|
|
||||||||
Animal: RNA Viruses |
Hepatitis Viruses and Molecular Hepatitis Sections, Laboratory of Infectious Diseases1 and Laboratory of Immunoregulation2, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
Critical Care Medicine Department, Clinical Center, National Institutes of Health, Bethesda, MD 20892, USA3
Author for correspondence: Suzanne Emerson. Fax +1 301 402 0524. e-mail semerson{at}niaid.nih.gov
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In Western Europe and the United States (US), clinical cases of hepatitis caused by HEV are rare and most often they have been associated with travel to areas where HEV is endemic. However, novel strains of HEV have been isolated in the US (Schlauder et al., 1998
) and in Europe (Schlauder et al., 1999
; Zanetti et al., 1999
) from patients without a history of travel to regions endemic for HEV. Serological studies in industrialized countries have shown that the prevalence of anti-HEV antibodies is 16% among blood donors (Paul et al., 1994
; Mast et al., 1997
) and is much higher in some populations (Zaaijer et al., 1995
; Thomas et al., 1997
). The cause of this relatively high prevalence of anti-HEV in countries where clinical hepatitis E is rare is unknown. The discovery of a new strain of HEV circulating among swine in the US (Meng et al., 1997
) and the detection of anti-HEV antibodies in rodents in the US (Kabrane-Lazizi et al., 1999
; Favorov et al., 2000
) raise the possibility that an animal reservoir of HEV may exist even in developed countries.
HEV is a small, non-enveloped virus that has a positive-sense, single-stranded RNA genome of approximately 7·5 kb. The genome contains three open reading frames (ORFs); ORF1 encodes the non-structural proteins, ORF2 encodes the capsid protein and ORF3 encodes a protein of unknown function (Reyes et al., 1993
). The sequences of ORF2 and ORF3 are well conserved among HEV isolates whereas one region of ORF1 (the hypervariable region) displays significant genetic diversity (Tsarev et al., 1992
; Huang et al., 1995
). Four genotypes of HEV have been identified, based on comparisons of nearly full-length genomic sequences. In general, different genotypes circulate within different geographical areas. Genotype 1 comprises Southeast and Central Asian isolates from Burma, Pakistan, India and China; genotype 2 comprises a single Mexican isolate; genotype 3 comprises US isolates (two human, one swine); and genotype 4 comprises recently described Chinese isolates (Wang et al., 1999
, 2000
).
In the present study, we identified the aetiological agent of acute hepatitis in a US patient who had recently returned from a vacation in Thailand. We transmitted the HEV strain from the patient to a monkey and demonstrated that the genome represented a unique HEV strain related to, but not identical to, US isolates.
| Methods |
|---|
|
|
|---|
Patient history.
Animal transmission.
A rhesus monkey (Macaca mulatta) was inoculated intravenously with 0·2 ml of the first acute phase serum collected from patient W. Serum samples were collected weekly from the monkey for 12 weeks post-inoculation (p.i.) and tested for anti-HEV by ELISA and for levels of serum liver enzymes by standard methods. Faecal samples were collected daily for HEV RNA detection by RTPCR.
Serological tests.
Serology for hepatitis A (IgG and IgM anti-HAV), for hepatitis B (HBsAg, IgG and IgM anti-HBc) and for hepatitis C (anti-HCV) were performed using commercial ELISAs (Abbott Laboratories). The detection of antibody to HAV non-structural protein (3C proteinase) was performed as described previously (Stewart et al., 1997
). The detection of anti-HEV antibodies (IgG and IgM) in patient and monkey sera was performed with an in-house ELISA using as antigen a truncated (55 kDa) recombinant HEV capsid protein expressed from baculovirus and purified from SF-9 insect cells (Robinson et al., 1998
; Tsarev et al., 1993
).
RTPCR.
HEV RNA was extracted from 50 µl of patient or monkey serum with TRIzol reagent (Gibco-BRL) or from 100 µl of a 10% suspension of faeces with a QIAamp viral RNA kit (Qiagen). Reverse transcription was performed with random hexamers and a GeneAmp RTPCR kit according to the manufacturers protocol (Perkin Elmer). Detection and titration of viral RNA by RTPCR were performed with degenerate primers described for amplification of a conserved region in ORF1 and in ORF2 (Wang et al., 1999
). These primers were also used to amplify the ORF1 and ORF2 regions for sequencing. Additional primers were designed to amplify three other regions of the genome: these were HVR external sense 5' GGTAATAARACCTTCMGSACGWCGKTKGTTG (nt 17111741); HVR external antisense 5' CGGGAGCAAGTCTCCCGGTASGCWGCCTC (nt 26842656); HVR internal sense 5' CCCAGCGSCWTTCGCTGACCGG (nt 19852006); HVR internal antisense 5' CCCGGTASGCWGCCTCAAGCCTC (nt 26712649); ORF1, 2, 3 external sense 5' CGAGGGTTGACAAATGTTGCG (nt 49514971); ORF1, 2, 3 external antisense 5' CGGGTTGTGAAACGACATCG (nt 53815362); ORF1, 2, 3 internal sense 5' CCGTGTTTATGGAGTTAGCCCC (nt 49955016); ORF1, 2, 3 internal antisense 5' TGAGAATCAACCCTGTCACCCC (nt 53165294); ORF2 external sense 5' GACAGAATTRATTTCGTCGGC (nt 63226345; ORF2 external antisense oligo(dT)1218; ORF2 internal sense 5' GTTGTCTCGGCCAATGGCGAGC (nt 63716392); ORF2 internal antisense 5' TTTTTTTTTTTTCCAGGGAGCGCGG. Primer positions are numbered according to swine HEV GenBank AF082843. Degenerate primers contained multiple bases at the indicated positions where R=A or G, M=A or C, S=C or G, W=A or T and K=G or T.
For genome characterization, RTPCR was performed on HEV RNA extracted from patient W serum (conserved region of ORF1 and ORF2) and from a monkey faecal sample (remaining three regions) collected 2 days before the experimentally infected monkey seroconverted to anti-HEV. The cDNAs were synthesized with Superscript II reverse transcriptase (Gibco-BRL).
The PCR conditions used to amplify the different regions of the genome varied. A 100 µl PCR reaction was performed with 10 µl of cDNA or amplification product for first and second round respectively and 50 pmol of each external or internal primer, 2 mM MgCl2 and 5 U Taq polymerase. For amplification of GC-rich regions, first and second round PCR were carried out in a 50 µl reaction using an Advantage-GC cDNA PCR kit (Clontech). All the thermal procedures were performed in a GeneAmp PCR system (Perkin Elmer).
Sequence and phylogenetic analysis.
The PCR fragments were purified with a QIAquick gel extraction kit (Qiagen) and cloned with a TA cloning kit (Invitrogen). Both strands were sequenced with an automated DNA sequencer. Nucleotide and amino acid sequences were analysed with the Sequencher 3.0 software (Gene Codes Corp.). Strains representing the four genotypes were compared with GAP (GCG version 9.0, Genetics Computer Group, Madison, WI, USA).
The nucleotide sequences were aligned using PILEUP (GCG) and analysed with PAUPSEARCH and PAUPDISPLAY from the PAUP computer software (4.0) to generate phylogenetic trees. Bootstrap 50% majority-rule consensus trees (midpoint rooting) were obtained by performing heuristic search (optimality criterion, maximum parsimony; all characters equal weight; 1000 replicates). The consensus trees were viewed using the TREEVIEW program.
GenBank numbers: Pakistan (SAR-55), accession no. M80581 (Tsarev et al., 1992
); Burma (B1and B2), accession nos M73218 and D10330 (Tam et al., 1991
); Mexico M1, accession no. M74506 (Huang et al., 1992
); US1 and US2, accession nos AF060668 and AF060669 respectively, (Schlauder et al., 1998
); US swine, accession no. AF082843 (Meng et al., 1998
); Italian (It1), accession nos AF110387, AF110309 (Schlauder et al., 1999
); Greek, (Gr1 and Gr2), accession nos AF110388, AF110391 and AF110389, AF110392 (Schlauder et al., 1999
); New Chinese, accession no. AJ272108 (Wang et al., 2000
); New Zealand swine (NZ swine), accession nos AF215661, AF200704 (Garbavenko et al., 2000
).
| Results |
|---|
|
|
|---|
The serum collected prior to visiting Thailand was negative for anti-HEV, but the two serum samples collected 1 week apart during the acute phase were both strongly positive for IgG and IgM anti-HEV antibodies. HEV RNA was also detected by RTPCR, indicating that the acute hepatitis in patient W was caused by HEV. The first acute phase serum was positive for HEV sequences at dilutions of 105 and 107 respectively for ORF1 and ORF2. An aliquot of this serum specimen was inoculated into a rhesus monkey. We also tested sera from two of the three travelling companions 10 months after they returned from Thailand. They were negative for anti-HEV.
Transmission study
ALT values were elevated in the inoculated monkey on day 7, 14 and 42 p.i with the peak value (188 IU/l) on day 42 p.i. The monkey seroconverted to anti-HEV IgG and anti-HEV IgM 3 weeks after inoculation (day 21). HEV RNA was detected by RTPCR in serum collected 1 week (day 14) before seroconversion and remained detectable for 3 weeks. The six faecal specimens collected near the time of seroconversion (between days 18 and 30 p.i) were all positive for HEV sequences by RTPCR: RNA from the faecal specimen collected 2 days before seroconversion was further characterized.
Sequence analysis of conserved regions in ORF1 and ORF2
The PCR products corresponding to the most conserved regions in ORF1 and in ORF2, respectively, were sequenced since these regions have been frequently used for the identification of new strains.
The comparison of the ORF1 nucleotide sequence amplified from patient serum indicated that the HEV strain recovered from patient W was most closely related to swine and human strains recovered in the US (8586% identity) and to the swine strain recovered in New Zealand (87% identity) (Table 1
). The sequence identities between the W isolate and the European HEV strains were lower (7881%). The nucleotide sequence of the W isolate was significantly divergent from those of the Asian, New Chinese and Mexican isolates (7073% identity). The amino acid sequence comparisons also showed more identity between the W isolate and HEV strains from the US and European groups (9296%), compared to that observed with the Asian group (8586%) or with the Mexican isolate (89%). However, the W isolate also had high amino acid identities with NZ swine (95%) and the New Chinese isolate (90%).
|
We confirmed these data by analysing the sequence of the same regions amplified from stools collected from the infected monkey.
Sequence analysis of the 3' portion of the genome
Approximately 800 bp of the 3' terminus of ORF2 was amplified from the monkey faecal sample. The HEV strain from patient W shared approximately 87% nucleotide identity with the US strains (swine and human) within this region and only 7478% with the Mexican, Asian and New Chinese strains (Table 1
). The amino acid sequence comparisons also showed more identity between the patient W strain and the US strains, 8485% versus 8182% with the Asian strains and 79% with the Mexican strain.
We also amplified about 250 nt encompassing a portion of ORF1 and the region of ORF2/ORF3 overlap, and compared its sequence with the sequences available for other HEV strains. The nucleotide identities found with swine and human US strains (8689%) were 912% higher than with the genotype 1, 2 or 4 strains (Table 1
). As in the US isolates, the W strain had a deletion of 3 nt just downstream of the ORF3 initiation codon (data not shown). The amino acid sequences within this region were not compared because all three reading frames were utilized.
Sequence analysis of the hypervariable region in ORF1
Because the HVR in ORF1 (between nt 2011 and 2325) distinguishes between very closely related strains (Tsarev et al., 1992
), we amplified and analysed a fragment of 555 nt in this region. The estimated nucleotide identity between the homologous regions of the W strain and the US strains (US1 and swine) or the Pakistani, Burmese, Mexican and genotype 4 isolates was approximately 82% and 5961%, respectively (data not shown). We also compared a portion of the HVR sequence of strain W to that of the swine and US1 strains and to a consensus sequence of 17 strains (Fig. 1
). The HVR of US human and swine strains has 4245 nt more than do all the Asian strains and 3336 nt more than does the Mexican strain (Meng et al., 1998
). The W strain also had additional nucleotides in this region but it had only 30 extra nucleotides compared to the Asian strains since it did not have the poly(C) tract characteristic of the US strains (Fig. 1
). The New Chinese strain had a similar number of additional nucleotides as did the US strain in this region but lacked the poly(C) tract (data not shown). Because of the high level of diversity and the difference in lengths of the HVR, the exact positions of the 30 extra nucleotides could not be defined relative to the other strains.
|
|
| Discussion |
|---|
|
|
|---|
To define further the relationship between the W isolate and US isolates, we sequenced and analysed the HVR in ORF1. Very low nucleotide or amino acid identities within the HVR have been observed between geographically distant HEV strains. For instance, the US isolates are approximately 85% identical to each other but only 42% identical to the Pakistani strain, 39% identical to the Burmese strain and 32% identical to the Mexican strain in this region (Erker et al., 1999
). Furthermore, within this region, US isolates from humans and from swine contain many nucleotide insertions and a unique poly(C) tract, when compared to other strains. The W isolate was similar to the US strains in having many insertions but differed from them by lacking this characteristic poly(C) tract: otherwise the HVR nucleotide sequences were quite similar with an identity of 82% (data not shown). The W strain additionally had a 3 nt deletion in ORF3 as do US strains but not Asian strains (Meng et al., 1998
; Erker et al., 1999
). Comparison of the HVR of strain W with those of the Pakistani, the Burmese and the New Chinese strains showed lower nucleotide identities (5961%), consistent with the results of nucleotide comparisons based on conserved regions of ORF1 and ORF2. Therefore, the W strain shared some unique features and considerable homology with the US strains. However, its genotype cannot be assigned until more sequence, preferably that of the entire genome, is obtained.
Originally, all HEV strains from Southeast and Central Asia were classified as genotype 1 but recently another group of viruses from China was found to constitute a new genotype, genotype 4. The only strain isolated from Mexico is of genotype 2 although a new Nigerian strain is more closely related to the Mexican strain than to other HEV strains (Buisson et al., 2000
). All these strains were isolated in areas where hepatitis E is endemic or epidemic. In contrast, the viruses isolated in the US, where hepatitis E is rare, form another branch of the phylogenetic tree and constitute genotype 3.
Additional isolates of HEV are being identified at a rapid rate. North African HEV isolates cluster with the Asian strains and constitute what appears to be a separate subtype within genotype 1 (Tsarev et al., 1999
). Unique isolates from other countries have been assigned by their discoverers to genotype 4 (Hsieh et al., 1998
) or to new genotypes 58 (Schlauder et al., 1999
, 2000
). However, only very limited sequence data (<400 nucleotides) are available for these latter strains and, as shown by the data in Fig. 2
and Table 1
, different degrees of relatedness are predicted when different regions are compared. For instance, the New Chinese strain was closer or more distant to the W strain than were the Asian strains depending on the region. Therefore, until more sequence data are obtained and a consensus is reached on what defines a genotype, these strains, as well as the W strain, are best considered as unclassified.
The fact that the new HEV isolate described in this study was more closely related to the US and European strains than to the Asian strains raises the questions of the origin of this infection in the patient and of the distribution of HEV strains worldwide. Indeed, the report of an isolation of a US/European-like HEV from swine in NZ suggests that the apparent localization of a particular genotype to a defined geographical region may not be as stringent as previously thought. Thus, the true geographical origin of the patient W HEV isolate remains obscure.
| References |
|---|
|
|
|---|
Balayan, M. S. (1997). Epidemiology of hepatitis E virus infection. Journal of Viral Hepatitis 4, 155-165.[Medline]
Balayan, M. S., Usmanov, R. K., Zamiatina, N. A., Dzhumalieva, D. I. & Karas, F. R. (1990). Experimental hepatitis E in domestic piglets. Journal of Medical Virology 32, 58-59.[Medline]
Buisson, Y., Grandadam, M., Nicand, E., Cheval, P., van Cuyck-Gandre, H., Innis, B. L., Rehel, P., Coursaget, P., Teyssou, R. & Tsarev, S. (2000). Identification of a novel hepatitis E virus in Nigeria. Journal of General Virology 81, 903-909.
Clayson, E. T., Innis, B. L., Myint, K. S., Naraputi, S., Vaughn, D. W., Giri, S., Ranabhat, P. & Shrestha, M. P. (1995). Detection of hepatitis E infection in domestic swine in Kathmandu Valley in Nepal. American Journal of Tropical Medicine and Hygiene 53, 228-232.
Erker, J. C., Desai, S. M., Schlauder, G. G., Dawson, G. J. & Mushahwar, I. K. (1999). A hepatitis E variant from the United States: molecular characterization and transmission in cynomolgus macaques. Journal of General Virology 80, 681-690.[Abstract]
Favorov, M. O., Kosoy, M. Y., Tsarev, S. A., Childs, J. E. & Margolis, H. S. (2000). Prevalence of antibody to hepatitis E virus among rodents in the United States. Journal of Infectious Diseases 181, 449-455.[Medline]
Garbavenko, O., Anderson, D., Shroeder, B. & Croxson, C. (2000). Evidence of swine hepatitis E virus in New Zealand. 10th International Symposium on Viral Hepatitis and Liver Disease, Atlanta, USA, April 913, abstract E016.
Hsieh, S. Y., Yang, P. Y., Ho, Y. P., Chu, C. M. & Liaw, Y. F. (1998). Identification of a novel strain of hepatitis E virus responsible for sporadic acute hepatitis in Taiwan. Journal of Medical Virology 55, 300-304.[Medline]
Huang, C. C., Nguyen, D., Fernandez, J., Yun, K. Y., Fry, K. E., Bradley, D. W., Tam, A. W. & Reyes, G. R. (1992). Molecular cloning and sequencing of the Mexico isolate of hepatitis E virus. Virology 191, 550-558.[Medline]
Huang, R. T., Nakazono, N., Ishii, K., Kawamata, O., Kawaguchi, R. & Tsukada, Y. (1995). II. Existing variations on the gene structure of hepatitis E virus strains from some regions of China. Journal of Medical Virology 47, 303-308.[Medline]
Kabrane-Lazizi, Y., Fine, J. B., Glass, G. E., Higa, H., Diwan, A., Gibbs, C. J., Meng, X.-J., Emerson, S. U. & Purcell, R. H. (1999). Evidence of wide spread infection of wild rats with hepatitis E virus in the United States. American Journal of Tropical Medicine and Hygiene 61, 331-335.[Abstract]
Karetnyi, Y. V., Dzhumalieva, D. I., Usmanov, R. K., Titova, I. P., Lituak, Y. A. & Balayan, M. S. (1993). Possible involvement of rodents in the spread of hepatitis E (in Russian). Journal of Microbiology Epidemiology and Immunology 41, 52-56.
Mast, E. E., Kuramoto, I. K., Favorov, M. O., Shoening, V. R., Burkholder, B. T., Shapiro, C. N. & Holland, P. V. (1997). Prevalence of and risk factors for antibody to hepatitis E virus seroreactivity among bloods donors in northern California. Journal of Infectious Diseases 176, 34-40.[Medline]
Meng, X.-J., Purcell, R. H., Halbur, P. G., Lehman, J. R., Webb, D. M., Tsareva, T. S., Haynes, J. S., Thacker, B. J. & Emerson, S. U. (1997). A novel virus in swine is closely related to the human hepatitis E virus. Proceedings of the National Academy of Sciences, USA 94, 9860-9865.
Meng, X.-J., Halbur, P. G., Shapiro, M. S., Govindarajan, S., Bruna, J. D., Mushahwar, I. K., Purcell, R. H. & Emerson, S. U. (1998). Genetic and experimental evidence for cross-species infection by swine hepatitis E virus. Journal of Virology 72, 9714-9721.
Paul, D. A., Knigge, M. F., Ritter, A., Gutierrez, R., Pilot-Matias, T., Chau, K. H. & Dawson, G. J. (1994). Determination of hepatitis E seroprevalence by using recombinant fusion protein and synthetic peptides. Journal of Infectious Diseases 169, 801-806.[Medline]
Purcell, R. H. (1996). Hepatitis E virus. In Fields Virology , pp. 2831-2843. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Reyes, G. R., Huang, C. C., Tam, A. W. & Purdy, M. A. (1993). Molecular organization and replication of hepatitis E virus (HEV). Archives of Virology 7, 15-29.
Robinson, R. A., Burgess, W. H., Emerson, S. U., Leibowitz, R. S., Sosnovtseva, S. A., Tsarev, S. & Purcell, R. H. (1998). Structural characterization of recombinant hepatitis E virus ORF2 proteins in baculovirus-infected insect cells. Protein Expression and Purification 12, 75-84.[Medline]
Schlauder, G. G., Dawson, G. J., Erker, J. C., Kwo, P. Y., Knigge, M. F., Smalley, D. L., Rosenblatt, J. E., Desai, S. M. & Mushahwar, I. K. (1998). The sequence and phylogenetic analysis of a novel hepatitis E virus isolated from a patient with acute hepatitis reported in the United States. Journal of General Virology 79, 449-456.
Schlauder, G. G., Desai, S. M., Zanetti, A. R., Tassopoulos, N. C. & Mushahwar, I. K. (1999). Novel hepatitis E virus (HEV) isolates from Europe: evidence for additional genotypes of HEV. Journal of Medical Virology 57, 243-251.[Medline]
Schlauder, G. G., Frider, B., Sookoian, S., Castano, G. C. & Mushahwar, I. K. (2000). Identification of 2 novel isolates of hepatitis E virus in Argentina. Journal of Infectious Diseases 182, 294-297.[Medline]
Stapleton, J. T. (1995). Host immune response to hepatitis A virus. Journal of Infectious Diseases 171(Suppl. 1), 914.[Medline]
Stewart, D. R., Morris, T. S., Purcell, R. H. & Emerson, S. U. (1997). Detection of antibodies to the nonstructural 3C proteinase of hepatitis A virus. Journal of Infectious Diseases 176, 593-601.[Medline]
Tam, A. W., Smith, M. M., Guerra, M. E., Huang, C. C., Bradley, D. W., Fry, K. E. & Reyes, G. R. (1991). Hepatitis E virus (HEV): molecular cloning and sequencing of the full-length viral genome. Virology 185, 120-131.[Medline]
Thomas, D. L., Yarbough, G. H., Vlahov, D., Tsarev, S. A., Nelson, K. E., Saah, A. J. & Purcell, R. H. (1997). Seroreactivity to hepatitis E virus in areas where the disease is not endemic. Journal of Clinical Microbiology 35, 1244-1247.[Abstract]
Tsarev, S. A., Emerson, S. U., Reyes, G. R., Tsareva, T. S., Legters, L. J., Malik, I. A, Iqbal, M. & Purcell, R. H. (1992). Characterization of a prototype strain of hepatitis E virus. Proceedings of the National Academy of Sciences, USA 89, 559-563.
Tsarev, S. A., Tsareva, T. S., Emerson, S. U., Kapikian, A. Z., Ticehurst, J., London, W. & Purcell, R. H. (1993). ELISA for antibody to hepatitis E virus (HEV) based on complete open-reading frame 2 protein expressed in insect cells: identification of HEV infection in primates. Journal of Infectious Diseases 168, 369-378.[Medline]
Tsarev, S. A., Binn, L. N., Gomatos, P. J., Arthur, R. R., Monier, M. K., van Cuyck-Gandre, H., Longer, C. F. & Innis, B. L. (1999). Phylogenetic analysis of hepatitis E virus isolates from Egypt. Journal of Medical Virology 57, 68-74.[Medline]
Usmanov, R. K., Balayan, M. S., Dvoinikova, O. V., Alynbayeva, D. B., Zamayatina, N. A., Kazachkov, Y. A. & Belov, V. I. (1994). Experimental hepatitis E infection in lambs. Voprosy Virusologii 39, 165-168.[Medline]
Wang, Y., Ling, R., Erker, J. C., Zhang, H., Li, H., Desai, S. M., Mushahwar, I. K. & Harrison, T. J. (1999). A divergent genotype of hepatitis E virus in Chinese patients with acute hepatitis. Journal of General Virology 80, 169-177.[Abstract]
Wang, Y., Zhang, H., Ling, R., Li, H. & Harrison, T. J. (2000). The complete sequence of hepatitis E virus genotype 4 reveals an alternative strategy for translation of open reading frames 2 and 3. Journal of General Virology 81, 1675-1686.
Zaaijer, H. L., Mauser-Bunschoten, E. P., ten Veen, J. H., Kapprell, H. P., Kok, M., van den Berg, H. M. & Lelie, P. N. (1995). Hepatitis E virus antibodies among patients with hemophilia, blood donors, and hepatitis patients. Journal of Medical Virology 46, 244-246.[Medline]
Zanetti, A. R., Schlauder, G. G., Romano, L., Tanzi, E., Fabris, P., Dawson, G. J. & Mushahwar, I. K. (1999). Identification of a novel variant of hepatitis E virus in Italy. Journal of Medical Virology 57, 356-360.[Medline]
Received 4 October 2000;
accepted 14 March 2001.
This article has been cited by other articles:
![]() |
K. Cooper, F. F. Huang, L. Batista, C. D. Rayo, J. C. Bezanilla, T. E. Toth, and X. J. Meng Identification of Genotype 3 Hepatitis E Virus (HEV) in Serum and Fecal Samples from Pigs in Thailand and Mexico, Where Genotype 1 and 2 HEV Strains Are Prevalent in the Respective Human Populations J. Clin. Microbiol., April 1, 2005; 43(4): 1684 - 1688. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. W. Huang, G. Haqshenas, C. Kasorndorkbua, P. G. Halbur, S. U. Emerson, and X. J. Meng Capped RNA Transcripts of Full-Length cDNA Clones of Swine Hepatitis E Virus Are Replication Competent When Transfected into Huh7 Cells and Infectious When Intrahepatically Inoculated into Pigs J. Virol., February 1, 2005; 79(3): 1552 - 1558. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Huang, Z. F. Sun, S. U. Emerson, R. H. Purcell, H. L. Shivaprasad, F. W. Pierson, T. E. Toth, and X. J. Meng Determination and analysis of the complete genomic sequence of avian hepatitis E virus (avian HEV) and attempts to infect rhesus monkeys with avian HEV J. Gen. Virol., June 1, 2004; 85(6): 1609 - 1618. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pei and D. Yoo Genetic Characterization and Sequence Heterogeneity of a Canadian Isolate of Swine Hepatitis E Virus J. Clin. Microbiol., November 1, 2002; 40(11): 4021 - 4029. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Huang, G. Haqshenas, H. L. Shivaprasad, D. K. Guenette, P. R. Woolcock, C. T. Larsen, F. W. Pierson, F. Elvinger, T. E. Toth, and X. J. Meng Heterogeneity and Seroprevalence of a Newly Identified Avian Hepatitis E Virus from Chickens in the United States J. Clin. Microbiol., November 1, 2002; 40(11): 4197 - 4202. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Huang, G. Haqshenas, D. K. Guenette, P. G. Halbur, S. K. Schommer, F. W. Pierson, T.E. Toth, and X. J. Meng Detection by Reverse Transcription-PCR and Genetic Characterization of Field Isolates of Swine Hepatitis E Virus from Pigs in Different Geographic Regions of the United States J. Clin. Microbiol., April 1, 2002; 40(4): 1326 - 1332. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |