|
|
||||||||
Plant |
Institute of Biochemistry and Biophysics PAS, Ul. Pawi
skiego 5A, 02-106 Warsaw, Poland1
Institut des Sciences Végétales CNRS, Av. de la Terrasse, 91 198 Gif-sur-Yvette, France2
Author for correspondence: Ewa Sadowy. Present address: Sera & Vaccine Central Research Laboratory, Ul. Che
mska 30/34, 00-725 Warszawa, Poland. Fax +48 22 841 29 49. e-mail sadowy{at}ibbrain.ibb.waw.pl
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
6 kb with a small protein, VPg, linked to its 5' end (Mayo et al., 1982
|
Infectious cDNA clones and their modification by reverse genetics represent important tools to study RNA viruses (reviewed in Boyer & Haenni, 1994
). We used an infectious cDNA clone of the Polish isolate of PLRV (Sadowy et al., 2000
) to study the role of ORF0 in the virus life-cycle. For this purpose, two mutations that abolished ORF0 expression were constructed and their consequences were followed in vitro and in vivo.
Two plasmids, pJF (Sadowy et al., 1998
) and pBOK [Fig. 1B
; Sadowy et al., 2001
(accompanying paper)] were used to construct mutants of ORF0. pJF was mutagenized by Tth111I-cleavage at nt position 81, end-filling and re-ligation. The resulting plasmid (pJF-T) contains an additional C residue at nt 81 which causes a frameshift and, as a consequence, terminates translation of ORF0 at position 106. In addition, a mutation that changes Gln-47 of the putative ORF0 product (nt 208210) into a stop codon was introduced by site-directed mutagenesis (QuikChange, Stratagene) using primers 208-1 and 208-2 (5' GTTATAATCATGAATAGATTTACCGCATATGC and 5'ATATGCGGTAAATCTATTCATGATTATAACCG; altered nucleotides in bold) to yield plasmid pQ47stop. The sequence of viral cDNA in the clone was verified.
Plasmid pBOK contains a full-length cDNA of PLRV flanked by the 35S promoter and terminator sequences of Cauliflower mosaic virus (CaMV) in pBin19 (Bevan, 1988). It drives efficient virus replication upon agroinoculation of potato leaf discs (Sadowy et al., 2001
). The P0 mutations described above were introduced into pBOK using a smaller derivative thereof, pOK, as an intermediate. pOK is a derivative of pBluescript KS(+) (Stratagene) that contains the 35S promoter and the cDNA corresponding to nt 1369 of PLRV. Plasmids carrying the P0 mutations were digested with KpnI (cuts upstream of the 35S promoter) and ApaI (cuts at nt 369 of the PLRV genome), and the mutant fragments were exchanged for the corresponding wild-type DNA of pBOK, yielding pBOK-T and pBQ47stop, respectively.
The impact of these ORF0 mutations on the synthesis of ORF1 and ORF2 proteins was studied by in vitro translation of transcripts derived from plasmids pJF, pJF-T and pQ47stop. Plasmid DNAs linearized with ScaI (nt position 5882) were used for in vitro transcription (Kujawa et al., 1993
); 200 ng of the uncapped transcripts were then translated in a rabbit reticulocyte lysate (Boehringer Mannheim) supplemented with L-[35S]methionine. Radioactively labelled products were separated on discontinuous denaturing 12·5% polyacrylamide gels (Laemmli, 1970
) and visualized by autoradiography (Fig. 2
). Translation of the wild-type transcript (lane 4) and PLRV gRNA (lane 5) resulted in the same pattern of three major proteins (28, 70 and 118 kDa), corresponding to the translation products of ORF0, ORF1 and the natural ORF1ORF2 frameshift. Two proteins of 70 and 118 kDa were detected as translation products of pJF-T and pQ47stop (lanes 2 and 3). Therefore, the introduced mutations prevent ORF0 synthesis without affecting translation of overlapping ORF1 or influencing efficiency of the ORF1ORF2 frameshift.
|
|
In addition, the ORF0 protein may be involved in an interaction with a host specificity factor. Considering the relatively low sequence conservation of ORF0 among poleroviruses (Mayo & Ziegler-Graff, 1996
) and the infection-like phenotype of ORF0-transgenic plants, such a role for ORF0 protein appears possible. Such a function has indeed been demonstrated for P1 of RYMV (Voinnet et al., 1999
). Additional experiments to identify viral or cellular targets of the ORF0 protein will be required to further clarify its role in the PLRV life-cycle.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Arias, C. F., Preugschat, F. & Strauss, J. H. (1993). Dengue 2 virus NS2B and NS3 form a stable complex that can cleave NS3 within the helicase domain. Virology 193, 888-899.[Medline]
Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12, 8711-8721.
Bonneau, C., Brugidou, C., Chen, L., Beachy, R. N. & Fauquet, C. (1998). Expression of the rice yellow mottle virus P1 protein in vitro and in vivo and its involvement in virus spread. Virology 244, 79-86.[Medline]
Boyer, J.-Ch. & Haenni, A.-L. (1994). Infectious transcripts and cDNA clones of RNA viruses. Virology 198, 415-426.[Medline]
Datta, U. & Dasgupta, A. (1994). Expression and subcellular localization of poliovirus VPg-precursor protein 3AB in eukaryotic cells: evidence for glycosylation in vitro. Journal of Virology 68, 4468-4477.
de Groot, R. J., Hardy, W. R., Shirako, Y. & Strauss, J. H. (1990). Cleavage-site preferences of Sindbis virus polyproteins containing the non-structural proteinase. Evidence for temporal regulation of polyprotein processing in vivo. EMBO Journal 9, 2631-2638.[Medline]
Hulanicka, M. D., Sadowy, E., Juszczuk, M. & Gronenborn, B. (1999). ORF1 of potato leafroll virus encodes a serine proteinase indispensable for viral replication. Oral presentation at the XIth International Congress of Virology, Sydney, 913 August 1999.
Kujawa, A. B., Drugeon, G., Hulanicka, D. & Haenni, A.-L. (1993). Structural requirements for efficient translational frameshifting in the synthesis of the putative viral RNA-dependent RNA polymerase of potato leafroll virus. Nucleic Acids Research 21, 2165-2171.
Laemmli, U. K. (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Lama, J., Paul, A. V., Harris, K. S. & Wimmer, E. (1994). Properties of purified recombinant poliovirus protein 3AB as substrate for viral proteinases and as co-factor for RNA polymerase 3Dpol. Journal of Biological Chemistry 269, 66-70.
Mayo, M. A. & Ziegler-Graff, V. (1996). Molecular biology of luteoviruses. Advances in Virus Research 46, 416-460.
Mayo, M. A., Barker, H., Robinson, D. J., Tamada, T. & Harrison, B. D. (1982). Evidence that potato leafroll virus RNA is positive-stranded, is linked to a small protein and does not contain polyadenylate. Journal of General Virology 59, 163-167.
Mayo, M. A., Robinson, D. J., Jolly, C. A. & Hyman, L. (1989). Nucleotide sequence of potato leafroll luteovirus RNA. Journal of General Virology 70, 1037-1051.
Miller, W. A., Brown, C. M. & Wang, S. (1997). New punctuation for the genetic code: luteovirus gene expression. Seminars in Virology 8, 3-13.
Molla, A., Harris, K. S., Paul, A. V., Shin, S. H., Mugevero, J. & Wimmer, E. (1994). Stimulation of poliovirus proteinase 3Cpro-related proteolysis by the genome-linked protein VPg and its precursor 3AB. Journal of Biological Chemistry 269, 27015-27020.
Pringle, C. R. (1998). Virus taxonomy San Diego 1998. Report of the 27th Meeting of the Executive Committee of the International Committee on Taxonomy of Viruses. Archives of Virology 143, 1449-1459.[Medline]
Reutenauer, A., Ziegler-Graff, V., Lot, H., Scheidecker, D., Guilley, H., Richards, K. & Jonard, G. (1993). Identification of beet western yellows luteovirus genes implicated in viral replication and particle morphogenesis. Virology 195, 692-699.[Medline]
Richards, O. C. & Ehrenfeld, E. (1998). Effects of poliovirus 3AB protein on 3D polymerase-catalyzed reaction. Journal of Biological Chemistry 273, 12832-12840.
Sadowy, E., Pluta, K., Gronenborn, B. & Hulanicka, D. (1998). Infectious transcripts from cloned cDNA of potato leafroll virus. Acta Biochimica Polonica 45, 611-619.[Medline]
Sadowy, E., Wi
niewska, A., Gronenborn, B. & Hulanicka, D. (2000). Genes involved in Potato leafroll virus replication. Plant Virus Invasion and Host Defence. EMBO Workshop, Kolymbari, Crete, Greece, 28 May1 June 2000.
Sadowy, E., Juszczuk, M., David, C., Gronenborn, B. & Hulanicka, M. D. (2001). Mutational analysis of the proteinase function of Potato leafroll virus. Journal of General Virology 82, 1517-1527.
Schaad, M. C., Jensen, P. E. & Carrington, J. C. (1997). Formation of plant RNA virus replication complexes on membranes: role of an endoplasmic reticulum-targeted viral protein. EMBO Journal 16, 4049-4059.[Medline]
Tamm, T. & Truve, E. (2000a). Sobemoviruses. Journal of Virology 74, 6231-6241.
Tamm, T. & Truve, E. (2000b). RNA-binding activities of cocksfoot mottle sobemovirus proteins. Virus Research 66, 197-207.[Medline]
Towner, J. S., Ho, T. V. & Semler, B. L. (1996). Determinants of membrane association for poliovirus protein 3AB. Journal of Biological Chemistry 271, 26810-26818.
van der Wilk, F., Houterman, P., Molthoff, J., Hans, F., Dekker, B., van den Heuvel, J. M. F. M., Huttinga, H. & Goldbach, R. (1997). Expression of the potato leafroll virus ORF0 induces viral-disease-like symptoms in transgenic potato plants. Molecular PlantMicrobe Interactions 10, 153-159.
Voinnet, O., Pinto, Y. M. & Baulcombe, D. C. (1999). Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proceedings of National Academy of Sciences, USA 96, 14147-14152.
Wassenaar, A. L. M., Spaan, W. J. M., Gorbalenya, A. E. & Snijder, E. J. (1997). Alternative proteolytic processing of the arterivirus replicase ORF1a polyprotein: evidence that NSP2 acts as a cofactor for the NSP4 serine protease. Journal of Virology 71, 9313-9322.[Abstract]
Webster, A., Leith, I. R. & Hay, R. T. (1994). Activation of adenovirus-coded protease and processing of preterminal protein. Journal of Virology 68, 7292-7300.
Received 17 November 2000;
accepted 14 February 2001.
This article has been cited by other articles:
![]() |
X. Li, C. Halpin, and M. D. Ryan A novel cleavage site within the potato leafroll virus P1 polyprotein J. Gen. Virol., May 1, 2007; 88(5): 1620 - 1623. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pfeffer, P. Dunoyer, F. Heim, K. E. Richards, G. Jonard, and V. Ziegler-Graff P0 of Beet Western Yellows Virus Is a Suppressor of Posttranscriptional Gene Silencing J. Virol., June 5, 2002; 76(13): 6815 - 6824. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Guyader and D. G. Ducray Sequence analysis of Potato leafroll virus isolates reveals genetic stability, major evolutionary events and differential selection pressure between overlapping reading frame products J. Gen. Virol., June 1, 2002; 83(7): 1799 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sadowy, M. Juszczuk, C. David, B. Gronenborn, and M. D. Hulanicka Mutational analysis of the proteinase function of Potato leafroll virus J. Gen. Virol., June 1, 2001; 82(6): 1517 - 1527. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |