm that this domain is important for infectivity of SbCMV. ORF IV was identified as a capsid protein because the determined sequences of various peptides derived from the capsid protein were identical to parts of the deduced amino acid sequence of this ORF, as described below. This ORF was found to be essential for virus multiplication. In construction of p{Delta}IV, the zinc finger motif conserved among all pararetroviruses was deleted. It has been previously shown in the case of CaMV and FMV that a mutation altering the zinc finger motif abolishes the infectivity of these viruses (Scholthof et al., 1993Down ; Guerra-Peraza et al., 2000Down ). The loss of infectivity of p{Delta}IV appears to be dependent on the lack of the zinc finger motif. The deletion of ORF V, which encodes a reverse transcriptase, completely abolished virus replication, as expected.

We could not analyse the functions of ORFs VI and VII in this study because it was difficult to construct mutants of these two ORFs as they are duplicated in pSbCMV1.3. But as the resequenced data of the full-length SbCMV genome (revised data are shown in DDBJ, EMBL and GenBank nucleotide sequence databases) showed the existence of a translational transactivator (TAV) motif in ORF VI, as already mentioned by De Tapia et al. (1993)Down , the ORF VI product of SbCMV appears to have the role of TAV in the other caulimoviruses.

ORF IV encodes a capsid protein
ORF IV of SbCMV was presumed to encode a capsid protein because it has one copy of a zinc finger motif conserved in the capsid proteins of other caulimoviruses (Hasegawa et al., 1989Down ). However, strict identification of this ORF has not been performed previously. To confirm the identity of this ORF, N-terminal amino acid sequencing of the SbCMV capsid protein (56 kDa) was attempted, but the sequence could not be determined because the N terminus of the capsid protein appeared to be blocked. Therefore, the capsid protein was partially cleaved with V8 protease, and three of the resulting peptide fragments (24 kDa, 23 kDa and 14 kDa) were partially sequenced. The determined peptide sequences were identical to the deduced amino acid sequence of ORF IV at the amino acid positions 203 to 219 (SEEAFSQNNYYKLINLE), 220 to 234 (ICNMCYLENFLCEFQ) and 72 to 90 (AETSNKRKFDKNPEFTRFK).

Identification of viral transcripts
To investigate the mode of SbCMV gene expression, Northern blot analysis of viral transcripts was performed. The results indicated that two major virus-specific transcripts were produced (Fig. 4Down). The larger transcript (ca. 8200 nt) was found to be a pregenomic RNA as all of the six different probes covering all ORFs of SbCMV DNA hybridized with this RNA. The smaller transcript (ca. 1800 nt) hybridized only with a probe covering the ORF VI region of the genome, suggesting that it corresponds to a monocistronic mRNA like the 19S RNA of CaMV. In CaMV and FMV, the ORF VI product has been shown to possess TAV activity, causing reinitiation of translation (Bonneville et al., 1989Down ; Gowda et al., 1989Down ; Scholthof et al., 1992Down ). Therefore, the expression of all of the genes on the pregenomic RNA is thought to be efficiently activated by the ORF VI product translated from a monocistronic mRNA in these viruses. Since ORF VI of SbCMV has the TAV motif, as mentioned above, gene expression might take place in the same manner.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4. Northern analysis of total mRNAs isolated from SbCMV-infected P. vulgaris plants. Hybridization was performed with the probes shown in Fig. 1Up. The arrows indicate the positions of the two viral transcripts.

 
Subsequent determination of the 5'-end of the pregenomic RNA showed that the transcription initiation site was at nucleotide position 6184 (underlined), located in the NCR of the SbCMV genome: 6150TATAAATAAGAGACCAAGGACTCTATTGTTC CTTGGAGTTTGATTGAGTAA6200. A TATA box is located at nucleotide position 6150 (indicated in italics), which is 34 nt upstream from the transcription initiation site. This confirmed that transcription of the pregenomic RNA is promoted by the NCR promoter as predicted (Conci et al., 1993Down ). The results of 3' RACE PCR indicated that the poly(A) site was between nucleotide positions 6230 and 6232 (indicated in boldface) of the viral DNA: 6210CCAATAGTGCCGTGTAAGGCCAA6232(A)n.

Since the VI-F primer for 3' RACE PCR was based on the ORF VI present in both the pregenomic and monocistronic RNAs (shown in Fig. 1Up), the poly(A) site of both mRNAs would be located at the same position. Attempts to determine the 5'-end of the monocistronic mRNA by 5' RACE PCR were not successful, as the PCR products had various 5'-ends scattered between nucleotide positions 4420 and 4579 of the viral DNA and no TATA or TATA-like box was located upstream of these 5'-ends.

The pregenomic RNA of plant pararetroviruses carries a long leader sequence which contains several short ORFs (sORFs) and has the potential to form a large stem–loop structure; both features are known to be inhibitory for downstream translation (Pooggin et al., 1999Down ). To bypass these scanning-inhibitory regions, a ribosome shunt mechanism has been shown to be used in the case of CaMV (Fütterer et al., 1990Down , 1993Down ) and Rice tungro bacilliform virus (Fütterer et al., 1996Down ). Also, in other plant pararetroviruses, such a ribosome shunt mechanism has been predicted to exist because of the conservation of the consensus cis-elements (Pooggin et al., 1999Down ). However, our results showed that the SbCMV pregenomic RNA leader sequence was 293 nt in length, containing only one sORF overlapping ORF VII. Moreover, no extensive secondary structure was predicted to exist in this leader sequence, as mentioned by Pooggin et al. (1999)Down . This indicated that the ribosome shunt mechanism is not likely to be used in the case of SbCMV.

We have previously reported that a DNA fragment with a sequence corresponding to a region within ORF III of SbCMV, called promoter IV, could promote the expression of a downstream connected GUS gene in tobacco mesophyll protoplasts (Hasegawa et al., 1989Down ; Conci et al., 1993Down ). However, no transcript for ORF IV and its downstream ORFs could be detected in analysis of SbCMV-infected P. vulgaris leaves. No internal transcription units for ORFs I to V have been identified in other caulimoviruses, although a subgenomic RNA for ORF V of CaMV has been postulated (Plant et al., 1985Down ; Hohn et al., 1990Down ). Therefore, SbCMV promoter IV might not be functional in situ, although the excised fragment has promoter activity in vitro.


   Acknowledgments
 
We thank Professor M. Kameya-Iwaki of Yamaguchi University for kindly supplying the antiserum to SbCMV, and Mr S. Tomioka of The University of Tokyo for peptide sequencing.


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1995). Current Protocols in Molecular Biology. New York: John Wiley.

Baughman, G., Jacobs, J. D. & Howell, S. H. (1988). Cauliflower mosaic virus gene VI produces a symptomatic phenotype in transgenic tobacco plants. Proceedings of the National Academy of Sciences, USA 85, 733-737.[Abstract/Free Full Text]

Blanc, S., Cerutti, M., Chaabihi, H., Louis, C., Devauchelle, G. & Hull, R. (1993). Gene II product of an aphid-nontransmissible isolate of cauliflower mosaic virus expressed in a baculovirus system possesses aphid transmission factor activity. Virology 192, 651-654.[Medline]

Bonneville, J. M., Sanfaçon, H., Fütterer, J. & Hohn, T. (1989). Posttranscriptional trans-activation in cauliflower mosaic virus. Cell 59, 1135-1143.[Medline]

Cleveland, D. W., Fisher, S. G., Kirschner, M. W. & Laemmli, U. K. (1977). Peptide mapping by limited proteolysis in sodium dodecyl sulfate and analysis by gel electrophoresis. Journal of Biological Chemistry 252, 1102-1106.[Abstract/Free Full Text]

Conci, L. R., Nishizawa, Y., Saito, M., Date, T., Hasegawa, A., Miki, K. & Hibi, T. (1993). A strong promoter fragment from the large noncoding region of soybean chlorotic mottle virus DNA. Annals of the Phytopathological Society of Japan 59, 432-437.

Daubert, S., Richins, R. D., Shepherd, R. J. & Gardner, R. C. (1982). Mapping of the coat protein gene of cauliflower mosaic virus by its expression in a prokaryotic system. Virology 122, 444-449.

Daubert, S., Shepherd, R. J., Richard, C. & Gardner, R. C. (1983). Insertional mutagenesis of the cauliflower mosaic virus genome. Gene 25, 201-208.[Medline]

Dautel, S., Guidasci, T., Pique, M., Mougeot, J. L., Lebeurier, G., Yot, P. & Mesnard, J. M. (1994). The full-length product of CaMV open reading frame III is associated with the viral particle. Virology 202, 1043-1045.[Medline]

De Tapia, M., Himmelbach, A. & Hohn, T. (1993). Molecular dissection of the cauliflower mosaic virus translation transactivator. EMBO Journal 12, 3305-3314.[Medline]

Ducasse, D. A., Mushegian, A. R. & Shepherd, R. J. (1995). Gene I mutants of peanut chlorotic streak virus, a caulimovirus, replicate in plants but do not move from cell to cell. Journal of Virology 69, 5781-5786.[Abstract]

Fütterer, J., Gorgon, K., Sanfaçon, H., Bonneville, J. M. & Hohn, T. (1990). Positive and negative control of translation by the leader sequence of cauliflower mosaic virus pregenomic 35S RNA. EMBO Journal 9, 1697-1707.[Medline]

Fütterer, J., Kiss-László, Z. & Hohn, T. (1993). Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA. Cell 73, 789-802.[Medline]

Fütterer, J., Potrykus, I., Bao, Y., Li, L., Burns, T. M., Hull, R. & Hohn, T. (1996). Position-dependent ATT initiation during plant pararetrovirus rice tungro bacilliform virus translation. Journal of Virology 70, 2999-3010.[Abstract]

Goldberg, K. B., Kiernan, J. & Shepherd, R. J. (1991). A disease syndrome associated with expression of gene VI of caulimoviruses may be a nonhost reaction. Molecular Plant–Microbe Interactions 4, 182-189.

Gowda, S., Wu, F. C., Scholthof, H. B. & Shepherd, R. J. (1989). Gene VI of figwort mosaic virus (caulimovirus group) functions in posttranscriptional expression of genes on the full-length RNA transcript. Proceedings of the National Academy of Sciences, USA 86, 9203-9207.[Abstract/Free Full Text]

Gowda, S., Scholthof, H. B., Wu, F. C. & Shepherd, R. J. (1991). Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus. Virology 185, 867-871.[Medline]

Guerra-Peraza, O., De Tapia, M., Hohn, T. & Hemmings-Mieszczak, M. (2000). Interaction of the cauliflower mosaic virus coat protein with the pregenomic RNA leader. Journal of Virology 74, 2067-2072.[Abstract/Free Full Text]

Hasegawa, A., Verver, J., Shimada, A., Saito, M., Goldbach, R., Van Kammen, A., Miki, K., Kameya-Iwaki, M. & Hibi, T. (1989). The complete sequence of soybean chlorotic mottle virus DNA and the identification of novel promoter. Nucleic Acids Research 17, 9993-10013.[Abstract/Free Full Text]

Hibi, T. & Kameya-Iwaki, M. (1988). Soybean chlorotic mottle virus. AAB Descriptions of Plant Viruses, no. 331.

Hibi, T., Iwaki, M., Saito, Y., Verver, J. & Goldbach, R. (1986). Double-stranded DNA of soybean chlorotic mottle virus. Annals of the Phytopathological Society of Japan 52, 785-792.

Hirano, H. (1989). Microsequence analysis of the winged bean seed proteins electroblotted from two-dimensional gel. Journal of Protein Chemistry 8, 115-130.[Medline]

Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, R. K. (1989). Site-directed mutagenesis by overlap extension using PCR. Gene 77, 51-59.[Medline]

Hohn, T. (1999). Caulimoviruses: molecular biology. In Encyclopedia of Virology , pp. 1281-1285. Edited by A. Granoff & R. G. Webster. San Diego:Academic Press.

Hohn, T. & Fütterer, J. (1997). The proteins and functions of plant pararetroviruses: knowns and unknowns. Critical Reviews in Plant Sciences 16, 133-161.

Hohn, T., Bonneville, J. M., Fütterer, J., Gordon, K., Jiricny, J., Karlsson, S., Sanfaçon, H., Schultze, M. & De Tapia, M. (1990). The use of 35S RNA as either messenger or replicative intermediate might control the cauliflower mosaic virus replication cycle. In Viral Genes and Plant Pathogenesis , pp. 79-88. Edited by T. P. Pirone & J. G. Shaw. New York:Springer-Verlag.

Hull, R., Lockhart, B. E., Reddy, D. V. R. & Schoelz, J. E. (2000). Caulimoviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 335-347. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.

Iwaki, M., Isogawa, Y., Tsuzuki, H. & Honda, Y. (1984). Soybean chlorotic mottle virus, a new caulimovirus on soybean. Plant Disease 68, 1009-1011.

Jacquot, E., Geldreich, A., Keller, M. & Yot, P. (1998). Mapping regions of the cauliflower mosaic virus ORF III product required for infectivity. Virology 242, 395-402.[Medline]

Leclerc, D., Burri, L., Kajava, A. V., Mougeot, J. L., Hess, D., Lustig, A., Kleemann, G. & Hohn, T. (1998). The open reading frame III product of cauliflower mosaic virus forms a tetramer through a N-terminal coiled-coil. Journal of Biological Chemistry 273, 29015-29021.[Abstract/Free Full Text]

Leh, V., Jacquot, E., Geldreich, A., Hermann, T., Leclerc, D., Cerutti, M., Yot, P., Keller, M. & Blanc, S. (1999). Aphid transmission of cauliflower mosaic virus requires the viral PIII protein. EMBO Journal 18, 7077-7085.[Medline]

Maiti, I. B., Richins, R. D. & Shepherd, R. J. (1998). Gene expression regulated by gene VI of caulimovirus: transactivation of downstream genes of transcripts by gene VI of peanut chlorotic streak virus in transgenic tobacco. Virus Research 57, 113-124.[Medline]

Maule, A. J., Hull, R. & Donson, J. (1983). The application of spot hybridization to the detection of DNA and RNA viruses in plant tissues. Journal of Virological Methods 6, 215-224.[Medline]

Mougeot, J. L., Guidasci, T., Wurch, T., Lebeurier, G. & Mesnard, J. M. (1993). Identification of C-terminal amino acid residues of cauliflower mosaic virus open leading frame III protein responsible for its DNA binding activity. Proceedings of the National Academy of Sciences, USA 90, 1470-1473.[Abstract/Free Full Text]

Mushegian, A. R., Wolff, J. A., Richins, R. D. & Shepherd, R. J. (1995). Molecular analysis of the essential and nonessential genetic elements in the genome of peanut chlorotic streak caulimovirus. Virology 206, 823-834.[Medline]

Odell, J. T. & Howell, S. H. (1980). The identification, mapping, and characterization of mRNA for p66, a cauliflower mosaic virus-coded protein. Virology 102, 349-359.

Plant, A. L., Covey, S. & Grierson, D. (1985). Detection of a subgenomic mRNA for gene V, the putative reverse transcriptase gene of cauliflower mosaic virus. Nucleic Acids Research 13, 8305-8312.[Abstract/Free Full Text]

Pooggin, M. M., Fütterer, J., Skryabin, K. G. & Hohn, T. (1999). A short open reading frame terminating in front of a stable hairpin is the conserved feature in pregenomic RNA leaders of plant pararetroviruses. Journal of General Virology 80, 2217-2228.[Abstract/Free Full Text]

Reddy, D. V. R. & Richins, R. D. (1999). Legume caulimoviruses. In Encyclopedia of Virology , pp. 1289-1292. Edited by A. Granoff & R. G. Webster. San Diego:Academic Press.

Reddy, D. V. R., Richins, R. D., Rajeshwari, R., Iizuka, N., Manohar, S. K. & Shepherd, R. J. (1993). Peanut chlorotic streak virus, a new caulimovirus infecting peanuts (Arachis hypogaea) in India. Phytopathology 83, 129-133.

Schoelz, J. E. & Shepherd, R. J. (1988). Host range control of cauliflower mosaic virus. Virology 162, 30-37.[Medline]

Schoelz, J. E. & Bourque, J. E. (1999). Caulimoviruses: general features. In Encyclopedia of Virology , pp. 1275-1281. Edited by A. Granoff & R. G. Webster. San Diego:Academic Press.

Scholthof, H. B., Gowda, S., Wu, F. C. & Shepherd, R. J. (1992). The full-length transcript of a caulimovirus is a polycistronic mRNA whose genes are trans activated by the product of gene VI. Journal of Virology 65, 5190-5195.

Scholthof, H. B., Wu, F. C., Kiernan, J. M. & Shepherd, R. J. (1993). The putative zinc finger of a caulimovirus is essential for infectivity but does not influence gene expression. Journal of General Virology 74, 775-780.[Abstract/Free Full Text]

Stavolone, I., Ragozzino, A. & Hohn, T. (1999). Cestrum yellow leaf curling virus: a new plant pararetrovirus. In Abstract Book of XIth International Congress of Virology, p. 316.

Takatsuji, H., Hirochika, H., Fukushi, T. & Ikeda, J. E. (1986). Expression of cauliflower mosaic virus reverse transcriptase in yeast. Nature 319, 240-243.

Thomas, C. L., Perbal, C. & Maule, A. J. (1993). A mutation in cauliflower mosaic virus gene I interferes with virus movement but not virus replication. Virology 192, 415-421.[Medline]

Torruella, M., Gordon, K. & Hohn, T. (1989). Cauliflower mosaic virus produces an aspartic proteinase to cleave its polyproteins. EMBO Journal 8, 2819-2825.[Medline]

Verver, J., Schijns, P., Hibi, T. & Goldbach, R. (1987). Characterization of the genome of soybean chlorotic mottle virus. Journal of General Virology 68, 159-167.

Received 23 November 2000; accepted 12 February 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
L. Stavolone, A. Ragozzino, and T. Hohn
Characterization of Cestrum yellow leaf curling virus: a new member of the family Caulimoviridae
J. Gen. Virol., December 1, 2003; 84(12): 3459 - 3464.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takemoto, Y.
Right arrow Articles by Hibi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takemoto, Y.
Right arrow Articles by Hibi, T.
Agricola
Right arrow Articles by Takemoto, Y.
Right arrow Articles by Hibi, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS