|
|
||||||||
Animal: DNA Viruses |
Department of Clinical Chemistry and Transfusion Medicine, Institute of Laboratory Medicine, Göteborg University, Sahlgrenska University Hospital, S-413 45 Gothenburg, Sweden1
Author for correspondence: Lars Rymo. Fax +46 31 82 84 58. e-mail Lars.Rymo{at}clinchem.gu.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In spite of considerable efforts, our knowledge about the biochemical functions of EBNA5 and its role in the immortalization process is still fragmentary. The amount of EBNA5 observed during infection rises to high levels in the first 3 to 4 days of infection and then decreases to the levels found in established lymphoblastoid cell lines (LCLs) (Szekely et al., 1995b
). EBNA5 antigens appear very early and are at first diffusely distributed throughout the nucleoplasm (Szekely et al., 1995a
, 1996
). After a few days the EBNA5 immunostaining condenses into discrete foci which coincide with nuclear bodies known as ND10 domains or promyelocytic leukaemia-associated protein (PML) oncogenic domains (PODs). So far about 20 POD-associated proteins have been identified, including the PML protein, the retinoblastoma protein (Rb), the heat shock protein 70 (hsp70) and the transcriptional coactivator CREB-binding protein. Evidence is accumulating which suggests that PODs are involved in both transcription regulation, cell-cycle regulation and regulation of cell death (for overviews see Hess & Korsmeyer, 1998
; Matera, 1999
). EBNA5 has been shown to co-localize with hsp70 in vivo (Szekely et al., 1995a
), and studies in vitro have demonstrated a physical interaction between the proteins (Kitay & Rowe, 1996b
; Mannick et al., 1995
). The implication of this interaction for the biology of the virus remains to be elucidated. EBNA5 has also been shown to bind to the Rb and p53 proteins (Szekely et al., 1993
). However, it has so far not been possible to reveal any effect of EBNA5 on Rb or p53 in their function as regulators of transcription (Inman & Farrell, 1995
). EBNA5 has also been shown to associate with the nuclear matrix and it appears that EBNA5 increases the affinity of EBNA6 to this structure (Cludts & Farrell, 1998
; Szekely et al., 1995a
).
EBNA5 might be involved in the regulation of the cell cycle. Cyclin D2 expression was upregulated in resting B-lymphocytes in response to cotransfection with EBNA2 and EBNA5 expression vectors, making the cells leave the G0 phase and enter the cell cycle (Sinclair et al., 1994
). Moreover, the phosphorylation status of EBNA5 changes during the cell cycle, as shown by an increased number of phosphorylated serine residues in EBNA5 during the G2 phase, reaching a maximum of about 50% at the G2/M boundary (Kitay & Rowe, 1996a
). Direct evidence for the role of EBNA5 in transcription regulation was lent by recent studies showing that EBNA5 cooperates with EBNA2 to activate the expression of LMP1 (Harada & Kieff, 1997
; Nitsche et al., 1997
). EBNA5 enhanced the EBNA2-mediated induction of endogenous LMP1 expression in Eli-BL cells and was absolutely required for the induction of LMP1 expression in Akata-BL cells (Nitsche et al., 1997
). Notably, the Cp promoter was not induced by the same procedures that activated LMP1 expression (Nitsche et al., 1997
). In a transient transfection study with reporter plasmids, it was shown that EBNA5 potentiated EBNA2 activation of the LMP1 promoter in BJAB cells (Harada & Kieff, 1997
). EBNA5 also stimulated EBNA2 activation of reporter plasmids that contained either a multimer of a regulatory region from the Cp promoter or a synthetic DNA fragment containing five RBP-J
-binding sites.
The general objective of the present study was to broaden our understanding of the role of EBNA5 in transcription regulation. To identify EBNA5-interacting proteins, we performed a yeast two-hybrid screen of a B-cell cDNA library with EBNA5 as bait. In this paper we characterize the interaction between EBNA5 and the HS1-associated protein X-1 (HAX-1), a cytoplasmic protein that might be involved in signal transduction in B-cells. We also show that the smallest EBNA5 species, composed of the unique Y domain and only one copy of the W1W2 repeat domain, in contrast to larger EBNA5 species, is present in the cytoplasm but not in the nucleus of transfected B-lymphoid cells and associates with HAX-1 in the cells.
| Methods |
|---|
|
|
|---|
Cell culture and transfections.
Plasmids.
The pAS2/EBNA5 plasmid expressing the bait protein was constructed by cloning the EBNA5-encoding sequence as a NotIEcoRI fragment of pCI-EBNA5 DNA (M. Dufva, A. Nerstedt & L. Rymo, unpublished results) in the pAS2.1 vector (Clontech). The EBNA5-encoding sequence corresponds to a protein with seven copies of the W1W2 repeat domain (Fig. 1
). The pYEX/EBNA5 plasmid is a yeast GSTEBNA5 fusion protein expression vector and was constructed by cloning the NheINotI fragment of pCI-EBNA5/II, containing the EBNA5 reading frame (M. Dufva, A. Nerstedt & L. Rymo, unpublished results), in SmaI/NotI-cleaved pYEX 4T-3. The pGEX-EBNA5 plasmid is a bacterial GSTEBNA5 expression vector made by moving a Csp45IEcoRI DNA fragment encoding the GST and EBNA5 proteins from pYEX-EBNA5 into pGEX 2TK (Pharmacia). The HAX-1 expression vector pME18sf-HAX-1 was kindly supplied by Dr T. Watanabe, Kyushu University, Fukuoka, Japan (Suzuki et al., 1997
). The pGEM-HAX-1 plasmid was constructed for coupled in vitro transcription and translation of the HAX-1 protein by cloning an EcoRIXbaI fragment of pME18sf-HAX-1, containing the HAX-1 reading frame (Suzuki et al., 1997
), in the pGEM-3Zf+ plasmid (Promega). pECFP-Mito (Clontech) is a mammalian expression vector encoding a mutated green fluorescent protein fused to the mitochondrial localization signal of subunit VIII of the cytochrome c oxidase. The pCI-E5(W01W2Y) plasmid is a mammalian expression vector for the smallest species of EBNA5, encompassing one copy of the W01W2 repeat domain and the unique Y domain. The EBNA5-encoding sequence was obtained by PCR using the pCI-EBNA5 plasmid as the template and the 5' TTTTTGAATTCAAATGGGAGACCGAAGTGAAGG 3' and 5' TTTTTCTAGACTGGCTAAGCCTGTGACTTAGT 3' oligonucleotides as primers. The PCR fragment was digested with EcoRI and XbaI and inserted into the pCI vector. The pCI-E5(W1W2Y) plasmid was generated in an analogous manner (M. Dufva, A. Nerstedt & L. Rymo, unpublished results).
|
Yeast two-hybrid screen.
-galactosidase colony lift assay. The identities of the clones were determined by sequencing the plasmid insert from both ends using AD LD-insert Screening Amplimer primers (Clontech). The relative level of the interaction between the bait protein and HAX-1 was determined by estimating the levels of expression of the E. coli lacZ reporter gene. Transformed cells were grown to OD600 values of approximately 1·0 in synthetic medium lacking tryptophane, leucine and histidine or either tryptophane or leucine, equal numbers of cells were lysed, and the levels of
-galactosidase were determined using the substrate o-nitrophenyl-
-D-galactoside as described (Ausubel et al., 1996
Preparation of protein-containing cell extracts.
Yeast GSTEBNA5 was expressed by pYEX-EBNA5 in the yeast Y150 strain using established procedures (Clontech). To obtain bacterial GSTEBNA5, bacterial cells (BL 21 Codon Plus strain; Stratagene) were transformed with pGEX and pGEX-EBNA5, respectively, and the expression of recombinant protein was induced with IPTG (final concentration of 0·5 mM). The cells were lysed in 20 mM TrisHCl, pH 8·0, 100 mM NaCl, 1 mM EDTA, 0·1% Tween, sonicated and centrifuged. DG75 cell extracts were prepared by lysing 2x107 cells in 500 µl 50 mM TrisHCl, pH 7·4, 150 mM NaCl, 0·1% Nonidet P-40 and centrifugation at 14000 g for 10 min. All extracts were precleared by incubation with glutathione-conjugated Sepharose beads (Pharmacia) prior to the GST pull down experiments.
For coimmunoprecipitation experiments, cell extracts were prepared by resuspending 2x107 cells cotransfected with the HAX-1 expression vector pME18sf-HAX-1 and either the pCI (Promega), pCI-E5(W1W2Y) or pCI-EBNA5 plasmids in lysis buffer [150 mM NaCl, 50 mM TrisHCl, pH 8·0, 0·5 mM dithiothreitol, 0·5% Nonidet P-40, 0·5 mM pefabloc (Roche), 5 µg/ml antipain (Roche), 5 µg/ml leupeptin (Roche) and 5 µg/ml aprotinin (Roche)]. The cell suspension was kept on ice for 15 min, sonicated three times for 10 s at 10 µm, and cleared by centrifugation for 30 min at 4 °C and 18000 g. The supernatant was incubated with or without the JF186 anti-EBNA5 antibody for 16 h at 4 °C. The immune complex was collected using protein G-conjugated Sepharose beads (Pharmacia Biotech) and washed extensively. The adsorbed proteins were eluted by boiling in SDS sample buffer and analysed under denaturing conditions by electrophoresis in 10% polyacrylamide gels (SDSPAGE) and immunoblotting. HAX-1 and EBNA5 were visualized on the blots by alkaline phosphatase (AP)-conjugated rabbit anti-mouse antibody (Dako) and a nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (BCIP/NBT) colorimetric AP reaction (Promega).
Antibodies and immunostaining.
GAL4 activation domain (AD) fusion protein was detected with anti-GAL4-AD antibody (Clontech). EBNA5 was detected with the mouse monoclonal anti-EBNA5 antibody JF186 (Dillner et al., 1986
) obtained from Dr M. Masucci, MTC, Karolinska Institute, Stockholm. Anti-HAX-1 antibody was purchased from Transduction Laboratories. Hsp60 was detected by immunostaining using the goat anti-hsp60 antibody (Santa Cruz Biotechnology) as the primary antibody and rhodamine-conjugated donkey anti-goat IgG antibody (Santa Cruz Biotechnology) as the secondary antibody. E5(W01W2Y) and HAX-1 were detected by immunostaining using JF186 anti-EBNA5 and anti-HAX-1 antibodies, respectively, as primary antibodies, and FITC-conjugated rabbit anti-mouse IgG antibodies (Dako) in a first step and FITC-conjugated swine anti-rabbit IgG antibodies (Dako) in a second step as secondary antibodies.
| Results and Discussion |
|---|
|
|
|---|
-galactosidase compared with the control cells expressing the BD fusion protein and AD vector (Table 1
|
|
|
|
The functional significance of the interaction between EBNA5 and HAX-1 is difficult to evaluate since little is known about the function of HAX-1. The HAX-1 protein was first identified by a two-hybrid screen using the HS1 protein as bait (Suzuki et al., 1997
). HS1 is a tyrosine kinase in the BCR signalling pathway and is important for the clonal expansion and deletion of B-cells (Fukuda et al., 1995
; Taniuchi et al., 1995
). Cross-linking of the BCR results in phosphorylation of HS1 by the BCR-associated tyrosine kinases Lyn and Syk (Yamanashi et al., 1997
). The phosphorylation is necessary for targeting HS1 to the nucleus and to activate apoptosis (Yamanashi et al., 1997
). One might speculate that E5(W1W2Y), by interacting with HAX-1, might interfere with HS1 and BCR signalling to the nucleus that would otherwise induce apoptosis.
Homology searches revealed similarities between HAX-1 and the pro-apoptotic BNIP3 protein (Suzuki et al., 1997
). In this context it might be worth noting that evidence has appeared supporting a role of EBNA5 also as a specific repressor of gene expression functioning by inhibiting the processing of pre-mRNA (M. Dufva, A. Nerstedt & L. Rymo, unpublished results). The effect of EBNA5 on the expression of cellular genes in a chromosomal context was analysed in transient transfections with an EBNA5 expression vector and using the DNA microarray technology. The experiments demonstrated that EBNA5 inhibited the expression of certain chromosomal genes, one of which coded for the BNIP3 protein. Interestingly, this protein interacts with anti-apoptotic proteins including BCL-2 and the EBV-encoded BCL-2 homologue BHRF1 (Boyd et al., 1994
; Chen et al., 1997
; Yasuda et al., 1998
). BNIP3-binding of BCL-2 inhibits its anti-apoptotic function. Conceivably, down-regulation of BNIP3 by EBNA5 promotes the survival of EBV-infected cells.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. A. & Struhl, K. (1996). Current Protocols in Molecular Biology, unit 20.2. New York: John Wiley & Sons.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. A. & Struhl, K. (1997). Current Protocols in Molecular Biology, unit 13.6.2. New York: John Wiley & Sons.
Ben Bassat, H., Goldblum, N., Mitrani, S., Goldblum, T., Yoffey, J. M., Cohen, M. M., Bentwich, Z., Ramot, B., Klein, E. & Klein, G. (1977). Establishment in continuous culture of a new type of lymphocyte from a Burkitt like malignant lymphoma (line D.G.-75). International Journal of Cancer 19, 27-33.
Boyd, J. M., Malstrom, S., Subramanian, T., Venkatesh, L. K., Schaeper, U., Elangovan, B., DSa-Eipper, C. & Chinnadurai, G. (1994). Adenovirus E1B 19 kDa and Bcl-2 proteins interact with a common set of cellular proteins. Cell 79, 341351: erratum 1120.[Medline]
Chen, G., Ray, R., Dubik, D., Shi, L., Cizeau, J., Bleackley, R. C., Saxena, S., Gietz, R. D. & Greenberg, A. H. (1997). The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric mitochondrial protein that activates apoptosis. Journal of Experimental Medicine 186, 1975-1983.
Cludts, I. & Farrell, P. J. (1998). Multiple functions within the EpsteinBarr virus EBNA-3A protein. Journal of Virology 72, 1862-1869.
Dillner, J. & Kallin, B. (1988). The EpsteinBarr virus proteins. Advances in Cancer Research 50, 95-158.[Medline]
Dillner, J., Kallin, B., Alexander, H., Ernberg, I., Uno, M., Ono, Y., Klein, G. & Lerner, R. A. (1986). An EpsteinBarr virus (EBV)-determined nuclear antigen (EBNA5) partly encoded by the transformation-associated Bam WYH region of EBV DNA: preferential expression in lymphoblastoid cell lines. Proceedings of the National Academy of Sciences, USA 83, 6641-6645.
Finke, J., Rowe, M., Kallin, B., Ernberg, I., Rosén, A., Dillner, J. & Klein, G. (1987). Monoclonal and polyclonal antibodies against EpsteinBarr virus nuclear antigen 5 (EBNA-5) detect multiple protein species in Burkitts lymphoblastoid cell lines. Journal of Virology 61, 3870-3878.
Fukuda, T., Kitamura, D., Taniuchi, I., Maekawa, Y., Benhamou, L. E., Sarthou, P. & Watanabe, T. (1995). Restoration of surface IgM-mediated apoptosis in an anti-IgM-resistant variant of WEHI-231 lymphoma cells by HS1, a protein-tyrosine kinase substrate. Proceedings of the National Academy of Sciences, USA 92, 7302-7306.
Gallagher, A. R., Cedzich, A., Gretz, N., Somlo, S. & Witzgall, R. (2000). The polycystic kidney disease protein PKD2 interacts with Hax-1, a protein associated with the actin cytoskeleton. Proceedings of the National Academy of Sciences, USA 97, 4017-4022.
Harada, S. & Kieff, E. (1997). EpsteinBarr nuclear protein LP stimulates EBNA-2 acidic domain mediated transcriptional activation. Journal of Virology 71, 6611-6618.[Abstract]
Hess, J. L. & Korsmeyer, S. J. (1998). Life, death and nuclear spots. Nature Genetics 20, 220-222.[Medline]
Inman, G. J. & Farrell, P. J. (1995). EpsteinBarr virus EBNA-LP and transcription regulation of pRB, p107 and p53 in transfection assays. Journal of General Virology 76, 2141-2149.
Kawaguchi, Y., Nakajima, K., Igarashi, M., Morita, T., Tanaka, M., Suzuki, M., Yokoyama, A., Matsuda, G., Kato, K., Kanamori, M. & Hirai, K. (2000). Interaction of EpsteinBarr virus nuclear antigen leader protein (EBNA-LP) with HS1-associated protein X-1: implication of cytoplasmic function of EBNA-LP. Journal of Virology 74, 10104-10111.
Kieff, E. (1996). EpsteinBarr virus and its replication. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Kitay, M. K. & Rowe, D. T. (1996a). Cell cycle stage-specific phosphorylation of the EpsteinBarr virus immortalization protein EBNA-LP. Journal of Virology 70, 7885-7893.[Abstract]
Kitay, M. K. & Rowe, D. T. (1996b). Proteinprotein interactions between EpsteinBarr nuclear antigen-LP and cellular gene products: binding of 70-kilodalton heat shock proteins. Virology 220, 91-99.[Medline]
Mannick, J. B., Tong, X., Hemnes, A. & Kieff, E. (1995). The EpsteinBarr nuclear antigen leader protein associates with hsp72/hsc73. Journal of Virology 69, 8169-8172.[Abstract]
Matera, A. G. (1999). Nuclear bodies: multifaceted subdomains of the interchromatin space. Trends in Cell Biology 9, 302-309.[Medline]
Nitsche, F., Bell, A. & Rickinson, A. (1997). EpsteinBarr leader protein enhances EBNA-2 mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. Journal of Virology 71, 6619-6627.[Abstract]
Peng, R., Tan, J. & Ling, P. D. (2000). Conserved regions in the EpsteinBarr virus leader protein define distinct domains required for nuclear localization and transcriptional cooperation with EBNA2. Journal of Virology 74, 9953-9963.
Sinclair, A. J., Ignacio, P., Peters, G. & Farrell, P. (1994). EBNA-2 and EBNA-LP cooperate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by EpsteinBarr virus. EMBO Journal 13, 3321-3328.[Medline]
Soltys, B. J. & Gupta, R. S. (1996). Immunoelectron microscopic localization of the 60-kDa heat shock chaperonin protein (Hsp60) in mammalian cells. Experimental Cell Research 222, 16-27.[Medline]
Suzuki, Y., Demoliere, C., Kitamura, D., Takeshita, H., Deuschle, U. & Watanabe, T. (1997). HAX-1, a novel intracellular protein, localized on mitochondria, directly associates with HS1, a substrate of Src family tyrosine kinases. Journal of Immunology 158, 2736-2744.[Abstract]
Szekely, L., Selivanova, G., Magnusson, K. P., Klein, G. & Wiman, K. G. (1993). EBNA-5, an EpsteinBarr virus encoded nuclear antigen, binds to the retinoblastoma and p53 proteins. Proceedings of the National Academy of Sciences, USA 90, 5455-5459.
Szekely, L., Jiang, W.-Q., Pokrovskaja, K., Wiman, K. G., Klein, G. & Ringertz, N. (1995a). Reversible nucleolar translocation of EpsteinBarr virus-encoded EBNA-5 and hsp70 proteins after exposure to heat shock or cell density congestion. Journal of General Virology 76, 2423-2432.
Szekely, L., Pokrovskaja, K., Jiang, W.-Q., Selivanova, G., Löwbeer, M., Ringertz, N., Wiman, K. G. & Klein, G. (1995b). Resting B-cells, EBV-infected B-blasts and established lymphoblastoid cell lines differ in their Rb, p53 and EBNA-5 expression patterns. Oncogene 10, 1869-1874.[Medline]
Szekely, L., Pokrovskaja, K., Jiang, W.-Q., de The, H., Ringertz, N. & Klein, G. (1996). The EpsteinBarr virus-encoded nuclear antigen EBNA-5 accumulates in PML-containing bodies. Journal of Virology 70, 2562-2568.[Abstract]
Taniuchi, I., Kitamura, D., Maekawa, Y., Fukuda, T., Kishi, H. & Watanabe, T. (1995). Antigen-receptor induced clonal expansion and deletion of lymphocytes are impaired in mice lacking HS1 protein, a substrate of the antigen-receptor-coupled tyrosine kinases. EMBO Journal 14, 3664-3678.[Medline]
Yamanashi, Y., Fukuda, T., Nishizumi, H., Inazu, T., Higashi, K., Kitamura, D., Ishida, T., Yamamura, H., Watanabe, T. & Yamamoto, T. (1997). Role of tyrosine phosphorylation of HS1 in B cell antigen receptor-mediated apoptosis. Journal of Experimental Medicine 185, 1387-1392.
Yasuda, M., Theodorakis, P., Subramanian, T. & Chinnadurai, G. (1998). Adenovirus E1B-19K/BCL-2 interacting protein BNIP3 contains a BH3 domain and a mitochondrial targeting sequence. Journal of Biological Chemistry 273, 12415-12421.
Received 19 October 2000;
accepted 16 March 2001.
This article has been cited by other articles:
![]() |
P. D. Ling, J. Tan, and R. Peng Nuclear-Cytoplasmic Shuttling Is Not Required for the Epstein-Barr Virus EBNA-LP Transcriptional Coactivation Function J. Virol., July 15, 2009; 83(14): 7109 - 7116. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vafiadaki, D. A. Arvanitis, S. N. Pagakis, V. Papalouka, D. Sanoudou, A. Kontrogianni-Konstantopoulos, and E. G. Kranias The Anti-apoptotic Protein HAX-1 Interacts with SERCA2 and Regulates Its Protein Levels to Promote Cell Survival Mol. Biol. Cell, January 1, 2009; 20(1): 306 - 318. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Garibal, E. Hollville, A. I. Bell, G. L. Kelly, B. Renouf, Y. Kawaguchi, A. B. Rickinson, and J. Wiels Truncated Form of the Epstein-Barr Virus Protein EBNA-LP Protects against Caspase-Dependent Apoptosis by Inhibiting Protein Phosphatase 2A J. Virol., July 15, 2007; 81(14): 7598 - 7607. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Ramsay, M. D. Keppler, M. Jazayeri, G. J. Thomas, M. Parsons, S. Violette, P. Weinreb, I. R. Hart, and J. F. Marshall HS1-Associated Protein X-1 Regulates Carcinoma Cell Migration and Invasion via Clathrin-Mediated Endocytosis of Integrin {alpha}v{beta}6 Cancer Res., June 1, 2007; 67(11): 5275 - 5284. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Han, Y.-S. Chen, Z. Liu, N. Bodyak, D. Rigor, E. Bisping, W. T. Pu, and P. M. Kang Overexpression of HAX-1 Protects Cardiac Myocytes From Apoptosis Through Caspase-9 Inhibition Circ. Res., August 18, 2006; 99(4): 415 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Oberndorfer, D. Schmid, R. Geisberger, G. Achatz-Straussberger, R. Crameri, M. Lamers, and G. Achatz HS1-Associated Protein X-1 Interacts with Membrane-Bound IgE: Impact on Receptor-Mediated Internalization J. Immunol., July 15, 2006; 177(2): 1139 - 1145. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. R. K. Yedavalli, H.-M. Shih, Y.-P. Chiang, C.-Y. Lu, L.-Y. Chang, M.-Y. Chen, C.-Y. Chuang, A. I. Dayton, K.-T. Jeang, and L.-M. Huang Human Immunodeficiency Virus Type 1 Vpr Interacts with Antiapoptotic Mitochondrial Protein HAX-1 J. Virol., November 1, 2005; 79(21): 13735 - 13746. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Peng, S. C. Moses, J. Tan, E. Kremmer, and P. D. Ling The Epstein-Barr Virus EBNA-LP Protein Preferentially Coactivates EBNA2-Mediated Stimulation of Latent Membrane Proteins Expressed from the Viral Divergent Promoter J. Virol., April 1, 2005; 79(7): 4492 - 4505. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cilenti, M. M. Soundarapandian, G. A. Kyriazis, V. Stratico, S. Singh, S. Gupta, J. V. Bonventre, E. S. Alnemri, and A. S. Zervos Regulation of HAX-1 Anti-apoptotic Protein by Omi/HtrA2 Protease during Cell Death J. Biol. Chem., November 26, 2004; 279(48): 50295 - 50301. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Ortiz, J. Moseley, G. Calderon, A. L. Swift, S. Li, and I. M. Arias Identification of HAX-1 as a Protein That Binds Bile Salt Export Protein and Regulates Its Abundance in the Apical Membrane of Madin-Darby Canine Kidney Cells J. Biol. Chem., July 30, 2004; 279(31): 32761 - 32770. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. McCann, G. L. Kelly, A. B. Rickinson, and A. I. Bell Genetic analysis of the Epstein-Barr virus-coded leader protein EBNA-LP as a co-activator of EBNA2 function J. Gen. Virol., December 1, 2001; 82(12): 3067 - 3079. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |