J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadowy, E.
Right arrow Articles by Hulanicka, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadowy, E.
Right arrow Articles by Hulanicka, M. D.
Agricola
Right arrow Articles by Sadowy, E.
Right arrow Articles by Hulanicka, M. D.
Journal of General Virology (2001), 82, 1529-1532.
© 2001 Society for General Microbiology


Plant

The ORF0 product of Potato leafroll virus is indispensable for virus accumulation

Ewa Sadowy1,2, Anna Maasen1, Marek Juszczuk1, Chantal David2, Wlodzimierz Zagórski-Ostoja1, Bruno Gronenborn2 and M. Danuta Hulanicka1

Institute of Biochemistry and Biophysics PAS, Ul. Pawiskiego 5A, 02-106 Warsaw, Poland1
Institut des Sciences Végétales CNRS, Av. de la Terrasse, 91 198 Gif-sur-Yvette, France2

Author for correspondence: Ewa Sadowy. Present address: Sera & Vaccine Central Research Laboratory, Ul. Chelmska 30/34, 00-725 Warszawa, Poland. Fax +48 22 841 29 49. e-mail sadowy{at}ibbrain.ibb.waw.pl


   Abstract
TOP
Abstract
Main text
References
 
Using a cDNA expression cassette in combination with agroinoculation of potato leaf discs we have investigated the role the protein encoded by ORF0 of Potato leafroll virus (PLRV) and have shown its importance for virus accumulation. Two mutations introduced into ORF0 by site-directed mutagenesis prevented expression of the corresponding protein and completely abolished virus accumulation in plant cells. They did not, however, affect translation of ORF1 and ORF2. We therefore conclude that ORF0 of PLRV produces a protein essential for virus accumulation, a hitherto undescribed finding.


   Main text
TOP
Abstract
Main text
References
 
Potato leafroll virus (PLRV) is the type member of the genus Polerovirus and belongs to the family Luteoviridae, which also contains the genera Luteovirus and Enamovirus (Pringle, 1998Down ). PLRV has a monopartite, non-polyadenylated RNA genome of ~6 kb with a small protein, VPg, linked to its 5' end (Mayo et al., 1982Down ). PLRV RNA encodes six main open reading frames (ORF; Fig. 1ADown) that are expressed by a variety of mechanisms (reviewed in Miller et al., 1997Down ). The three 5'-proximal ORFs are translated directly from the genomic RNA and include ORF1, encoding the 70 kDa viral proteinase (Hulanicka et al., 1999Down ) and ORF2, which is translated via a ribosomal frameshift within ORF1 to yield the 118 kDa viral replicase. Three other ORFs are expressed via a subgenomic RNA synthesized in infected cells and include ORF3, encoding the 23 kDa viral capsid protein, ORF4, encoding a 17 kDa putative movement protein and ORF5, expressed by translational readthrough as a fusion protein with the capsid protein. It encodes a 56 kDa protein that presumably is involved in aphid transmission of the virus.



View larger version (7K):
[in this window]
[in a new window]
 
Fig. 1. (A) Schematic structure of the PLRV genome. ORFs are represented by boxes. The catalytic centre of the putative viral proteinase is marked by an asterisk; the VPg coding sequence is represented by a black box in ORF1. The VPg at the 5' end of the genomic RNA is represented by a closed circle; the GDD motif of the putative replicase is indicated by an open square, oblique and horizontal arrows symbolize ribosomal frameshift and readthrough sites, respectively. (B) Schematic representation of the pBOK plasmid. Dashed rectangles marked 35S-p and ter denote the 35S promoter and terminator sequences, respectively; arrowheads marked LB and RB denote the T-DNA left and right border, respectively. Relevant restriction endonuclease sites are symbolized as follows: A, ApaI; K, KpnI; T, Tth111I; thick black line symbolizes viral cDNA.

 
The function of the putative 28 kDa translation product of ORF0 in the PLRV life-cycle is unknown. Apart from its counterparts in other poleroviruses (reviewed in Mayo & Ziegler-Graff, 1996Down ), it shares no homology with known proteins. An analogous protein, P1, is also encoded by the genome of sobemoviruses, enamoviruses and barnaviruses (reviewed in Tamm & Truve, 2000aDown ). Transgenic plants expressing PLRV ORF0 show symptoms similar to those observed in plants infected with the virus and the phenotype of such transgenic plants appears to correlate with the amount of mRNA for ORF0 (van der Wilk et al., 1997Down ). Although a translation product of ORF0 was undetectable in transgenic plants, other constructs producing untranslatable ORF0 mRNA resulted in symptomless transgenic plants. Inactivation of ORF0 in an infectious cDNA clone of Beet western yellows virus (BWYV) resulted in a reduction of virus replication and a delay in onset of symptoms upon plant infection (Reutenauer et al., 1993Down ). Rice yellow mottle virus (RYMV) deficient in P1 was unable to spread in host plants although some level of replication was maintained (Bonneau et al., 1998Down ). This observation, together with the fact that P1 of Cocksfoot mottle virus is an RNA-binding protein, led to the suggestion that P1 of sobemoviruses might be a movement protein (Tamm & Truve, 2000aDown ).

Infectious cDNA clones and their modification by reverse genetics represent important tools to study RNA viruses (reviewed in Boyer & Haenni, 1994Down ). We used an infectious cDNA clone of the Polish isolate of PLRV (Sadowy et al., 2000Down ) to study the role of ORF0 in the virus life-cycle. For this purpose, two mutations that abolished ORF0 expression were constructed and their consequences were followed in vitro and in vivo.

Two plasmids, pJF (Sadowy et al., 1998Down ) and pBOK [Fig. 1BUp; Sadowy et al., 2001Down (accompanying paper)] were used to construct mutants of ORF0. pJF was mutagenized by Tth111I-cleavage at nt position 81, end-filling and re-ligation. The resulting plasmid (pJF-T) contains an additional C residue at nt 81 which causes a frameshift and, as a consequence, terminates translation of ORF0 at position 106. In addition, a mutation that changes Gln-47 of the putative ORF0 product (nt 208–210) into a stop codon was introduced by site-directed mutagenesis (QuikChange, Stratagene) using primers 208-1 and 208-2 (5' GTTATAATCATGAATAGATTTACCGCATATGC and 5'ATATGCGGTAAATCTATTCATGATTATAACCG; altered nucleotides in bold) to yield plasmid pQ47stop. The sequence of viral cDNA in the clone was verified.

Plasmid pBOK contains a full-length cDNA of PLRV flanked by the 35S promoter and terminator sequences of Cauliflower mosaic virus (CaMV) in pBin19 (Bevan, 1988). It drives efficient virus replication upon agroinoculation of potato leaf discs (Sadowy et al., 2001Down ). The P0 mutations described above were introduced into pBOK using a smaller derivative thereof, pOK, as an intermediate. pOK is a derivative of pBluescript KS(+) (Stratagene) that contains the 35S promoter and the cDNA corresponding to nt 1–369 of PLRV. Plasmids carrying the P0 mutations were digested with KpnI (cuts upstream of the 35S promoter) and ApaI (cuts at nt 369 of the PLRV genome), and the mutant fragments were exchanged for the corresponding wild-type DNA of pBOK, yielding pBOK-T and pBQ47stop, respectively.

The impact of these ORF0 mutations on the synthesis of ORF1 and ORF2 proteins was studied by in vitro translation of transcripts derived from plasmids pJF, pJF-T and pQ47stop. Plasmid DNAs linearized with ScaI (nt position 5882) were used for in vitro transcription (Kujawa et al., 1993Down ); 200 ng of the uncapped transcripts were then translated in a rabbit reticulocyte lysate (Boehringer Mannheim) supplemented with L-[35S]methionine. Radioactively labelled products were separated on discontinuous denaturing 12·5% polyacrylamide gels (Laemmli, 1970Down ) and visualized by autoradiography (Fig. 2Down). Translation of the wild-type transcript (lane 4) and PLRV gRNA (lane 5) resulted in the same pattern of three major proteins (28, 70 and 118 kDa), corresponding to the translation products of ORF0, ORF1 and the natural ORF1–ORF2 frameshift. Two proteins of 70 and 118 kDa were detected as translation products of pJF-T and pQ47stop (lanes 2 and 3). Therefore, the introduced mutations prevent ORF0 synthesis without affecting translation of overlapping ORF1 or influencing efficiency of the ORF1–ORF2 frameshift.



View larger version (98K):
[in this window]
[in a new window]
 
Fig. 2. Proteins synthesized by ORF0 mutants in an in vitro translation system. Lane 1, translation of TMV RNA; lanes 2, 3 and 4, translation of pJFT, pQ47stop and pJF transcripts, respectively; lane 5, translation of PLRV virion RNA; lane 6, translation without exogenous RNA. The calculated sizes of the proteins are indicated on the right.

 
The biological importance of ORF0 expression was assessed by agroinoculation with plasmids pBOK, pBOK-T and pBQ47stop. Agroinoculation of potato leaf discs followed by RNA and protein isolation and their analysis by Northern hybridization and immunoblotting, respectively, were done as described (Sadowy et al., 2001Down ). Both pBOK-T and pBQ47stop failed to produce any genomic or subgenomic viral RNA (Fig. 3ADown, lanes 4 and 5, respectively), whereas in RNA preparations from leaf discs agroinoculated with pBOK (wild-type control) the genomic and subgenomic RNAs were readily detected (Fig. 3ADown, lane 3). Consistent with the results of the Northern analyses, viral capsid protein was absent from protein preparations obtained from leaf discs agroinoculated with pBOK-T or pBQ47stop (Fig. 3BDown, lanes 4 and 5, respectively) whereas it was readily detected in extracts prepared from discs agroinoculated with pBOK (Fig. 3BDown, lane 3).



View larger version (75K):
[in this window]
[in a new window]
 
Fig. 3. RNA and proteins synthesized by ORF0 mutants in leaf discs. (A) Northern analysis of RNA isolated from leaf discs agroinoculated with pBOK, pBOK-T and pB-Q47stop. Lane 1, RNA isolated from Physalis floridana infected with PLRV; lane 2, RNA isolated from mock-inoculated leaf discs; lanes 3, 4 and 5, RNA isolated from leaf discs agroinoculated with pBOK, pBOK-T and pB-Q47stop, respectively. Methylene blue staining of 28S rRNA as a control of equal loading of RNA (10 µg per lane except lane 1) as shown below. (B) Western analysis of capsid protein in total proteins isolated from leaf discs agroinoculated with pBOK, pBOK-T and pB-Q47stop. Lane 1, proteins isolated from mock-inoculated leaf discs; lane 2, virions of PLRV; lanes 3, 4 and 5, proteins isolated from leaf discs agroinoculated with pBOK-T, pB-Q47stop and pBOK, respectively.

 
To exclude the possibility that the mutations that abolish expression of a functional ORF0 product also influence expression of the overlapping ORF1 and the ORF1–ORF2 frameshift protein, we verified their expression by in vitro translation. The results of leaf disc agroinoculations with pBOK-T and pBQ47stop demonstrate that a functional ORF0 product is required for PLRV accumulation. This finding raises questions about the role of an ORF0 protein in this process. Considering its location in the viral genome, ORF0 may be expressed early during infection and it seems plausible that its product may play a direct role in PLRV replication. Analyses of the amino acid sequence of the ORF0 translation product revealed the presence of a potential transmembrane domain and potential phosphorylation sites (Mayo et al., 1989Down ). The relatively high content of hydrophobic amino acids in the ORF0 protein suggests that it may serve as a membrane anchor for the replication complex, as was shown for the 6 kDa protein of Tobacco etch virus (Schaad et al., 1997Down ) and the 3A protein of Poliovirus (Datta & Dasgupta, 1994Down ; Towner et al., 1996Down ). The ORF0 protein might also act as a cofactor of the PLRV proteinase or replicase. Protein cofactors are required for activity of numerous virus-encoded proteinases (de Groot et al., 1990Down ; Arias et al., 1993Down ; Amberg et al., 1994Down ; Molla et al., 1994Down ; Webster et al., 1994Down ; Wassenaar et al., 1997Down ) and stimulate replicase activity (Lama et al., 1994Down ; Richards & Ehrenfeld, 1998Down ).

In addition, the ORF0 protein may be involved in an interaction with a host specificity factor. Considering the relatively low sequence conservation of ORF0 among poleroviruses (Mayo & Ziegler-Graff, 1996Down ) and the infection-like phenotype of ORF0-transgenic plants, such a role for ORF0 protein appears possible. Such a function has indeed been demonstrated for P1 of RYMV (Voinnet et al., 1999Down ). Additional experiments to identify viral or cellular targets of the ORF0 protein will be required to further clarify its role in the PLRV life-cycle.


   Acknowledgments
 
We thank Anne-Lise Haenni for critical reading of manuscript. This work was supported by grant 6P04B01615 from the State Committee for Scientific Research (KBN). E.S. was a recipient of a UNESCO short-term fellowship in Biotechnology (SC/BSC/LS/97/BAC).


   References
TOP
Abstract
Main text
References
 
Amberg, S. M., Nestorowicz, A., McCourt, D. W. & Rice, C. M. (1994). NS2B3 proteinase-mediated processing in the yellow fever virus structural region: in vitro and in vivo studies. Journal of Virology 68, 3794-3802.[Abstract/Free Full Text]

Arias, C. F., Preugschat, F. & Strauss, J. H. (1993). Dengue 2 virus NS2B and NS3 form a stable complex that can cleave NS3 within the helicase domain. Virology 193, 888-899.[Medline]

Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12, 8711-8721.[Abstract/Free Full Text]

Bonneau, C., Brugidou, C., Chen, L., Beachy, R. N. & Fauquet, C. (1998). Expression of the rice yellow mottle virus P1 protein in vitro and in vivo and its involvement in virus spread. Virology 244, 79-86.[Medline]

Boyer, J.-Ch. & Haenni, A.-L. (1994). Infectious transcripts and cDNA clones of RNA viruses. Virology 198, 415-426.[Medline]

Datta, U. & Dasgupta, A. (1994). Expression and subcellular localization of poliovirus VPg-precursor protein 3AB in eukaryotic cells: evidence for glycosylation in vitro. Journal of Virology 68, 4468-4477.[Abstract/Free Full Text]

de Groot, R. J., Hardy, W. R., Shirako, Y. & Strauss, J. H. (1990). Cleavage-site preferences of Sindbis virus polyproteins containing the non-structural proteinase. Evidence for temporal regulation of polyprotein processing in vivo. EMBO Journal 9, 2631-2638.[Medline]

Hulanicka, M. D., Sadowy, E., Juszczuk, M. & Gronenborn, B. (1999). ORF1 of potato leafroll virus encodes a serine proteinase indispensable for viral replication. Oral presentation at the XIth International Congress of Virology, Sydney, 9–13 August 1999.

Kujawa, A. B., Drugeon, G., Hulanicka, D. & Haenni, A.-L. (1993). Structural requirements for efficient translational frameshifting in the synthesis of the putative viral RNA-dependent RNA polymerase of potato leafroll virus. Nucleic Acids Research 21, 2165-2171.[Abstract/Free Full Text]

Laemmli, U. K. (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lama, J., Paul, A. V., Harris, K. S. & Wimmer, E. (1994). Properties of purified recombinant poliovirus protein 3AB as substrate for viral proteinases and as co-factor for RNA polymerase 3Dpol. Journal of Biological Chemistry 269, 66-70.[Abstract/Free Full Text]

Mayo, M. A. & Ziegler-Graff, V. (1996). Molecular biology of luteoviruses. Advances in Virus Research 46, 416-460.

Mayo, M. A., Barker, H., Robinson, D. J., Tamada, T. & Harrison, B. D. (1982). Evidence that potato leafroll virus RNA is positive-stranded, is linked to a small protein and does not contain polyadenylate. Journal of General Virology 59, 163-167.

Mayo, M. A., Robinson, D. J., Jolly, C. A. & Hyman, L. (1989). Nucleotide sequence of potato leafroll luteovirus RNA. Journal of General Virology 70, 1037-1051.[Abstract/Free Full Text]

Miller, W. A., Brown, C. M. & Wang, S. (1997). New punctuation for the genetic code: luteovirus gene expression. Seminars in Virology 8, 3-13.

Molla, A., Harris, K. S., Paul, A. V., Shin, S. H., Mugevero, J. & Wimmer, E. (1994). Stimulation of poliovirus proteinase 3Cpro-related proteolysis by the genome-linked protein VPg and its precursor 3AB. Journal of Biological Chemistry 269, 27015-27020.[Abstract/Free Full Text]

Pringle, C. R. (1998). Virus taxonomy – San Diego 1998. Report of the 27th Meeting of the Executive Committee of the International Committee on Taxonomy of Viruses. Archives of Virology 143, 1449-1459.[Medline]

Reutenauer, A., Ziegler-Graff, V., Lot, H., Scheidecker, D., Guilley, H., Richards, K. & Jonard, G. (1993). Identification of beet western yellows luteovirus genes implicated in viral replication and particle morphogenesis. Virology 195, 692-699.[Medline]

Richards, O. C. & Ehrenfeld, E. (1998). Effects of poliovirus 3AB protein on 3D polymerase-catalyzed reaction. Journal of Biological Chemistry 273, 12832-12840.[Abstract/Free Full Text]

Sadowy, E., Pluta, K., Gronenborn, B. & Hulanicka, D. (1998). Infectious transcripts from cloned cDNA of potato leafroll virus. Acta Biochimica Polonica 45, 611-619.[Medline]

Sadowy, E., Winiewska, A., Gronenborn, B. & Hulanicka, D. (2000). Genes involved in Potato leafroll virus replication. Plant Virus Invasion and Host Defence. EMBO Workshop, Kolymbari, Crete, Greece, 28 May–1 June 2000.

Sadowy, E., Juszczuk, M., David, C., Gronenborn, B. & Hulanicka, M. D. (2001). Mutational analysis of the proteinase function of Potato leafroll virus. Journal of General Virology 82, 1517-1527.[Abstract/Free Full Text]

Schaad, M. C., Jensen, P. E. & Carrington, J. C. (1997). Formation of plant RNA virus replication complexes on membranes: role of an endoplasmic reticulum-targeted viral protein. EMBO Journal 16, 4049-4059.[Medline]

Tamm, T. & Truve, E. (2000a). Sobemoviruses. Journal of Virology 74, 6231-6241.[Free Full Text]

Tamm, T. & Truve, E. (2000b). RNA-binding activities of cocksfoot mottle sobemovirus proteins. Virus Research 66, 197-207.[Medline]

Towner, J. S., Ho, T. V. & Semler, B. L. (1996). Determinants of membrane association for poliovirus protein 3AB. Journal of Biological Chemistry 271, 26810-26818.[Abstract/Free Full Text]

van der Wilk, F., Houterman, P., Molthoff, J., Hans, F., Dekker, B., van den Heuvel, J. M. F. M., Huttinga, H. & Goldbach, R. (1997). Expression of the potato leafroll virus ORF0 induces viral-disease-like symptoms in transgenic potato plants. Molecular Plant–Microbe Interactions 10, 153-159.

Voinnet, O., Pinto, Y. M. & Baulcombe, D. C. (1999). Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proceedings of National Academy of Sciences, USA 96, 14147-14152.[Abstract/Free Full Text]

Wassenaar, A. L. M., Spaan, W. J. M., Gorbalenya, A. E. & Snijder, E. J. (1997). Alternative proteolytic processing of the arterivirus replicase ORF1a polyprotein: evidence that NSP2 acts as a cofactor for the NSP4 serine protease. Journal of Virology 71, 9313-9322.[Abstract]

Webster, A., Leith, I. R. & Hay, R. T. (1994). Activation of adenovirus-coded protease and processing of preterminal protein. Journal of Virology 68, 7292-7300.[Abstract/Free Full Text]

Received 17 November 2000; accepted 14 February 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
X. Li, C. Halpin, and M. D. Ryan
A novel cleavage site within the potato leafroll virus P1 polyprotein
J. Gen. Virol., May 1, 2007; 88(5): 1620 - 1623.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Pfeffer, P. Dunoyer, F. Heim, K. E. Richards, G. Jonard, and V. Ziegler-Graff
P0 of Beet Western Yellows Virus Is a Suppressor of Posttranscriptional Gene Silencing
J. Virol., June 5, 2002; 76(13): 6815 - 6824.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Guyader and D. G. Ducray
Sequence analysis of Potato leafroll virus isolates reveals genetic stability, major evolutionary events and differential selection pressure between overlapping reading frame products
J. Gen. Virol., June 1, 2002; 83(7): 1799 - 1807.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
E. Sadowy, M. Juszczuk, C. David, B. Gronenborn, and M. D. Hulanicka
Mutational analysis of the proteinase function of Potato leafroll virus
J. Gen. Virol., June 1, 2001; 82(6): 1517 - 1527.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sadowy, E.
Right arrow Articles by Hulanicka, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sadowy, E.
Right arrow Articles by Hulanicka, M. D.
Agricola
Right arrow Articles by Sadowy, E.
Right arrow Articles by Hulanicka, M. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS