|
|
||||||||
Animal: RNA Viruses |
Clinical Laboratory, Department of Internal Veterinary Medicine, Faculty of Veterinary Medicine, University of Zurich, Winterthurerstrasse 260, CH-8057 Zurich, Switzerland1
Author for correspondence: Hans Lutz. Fax +41 1 63 58 906. e-mail hanslutz{at}vetklinik.unizh.ch
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Three main outcomes of infection are known (Hoover et al., 1975
; Lutz et al., 1980
; Hoover & Mullins, 1991
; Rojko & Kociba, 1991
): (i) persistently infected animals generally die within 3 to 4 years as a result of FeLV infection (McClelland et al., 1980
), (ii) transiently FeLV-infected cats are able to overcome viraemia after a few weeks to months: the infection seems to be cleared and the animals are considered to be immune to re-infection, (iii) a third group of cats becomes immune to FeLV after the first contact with the virus. Although the susceptibility of cats to FeLV infection decreases with age (Hoover et al., 1975
), the factors that determine which of the above-mentioned courses of infection will prevail is still unknown. We speculate that the initial load of virus and provirus may influence the outcome of retrovirus infections.
To study provirus load in both naturally and experimentally infected FeLV cats, we established a quantitative real-time fluorogenic probe-based FeLV PCR (TaqMan probe, Perkin Elmer) (Gibson et al., 1996
; Heid et al., 1996
; Livak et al., 1995
). This method makes use of the 5'
3' exonuclease activity of Taq DNA polymerase (Holland et al., 1991
; Lee et al., 1993
; Lyamichev et al., 1993
) and offers advantages such as absolute quantification, low DNA consumption, fast throughput of many samples and low risk of contamination (Heid et al., 1996
). In addition, we report our nested FeLV PCR. We used these two PCR methods to detect and quantify FeLV provirus in naturally and experimentally infected cats. The results provide important new insights into the pathogenesis of FeLV infection.
| Methods |
|---|
|
|
|---|
Samples and experimental design.
To observe the provirus load during infection, 15 15-week-old SPF cats (Harlan CPB) were infected intraperitoneally with 500000 f.f.u. of FeLV-A Glasgow. Blood samples were collected weekly for 15 weeks and the provirus load was determined by PCR. Cats were grouped into persistently antigenaemic cats and transiently or not antigenaemic cats, as judged by p27 antigen ELISA (Lutz et al., 1983
). In addition, we determined anti-FeLV antibodies by both ELISA and Western blot using antigen (200 ng per test) that was purified on sucrose gradients, according to procedures described previously (Lutz et al., 1980
, 1988
).
Furthermore, we isolated DNA from 597 Swiss cats (as described above) to detect FeLV provirus in naturally infected cats and to determine the provirus loads in these cats. PCR results were compared with p27 antigen ELISA results.
Detection of FeLV provirus by conventional nested PCR.
We combined two previously described PCR methods that amplify a conserved fragment in the FeLV U3 long terminal repeat (LTR) of exogenous FeLV (Rohn & Overbaugh, 1995
; Jackson et al., 1993
) to produce a nested FeLV PCR. The primers for the first round of PCR, 5' AAAATTTAGCCAGCTACTGCAG 3' (sense) and 5' GAAGGTCGAACTCTGGTCAACT 3' (antisense), amplify a 235 bp product. Primers were designed based on the FeLV-U3-1 and FeLV-U3-2B primer sequences (omitting the endonuclease restriction sites) described previously by Rohn & Overbaugh (1995)
. Reaction mixtures contained 1xThermophilic DNA polymerase buffer (Catalys), 2·5 mM MgCl2, 0·2 mM of each of the four dNTPs (Catalys), 1 U Taq DNA polymerase (Sigma), 3·5 pmol of each oligonucleotide primer (Microsynth), 2 µg of total genomic DNA and dH2O in a total volume of 25 µl. Thermal cycling conditions were 4 min at 94 °C followed by 35 cycles of 1 min at 94 °C, 1 min at 50 °C and 2 min at 72 °C. The second round of PCR (nested) yielded a 166 bp product (Jackson et al., 1993
). Reaction mixtures for the second round contained 1xThermophilic DNA polymerase buffer, 1·6 mM MgCl2, 0·2 mM of each of the four dNTPs, 1·25 U Taq DNA polymerase, 15 pmol of each oligonucleotide primer, 1 µl of the first-round PCR product and ddH2O in a total volume of 25 µl. Thermal-cycling conditions were 3 min at 94 °C followed by 35 cycles of 1 min at 94 °C, 1 min at 52 °C and 2 min at 72 °C. PCR assays were carried out in a DNA Thermal Cycler PTC-100 (MJ Research, distributed in Switzerland by Bioconcept). PCR products were analysed on ethidium bromide-stained agarose gels (1·8%).
Detection and quantification of FeLV provirus by quantitative real-time PCR.
We designed primers and a probe that recognize the U3 LTR of exogenous FeLV-A (accession no. M12500; Stewart et al., 1986
), but not endogenous FeLV sequences (Berry et al., 1988
; Kumar et al., 1989
), using the Primer Express software (Perkin Elmer). The target sequence was a conserved fragment of 74 bp within the region that is amplified by the nested PCR method. The primer sequences were 5' ACCTGGGCCCCGGCT 3' (15 bases; nt 21742188) for the sense primer and 5' GCGGCCTTGAAACTTCTGCT 3' (20 bases; nt 22282247) for the antisense primer. The TaqMan FeLV probe, 5' AGGCCAAGAACAGTTAAACCCCGGAT 3' (Perkin Elmer) (26 bases; nt 21912216), was labelled at the 5' end with the reporter dye FAM (6-carboxyfluorescein) and at the 3' end with the quencher dye TAMRA (6-carboxytetramethyl-rhodamine). It was also phosphate-blocked at the 3' end to prevent extension. Reaction mixtures consisted of 1·25 vol. 1xTaqMan buffer A (Perkin Elmer) and 3·75 vol. 1xPCR buffer II (Perkin Elmer), 5 mM MgCl2, 0·2 mM of each of the four dNTPs (Catalys), 1·25 U Taq DNA polymerase (Sigma), 10 pmol of each oligonucleotide primer (Microsynth), 10 pmol TaqMan probe, 0·5 µg of total genomic DNA and ddH2O in a total volume of 50 µl. Thermal cycling conditions were 3 min at 95 °C, five cycles of 0·5 min at 95 °C and 0·5 min at 64 °C followed by 40 cycles of 0·5 min at 85 °C and 0·5 min at 64 °C. We used an ABI Prism 7700 detection system (Perkin Elmer), which gives a threshold cycle (CT) value for every sample. The CT value is reached very rapidly if the amount of input target DNA is high. Quantification of the PCR is achieved by comparing the CT value of the input DNA with the CT value of a standard template DNA that is co-amplified in the same run.
Analytical specificity of both PCR methods.
The analytic specificities of the nested and quantitative real-time PCR methods were confirmed by sequencing the PCR products following separation by gel electrophoresis and gel extraction with the Prep-A-Gene DNA Purification system (Bio-Rad). After ligation into the pT7Blue T vector (Novagen) using T4 ligase (Catalys), the resulting plasmids were used to transfect E. coli strain NovaBlue (Novagen). White colonies were screened for correct inserts by restriction enzyme analysis with HindIII and EcoRI (Catalys). The inserts of three clones were sequenced (Microsynth).
In addition, molecularly cloned viruses of the FeLV-A Glasgow (Stewart et al., 1986
), FeLV-B GardnerArnstein (Elder & Mullins, 1983
) and FeLV-C Sarma (Riedel et al., 1986
) subgroups were used to determine the specificity of both PCR methods. Feline embryonic fibroblast (FEA) cells that harboured these FeLV subgroups were propagated in Dulbeccos modified Eagles medium with 10% foetal calf serum. On day 15, 5x105 cells were harvested and DNA was extracted using the QIAamp Blood kit (Qiagen).
Analytical sensitivity of both PCR methods, production of the standard DNA template and linear range of the quantitative real-time PCR.
To assess the analytical sensitivity of the two PCR methods, FeLV-positive E. coli colonies (see above) were grown in LB medium containing 100 mg/l ampicillin (Fluka Chemie). Plasmid DNA was purified using the Qiagen Plasmid Midi kit (Qiagen) and linearized with HindIII. The concentration of the linearized DNA template was determined by measuring the optical density at 260 nm. The DNA template was then serially diluted tenfold in a solution of 100 ng/ml of calf thymus DNA (Sigma). The calculated copy numbers of DNA were confirmed by end-point dilution experiments. Identical dilutions were used to compare the analytical sensitivity of the nested and quantitative PCR methods. Linear regressions (y=a+bx) and Pearsons rank correlation coefficients (r) were calculated for the quantitative real-time PCR method.
Efficiency of amplification and precision of quantitative real-time PCR.
To allow reliable quantification, the amplification efficiency of the FeLV standard DNA template and that of the same sequence within the viral genome should be approximately equal. We compared the efficiency of amplification by assessing the slopes (s) of the regression lines (CT versus dilution) obtained after PCR amplification of serial dilutions of either the standard or the genomic DNA templates of an experimentally FeLV-A-infected cat. The efficiency of amplification of each sample can be considered to be equal if the difference in the slopes (
s) of the regression lines is less than 0·1 (Gut et al., 1999
).
The precision of the within run of the quantitative PCR was assessed by multiple measurements (n=16) of DNA from an experimentally FeLV-A-infected cat (#265) using a low (0·125 µg), an intermediate (0·5 µg) and a high (2 µg) quantity of DNA. The precision of the in-between run was assessed by multiple assays (n=11) with DNA from an experimentally FeLV-A-infected cat (#274) using 0·3 µg DNA per assay. Mean, standard deviations (SD) and coefficients of variation (CV) were calculated.
| Results |
|---|
|
|
|---|
|
The analytical sensitivity of the two PCR methods was compared by amplifying a tenfold serial dilution of the cloned standard DNA template. Both methods detected between 0·36 and 3·6 copies of the template DNA (Fig. 1
). Sensitivity was highly reproducible: figures are representative of the results of several experiments yielding corresponding results (n=4 for nested PCR; n=20 for quantitative real-time PCR).
The quantitative real-time PCR method was also tested for amplification efficiency. The efficiency of amplification of standard and genomic DNA should be approximately equal to allow valid quantification. Efficiencies can be considered to be equal if the difference in the slopes (
s) of the regression lines (CT versus dilution of input DNA) obtained with serial dilutions of different DNA is less than 0·1 (Gut et al., 1999
). We compared the regression lines of the cloned standard DNA template (s=-3·31, r=0·990) with that of genomic DNA from an experimentally FeLV-A-infected cat (s=-3·39, r=0·986). The
s value was 0·08. Therefore, the method is considered to be equally efficient for both standard and sample DNA and quantification using the DNA standard is expected to be valid.
Quantitative PCR was further evaluated for linear range and precision. By amplifying a serial dilution of the standard template DNA, a wide linearity of the method was demonstrated (10 orders of magnitude, Fig. 1b
). Precision was assessed by multiple measurements of DNA samples of experimentally FeLV-A-infected cats and was found to be high: CV of the CT values ranged from 0·9 to 1·0% for the within run and from 0·9 to 4·4% for the in-between runs.
Provirus loads after experimental FeLV infection and correlation with the outcome of infection
Cats experimentally infected with FeLV-A were observed for 15 weeks after infection. Animals were grouped according to their p27 antigen ELISA results (Fig. 2
). If the value of absorbance at 260 nm reached 5% or more of the positive control, ELISA results were defined as positive. Five animals showed a regressive value and viraemia, two animals never had a positive ELISA result and three animals were transiently positive for p27. Ten animals became persistently infected and showed progressive viraemia. Animals started to become positive by PCR from 1 to 2 weeks after experimental infection (Fig. 2
). Interestingly, cats that remained negative for the p27 antigen became positive by PCR.
|
|
ELISA was used to determine antibody levels during the weeks indicated in Fig. 3(e
, f
). In addition, the specificity of antibodies in weeks 0, 4, 8, 12 and 15 after experimental infection was determined by Western blot (data not shown). To some extent, all animals developed antibodies specific for FeLV proteins, indicating that infection was successful in all animals. Cats with regressive viraemia developed significantly higher antibody levels than persistently infected cats (MannWhitney U-test P<0·05; Fig. 3e
, f
). Antibody levels early in infection were indirectly correlated with provirus loads. Cats with high levels of antibody in week 3 had low provirus loads early in infection (week 3, Pearsons rank test r=-0·6266, P=0·0165) and during the first (r=-0·5641, P=0·0082) and second (r=-0·7137, P=0·0028) peak of provirus load.
PCR results in naturally infected cats and comparison with p27 antigen ELISA results
We collected blood samples from 597 Swiss cats and analysed them for the presence of provirus and p27 antigen. PCR results corresponded well with ELISA results: all of the positive ELISA samples were positive by PCR (n=41) and all of the negative PCR samples were negative by ELISA (n=495). Interestingly, 10% of the cats that were positive by PCR were negative for the p27 antigen (n=61). These samples were re-evaluated several times and negative controls were carried in all the experiments to assure that these results were not due to contamination. The majority of these cats (71%) did not show any clinical signs of infection. Provirus load was determined in cats that were positive for the p27 antigen and in animals that were negative for the p27 antigen but positive by PCR. The latter group had significantly lower (by a factor of 300) provirus loads (0·03±0·14 provirus copies per cell) than cats that were positive by ELISA (10±47 provirus copies per cell, MannWhitney U-test P<0·0001). The two PCR methods revealed satisfactory agreement: 86 samples were shown to be positive for FeLV and 492 were shown to be negative by both methods. Some discrepant results were found: one cat was found to be positive by quantitative PCR and negative by nested PCR and 15 animals (2·5%) were positive by nested PCR but negative by quantitative PCR. Detailed analysis of the naturally infected cats will be presented elsewhere.
| Discussion |
|---|
|
|
|---|
We discovered healthy cats that were positive for FeLV provirus and negative for the p27 antigen, which have not been described previously: (i) 10% of 597 Swiss cats examined were negative for the p27 antigen, but were FeLV-positive by PCR, (ii) two experimentally FeLV-A-infected cats testing negative for the p27 antigen became positive for provirus at 1 week after virus exposure, (iii) experimentally FeLV-A-infected cats that were transiently infected remained positive for provirus, even after clearing the p27 antigen from their blood. This contradicts the observations by Miyazawa & Jarrett (1997)
and Jackson et al. (1996)
who reported a good agreement between p27 antigen ELISA and PCR results and no cats that were negative for the p27 antigen and positive by PCR. As repeated experiments yielded identical results and proper controls were always included, we are confident that the discrepancies between ELISA and PCR are not due to contamination. Moreover, we hypothesize that the cats detected in the field that were positive by PCR and negative for the p27 antigen had, in fact, been infected with FeLV but were able to overcome antigenaemia. Alternatively, some of these cats might have been in the early phase of infection. Interestingly, these cats had significantly lower provirus loads than their p27 antigen-positive counterparts, which parallels our experimental studies in which cats that overcame antigenaemia had lower provirus loads than persistently infected cats. We did not analyse the 597 serum samples for the presence of antibodies to FeLV, nor did we determine whether virus production could be reactivated. The biological importance of this rather large population (10% of Swiss cats sampled) cannot yet be addressed, but the quantitative PCR method will allow both the observation of these cats and the determination of virus clearance. Provirus persistence could also be beneficial: for the non-retrovirus lymphocytic choriomeningitis virus of the mouse, it was postulated that persistence of the stably integrated DNA might contribute to the maintenance of the immune system memory (Klenerman et al., 1997
).
The provirus loads in our experimentally infected cats (average of all cats from weeks 115, 1·1±3·3 copies per cell) were similar to those found by semi-quantitative PCR in cats infected with the two major FeLV-FAIDS genotypes, 61C and 61E (Quackenbush et al., 1996
a
, b). Only two persistently infected cats twice showed provirus loads exceeding 10 copies per cell (weeks 4 and 12 post-infection). An explanation for this might be found in the high numbers of unintegrated viral DNA (UVD), which is not distinguishable from integrated provirus by our methods. UVD appears to be obligatory to the life-cycle of retroviruses and is detected in vitro a few days after infection of cultured cells with high virus multiplicity (Mullins et al., 1986
). This phenomenon is not usually observed in vivo, since few cells in a sample are infected synchronously immediately before collection.
Provirus loads in the antigen-positive, naturally FeLV-infected cats were higher than those in the experimentally infected cats. This may be explained by the fact that experimental infection was performed by intraperitoneal injection of infectious FeLV, which does not represent the typical mode of transmission (via the oropharynx) under natural conditions. Another explanation may again be UVD. Persistent UVD was demonstrated in high concentrations (1550 copies per cell) mainly in the bone marrow, but also in intestine and lymphoid tissues of FeLV-FAIDS-infected cats in the terminal stages of disease (Hoover et al., 1987
; Mullins et al., 1986
). So far, UVD has not, or only to a small extent, been found in cats with diseases induced by other FeLV strains and in healthy FeLV-FAIDS-infected cats (Mullins et al., 1986
, 1991
). Another additional explanation for the higher provirus loads in naturally infected cats could be the unknown, but supposedly longer, duration of infection in naturally infected cats than in experimentally infected animals. In the latter animals, the load of provirus was determined early in infection (up to week 15). Increased duration of infection might lead to an increase of the provirus load in cats that persistently test positive for the p27 antigen. Provirus burden gradually increased throughout the course of FeLV-FAIDS infection and the fraction of cells harbouring FeLV antigen was higher in chronically infected cats than in acutely infected animals (Quackenbush et al., 1996
a
, b).
The primers and the probe for quantitative PCR were designed to be specific for FeLV-A sequences. Both the quantitative and the nested PCR methods detected an FeLV-B molecular clone, but only the nested PCR method recognized FeLV-C Sarma. As all cats infected with FeLV are known to harbour FeLV-A (Jarrett et al., 1978
), false-negative results were not expected. However, when naturally infected Swiss cats were analysed by both PCR methods, discrepant results (positive by nested PCR but negative by quantitative real-time PCR) were found in 15 cats. We suspect that these cats harboured FeLV-C. Virus isolation, interference and neutralization assays (Sarma & Log, 1973
) as well as sequencing of the variable regions in env (Riedel et al., 1986
, 1988
) will be necessary to address this question. To avoid false-negative results when assessing naturally infected cats, we recommend the use of nested PCR or to enhance real-time PCR by a second probe.
Provirus was quantified in buffy-coat cells of cats during the early stage of experimental FeLV-A infection. We speculated that the initial provirus load might influence the outcome of infection. Challenged animals were grouped into persistently infected cats and cats with a regressive, contained viraemia (transiently antigenaemic or p27 antigen-negative). The persistently, progressively infected animals had an initial peak of high provirus loads at around week 4 after challenge infection. A similar, but less pronounced initial peak, was also found in transiently antigenaemic cats, but not in cats that tested negative for the p27 antigen. Furthermore, animals with an initially high provirus load had high antigenaemia and provirus load later in the experiment. Therefore, we hypothesize that the initial provirus load may be associated with the outcome of infection. However, to prove this hypothesis, a higher number of cats would have to be studied over a longer period of time.
To determine what factors might influence the magnitude of the initial provirus load, we determined FeLV-specific antibody production. Differences in humoral immune responses between cats with progressive and regressive antigenaemia were initially evident 3 weeks after virus exposure and coincided with the appearance of differences in provirus loads. Cats with contained antigenaemia displayed a more pronounced humoral immune response and lower provirus loads than animals with progressive antigenaemia. Consequently, a cat that is capable of immunologically controlling the initial peak of provirus may be able to effectively overcome viraemia. By lowering the initial provirus load to under a certain threshold or by augmenting the early humoral immune response, e.g. by vaccination, cats may be protected from persistent infection. Furthermore, antibodies seem to contribute to the control of infection after the initial peak of provirus: cats with high antibody levels had low or undetectable antigen and provirus throughout the remainder of the experiment and vice versa. It must be assumed that other factors also play an important role in defeating FeLV, such as the cellular immune response (Flynn et al. 2000
) or a more or less pronounced natural resistance of the host. One of the transiently antigenaemic cats showed initial low levels of anti-FeLV antibodies, was antigen-positive and had a high provirus load (as high as those of the persistently infected cats). Nevertheless, this cat developed high antibody levels by week 4, became antigen-negative and the provirus load decreased; the animal kept this status until the end of the experiment. It is unclear what the rescue mechanism was in this cat that showed all the signs of an upcoming persistent infection.
In conclusion, detection of provirus-positive carriers and the determination of the provirus loads provide important additional parameters that allow the more precise characterization of the pathogenesis of FeLV infection in naturally and experimentally infected cats. In addition, these parameters may be valuable to study the mechanisms that lead to protection after FeLV vaccination.
| Acknowledgments |
|---|
| Footnotes |
|---|
c Present address: Swiss National Center for Retroviruses, University of Zurich, Zurich, Switzerland. ![]()
| References |
|---|
|
|
|---|
Elder, J. H. & Mullins, J. I. (1983). Nucleotide sequence of the envelope gene of GardnerArnstein feline leukemia virus B reveals unique sequence homologies with a murine mink cell focus-forming virus. Journal of Virology 46, 871-880.
Essex, M. E. (1982). Feline leukemia: a naturally occurring cancer of infectious origin. Epidemiologic Reviews 4, 189-203.
Flynn, J. N., Hanlon, L. & Jarrett, O. (2000). Feline leukaemia virus: protective immunity is mediated by virus-specific cytotoxic T lymphocytes. Immunology 101, 120-125.[Medline]
Gibson, U. E. M., Heid, C. A. & Williams, P. M. (1996). A novel method for real-time quantitative RTPCR. Genome Research 6, 995-1001.
Gut, M., Leutenegger, C., Huder, J., Pedersen, N. & Lutz, H. (1999). One-tube fluorogenic reverse transcriptionpolymerase chain reaction for the quantitation of feline coronavirus. Journal of Virological Methods 77, 37-46.[Medline]
Hardy, W. D.Jr & McClelland, A. J. (1977). Feline leukemia virus. Its related diseases and control. Veterinary Clinics of North America 7, 93-103.
Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996). Realtime quantitative PCR. Genome Research 6, 986-994.
Holland, P. M., Abramson, R. D., Watson, R. & Gelfand, D. H. (1991). Detection of specific polymerase chain reaction product by utilizing the 5'
3' exonuclease activity of Thermus aquaticus DNA polymerase. Proceedings of the National Academy of Sciences, USA 88, 7276-7280.
Hoover, E. A. & Mullins, J. I. (1991). Feline leukemia virus infection and diseases. Journal of the American Veterinary Medical Association 199, 1287-1297.[Medline]
Hoover, E. A., Olsen, R. G., Hardy, W. D.Jr, Schaller, J. P., Mathes, L. E. & Cockerell, G. L. (1975). Biologic and immunologic response of cats to experimental infection with feline leukemia virus. Bibliotheca Haematologica 43, 180-183.
Hoover, E. A., Mullins, J. I., Quackenbush, S. L. & Gasper, P. W. (1987). Experimental transmission and pathogenesis of immunodeficiency syndrome in cats. Blood 70, 1880-1892.
Jackson, M. L., Haines, D. M., Meric, S. M. & Misra, V. (1993). Feline leukemia virus detection by immunohistochemistry and polymerase chain reaction in formalin-fixed, paraffin-embedded tumor tissue from cats with lymphosarcoma. Canadian Journal of Veterinary Research 57, 269-276.
Jackson, M. L., Haines, D. M., Taylor, S. M. & Misra, V. (1996). Feline leukemia virus detection by ELISA and PCR in peripheral blood from 68 cats with high, moderate, or low suspicion of having FeLV-related disease. Journal of Veterinary Diagnostic Investigation 8, 25-30.
Jarrett, W. F. (1975). Cat leukemia and its viruses. Advances in Veterinary Science and Comparative Medicine 19, 165-193.[Medline]
Jarrett, O. & Ganiere, J. P. (1996). Comparative studies of the efficacy of a recombinant feline leukemia virus vaccine. Veterinary Record 138, 7-11.
Jarrett, O., Hardy, W. D.Jr, Golder, M. C. & Hay, D. (1978). The frequency of occurrence of feline leukaemia virus subgroups in cats. International Journal of Cancer 21, 334-337.
Klenerman, P., Hengartner, H. & Zinkernagel, R. M. (1997). A non-retroviral RNA virus persists in DNA form. Nature 390, 298-301.[Medline]
Kumar, D. V., Berry, B. T. & Roy-Burman, P. (1989). Nucleotide sequence and distinctive characteristics of the env gene of endogenous feline leukemia provirus. Journal of Virology 63, 2379-2384.
Lee, L. G., Connell, C. R. & Bloch, W. (1993). Allelic discrimination by nick-translation PCR with fluorogenic probes. Nucleic Acids Research 21, 761-766.
Livak, K. J., Flood, S. J. A., Marmaro, J., Giusti, W. & Deetz, K. (1995). Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods and Applications 4, 357-362.[Medline]
Lutz, H., Pedersen, N., Higgins, J., Hubscher, U., Troy, F. A. & Theilen, G. H. (1980). Humoral immune reactivity to feline leukemia virus and associated antigens in cats naturally infected with feline leukemia virus. Cancer Research 40, 3642-3651.
Lutz, H., Pedersen, N. C., Durbin, R. & Theilen, G. H. (1983). Monoclonal antibodies to three epitopic regions of feline leukemia virus p27 and their use in enzyme-linked immunosorbent assay of p27. Journal of Immunological Methods 56, 209-220.[Medline]
Lutz, H., Arnold, P., Hubscher, U., Egberink, H., Pedersen, N. & Horzinek, M. C. (1988). Specificity assessment of feline T-lymphotropic lentivirus serology. Zentralblatt der Veterinärmedizin Reihe B 35, 773-778.
Lyamichev, V., Brow, M. A. D. & Dahlberg, J. E. (1993). Structure-specific endonucleolytic cleavage of nucleic acids by eubacterial DNA polymerases. Science 260, 778-783.
McClelland, A. J., Hardy, W. D. & Zuckerman, E. E. (1980). Prognosis of healthy feline leukemia virus infected cats. In Development in Cancer Research , pp. 121-126. Edited by W. D. Hardy, M. Essex & A. J. McClelland. Amsterdam:Elsevier.
Miyazawa, T. & Jarrett, O. (1997). Feline leukaemia virus proviral DNA detected by polymerase chain reaction in antigenemic but non-viraemic (discordant) cats. Archives of Virology 142, 323-332.[Medline]
Mullins, J. I., Chen, C. S. & Hoover, E. A. (1986). Disease-specific and tissue-specific production of unintegrated feline leukaemia virus variant DNA in feline AIDS. Nature 319, 333-336.[Medline]
Mullins, J. I., Hoover, E. A. & Quackenbush, S. L. (1991). Disease progression and viral genome variants in experimental feline leukemia virus-induced immunodeficiency syndrome. Journal of Acquired Immune Deficiency Syndromes 4, 547-557.
Quackenbush, S. L., Dean, G. A., Mullins, J. I. & Hoover, E. A. (1996a). Analysis of FeLV-FAIDS provirus burden and productive infection in lymphocyte subsets in vivo. Virology 223, 1-9.[Medline]
Quackenbush, S. L., Mullins, J. I. & Hoover, E. A. (1996b). Replication kinetics and cell tropism of an immunosuppressive feline leukaemia virus. Journal of General Virology 77, 1411-1420.
Riedel, N., Hoover, E. A., Gasper, P. W., Nicolson, M. O. & Mullins, J. I. (1986). Molecular analysis and pathogenesis of the feline aplastic anemia retrovirus, feline leukemia virus C-Sarma. Journal of Virology 60, 242-250.
Riedel, N., Hoover, E. A., Dornsife, R. E. & Mullins, J. I. (1988). Pathogenic and host range determinants of the feline aplastic anemia retrovirus. Proceedings of the National Academy of Sciences, USA 85, 2758-2762.
Rohn, J. L. & Overbaugh, J. (1995). In vivo selection of long terminal repeat alterations in feline leukemia virus-induced thymic lymphomas. Virology 206, 661-665.[Medline]
Rojko, J. L. & Kociba, G. J. (1991). Pathogenesis of infection by the feline leukemia virus. Journal of the American Veterinary Medical Association 199, 1305-1310.[Medline]
Sarma, P. S. & Log, T. (1973). Subgroup classification of feline leukemia and sarcoma viruses by viral interference and neutralization tests. Virology 54, 160-169.[Medline]
Sparkes, A. H. (1997). Feline leukaemia virus: a review of immunity and vaccination. Journal of Small Animal Practice 38, 187-194.[Medline]
Stewart, M. A., Warnock, M., Wheeler, A., Wilkie, N., Mullins, J. I., Onions, D. E. & Neil, J. C. (1986). Nucleotide sequences of a feline leukemia virus subgroup A envelope gene and long terminal repeat and evidence for the recombinational origin of subgroup B viruses. Journal of Virology 58, 825-834.
Received 26 September 2000;
accepted 8 March 2001.
This article has been cited by other articles:
![]() |
F. M. Coelho, M. R. Q. Bomfim, F. de Andrade Caxito, N. A. Ribeiro, M. M. Luppi, E. A. Costa, M. E. Oliveira, F. G. Da Fonseca, and M. Resende Naturally occurring feline leukemia virus subgroup A and B infections in urban domestic cats J. Gen. Virol., November 1, 2008; 89(11): 2799 - 2805. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Cunningham, M. A. Brown, D. B. Shindle, S. P. Terrell, K. A. Hayes, B. C. Ferree, R. T. McBride, E. L. Blankenship, D. Jansen, S. B. Citino, et al. EPIZOOTIOLOGY AND MANAGEMENT OF FELINE LEUKEMIA VIRUS IN THE FLORIDA PUMA J. Wildl. Dis., July 1, 2008; 44(3): 537 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Filoni, J. L. Catao-Dias, G. Bay, E. L. Durigon, R. S. P. Jorge, H. Lutz, and R. Hofmann-Lehmann First Evidence of Feline Herpesvirus, Calicivirus, Parvovirus, and Ehrlichia Exposure in Brazilian Free-ranging Felids. J. Wildl. Dis., April 1, 2006; 42(2): 470 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Gomes-Keller, E. Gonczi, R. Tandon, F. Riondato, R. Hofmann-Lehmann, M. L. Meli, and H. Lutz Detection of feline leukemia virus RNA in saliva from naturally infected cats and correlation of PCR results with those of current diagnostic methods. J. Clin. Microbiol., March 1, 2006; 44(3): 916 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Willi, F. S. Boretti, V. Cattori, S. Tasker, M. L. Meli, C. Reusch, H. Lutz, and R. Hofmann-Lehmann Identification, Molecular Characterization, and Experimental Transmission of a New Hemoplasma Isolate from a Cat with Hemolytic Anemia in Switzerland J. Clin. Microbiol., June 1, 2005; 43(6): 2581 - 2585. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-P. Ryser-Degiorgis, R. Hofmann-Lehmann, C. M. Leutenegger, C. H. af Segerstad, T. Morner, R. Mattsson, and H. Lutz EPIZOOTIOLOGIC INVESTIGATIONS OF SELECTED INFECTIOUS DISEASE AGENTS IN FREE-RANGING EURASIAN LYNX FROM SWEDEN J. Wildl. Dis., January 1, 2005; 41(1): 58 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Crawford, C. L. Swenson, S. P. Arnoczky, J. O'Shea, and H. Ross Lyophilization Does Not Inactivate Infectious Retrovirus in Systemically Infected Bone and Tendon Allografts Am. J. Sports Med., April 1, 2004; 32(3): 580 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Swenson and S. P. Arnoczky Demineralization for Inactivation of Infectious Retrovirus in Systemically Infected Cortical Bone: In Vitro and in Vivo Experimental Studies J. Bone Joint Surg. Am., January 29, 2003; 85(2): 323 - 332. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |