|
|
||||||||
Animal: RNA Viruses |
Laboratory of Veterinary Microbiology, Department of Veterinary Medicine, Faculty of Agriculture, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan1
Department of Veterinary Microbiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan2
Laboratory of Clinical Microbiology, Kyoritsu Shoji Corporation, 1-12-4 Kudan-Kita, Chiyoda-ku, Tokyo 102-0073, Japan3
Author for correspondence: Yukinobu Tohya. Fax +81 3 5841 8184. e-mail aytohya{at}jvm2.vm.a.u-tokyo.ac.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Capsid precursors of caliciviruses can be divided into six regions, designated as A to F (Neill, 1992
). As shown in Fig. 1
, in both FCV and CaCV, the A regions are cleaved by the proteinase encoded in ORF1 of FCV (Sosnovtsev et al., 1998
; Matsuura et al., 2000
). The A regions were identified as a 14 kDa polypeptide in the FCV-infected cells (Tohya et al., 1999
), and as a 22 kDa polypeptide in CaCV (Matsuura et al., 2000
). The B regions contain sequences that are highly conserved among all the caliciviruses (Neill, 1992
; Roerink et al., 1999a
). In CaCV, little is known about regions C to F. However, the C and E regions of FCV have been proposed to contain antigenic determinants (Milton et al., 1992
; Guiver et al., 1992
; Shin et al., 1993
). The E region of FCV is further divided into 5' and 3' hypervariable regions (HVRs) separated by a conserved central domain (Seal et al., 1993
; Geissler et al., 1997
; Radford et al., 1999
). The D and F regions are moderately conserved among caliciviruses. The F region is thought to be at least partially exposed on the surface of the virion (Milton et al., 1992
).
|
| Methods |
|---|
|
|
|---|
Virus and cells.
Production of MAbs against CaCV.
To diminish undesired antibodies against antigens from the canine cells, which were present even in the purified virus preparation, immunotolerance against uninfected cells was induced in BALB/c mice according to the methods described previously (Matthew & Sandrock, 1987
; Weiland et al., 1989
; Wieczorek-Krohmer et al., 1996
). Three weeks after the last immunotolerizing treatment, the first immunization with the purified CaCV was administered, followed by the second immunization 2 weeks later. Using IFA with the CaCV-infected MCM-B2 cells, antiviral antibodies were evaluated in sera collected 15 days after the second immunization. Seropositive mice, which showed a high titre of antibodies against CaCV, were inoculated with the purified CaCV by the intravenous route as the third immunization. Three days after the third immunization, spleen cells of the mice were taken out and fused with P3U1 myeloma cells (Tohya et al., 1990
). Hybridomas secreting antibodies against CaCV were detected by IFA and a neutralization test against 100 TCID50 of CaCV. Cultures producing virus-specific antibodies were subcloned by limiting dilution, followed by recloning and preparation of ascitic fluid. Immunoglobulin subtypes of the MAbs were determined by a MAb typing kit for mouse tissue culture supernatants (The Binding Site).
IFA with the products expressed from CaCV ORF2.
The CaCV ORF2 expression plasmid (pDCV-II) constructed as described previously (Matsuura et al., 2000
) was transfected into COS-7 cells according to the previously described method with minor modifications (Seed & Aruffo, 1987
; Shin et al., 1993
). The transfected COS-7 cells were smeared on glass slides, air-dried and then fixed in acetone. The fixed cells were reacted with the MAbs and then stained with anti-mouse IgG sheep antibody conjugated with fluorescein isothiocyanate. The cells were mounted in buffered glycerol and examined by fluorescence microscopy.
Isolation of neutralization-resistant variants.
Neutralization-resistant variants of CaCV No. 48 were selected by the methods described for FCV (Tohya et al., 1990
). CaCV No. 48 was allowed to react with ascitic fluids for 1 h at 37 °C and appropriate dilutions of the mixture were inoculated onto monolayers of MCM-B2 cells. Following incubation at 37 °C for 90 min, the cells were overlaid with 0·8% agar medium containing ascitic fluids. After incubation at 37 °C for 2 days, the monolayers were stained with 0·01% neutral red in agar overlay medium. Variant plaques were picked up and subjected to two more cycles of selection. Frequencies of variants resistant to neutralization by the MAbs in cloned virus stocks were measured as previously described (Smith & Inglis, 1987
; Tohya et al., 1997
). Neutralization-resistant variants were designated res followed by the name of the neutralizing MAbs.
Cross-neutralization test with the variants.
The cross-neutralization test was performed according to the microneutralization test procedure (San Gabriel et al., 1997
). Briefly, the ascitic fluids of MAbs, and anti-CaCV serum obtained from hyperimmunized mice, were serially twofold-diluted with Dulbeccos modified Eagle medium containing nutrient mixture F-12 (Life Technologies) with 1% foetal bovine serum. Twenty-five µl of each diluted ascitic fluid or serum was dispensed in each well of a 96-well plate. A dose of 100 TCID50 variants or parental virus as challenge virus in 25 µl was then added to each well. After 1 h incubation at 37 °C with occasional shaking, 50 µl of MCM-B2 cell suspension (2x106 cells/ml) was added. The plates were then observed at 48 and 72 h after infection. Neutralization titres of ascitic fluids and the serum against CaCV were expressed as the reciprocal of 50% neutralization end-point dilution.
Construction and transient expression of variant ORF2 expression plasmids.
RNA was extracted from MCM-B2 cells infected with each of the variants using an RNA micro-isolation Spin Cartridge system (Life Technologies). Each variant ORF2 was amplified with RTPCR as previously described (Matsuura et al., 2000
). The amplified fragments were cloned into the XhoIXbaI site of the pME18S expression vector driven by the SR
promoter (Takebe et al., 1988
). The constructed plasmids were transfected into COS-7 cells according to the methods described above. The transfected cells were analysed by IFA with MAbs.
Sequence analysis for detection of mutations in the variant ORF2s.
For each of the variants, two clones obtained from separate PCR experiments were sequenced. Sequencing was carried out using a BigDye Terminator Cycle Sequencing FS Ready Reaction kit (PE/Applied Biosystems) and analysed on an ABI PRISM 310 Genetic Analyser. Sequencing of the ORF2s was completed using primers derived from the sequence of parental CaCV ORF2 (Roerink et al., 1999a
). Amino acid translation was carried out using GENETYX-MAC version 8.0b. Detection of mutations in the variant ORF2s was carried out using CLUSTAL W, accessed through DDJB via the web. In this paper, amino acid position 1 of the CaCV ORF2 product is the start methionine. Nucleotide position 1 corresponds to nt 1086 in the nucleotide sequence deposited in GenBank (accession no. AF053720).
Alignment of the deduced amino acids of CaCV with FCV and San Miguel sea lion virus (SMSV) strains.
The deduced amino acid sequences of ORF2 products have been submitted to GenBank and assigned the following accession numbers: D90357 (FCV F4), L40021 (FCV Urbana), U13992 (FCV CFI/68), Z11536 (FCV F9), M87482 (SMSV4), U52005 (SMSV17), U15301 (SMSV1). The alignment of the deduced amino acid of CaCV ORF2 product with that of FCV/SMSV was carried out as described above. The E region of the CaCV capsid protein was considered to be the region corresponding to the E region of FCV/SMSV, based on the alignment of CaCV with the FCV/SMSV capsid protein.
Construction of revertant ORF2 expression plasmids by site-directed mutagenesis.
In order to confirm the amino acid residues related to forming the epitopes of the MAbs, nucleotide sequences of mutated amino acids of the variants were reverted to those of the parental virus by site-directed mutagenesis. Initially, the BamHI fragment containing the ORF2 of a variant was excised from the variant ORF2 expression plasmid and ligated into pBluescript II KS(+) (Stratagene). The reversion of amino acid position 442 (Gly442) (GTA to ATA for Asp) and the reversion of Lys477 (AAA to ACA for Thr) in the capsid precursor of resLD8, and the Arg478 reversion (CGA to CAA for Gln) and the Asp517 reversion (GAT to GGT for Gly) of res27G2 were introduced into the fragments with the use of synthetic oligonucleotides (Table 1
) and the TaKaRa LA PCR in vitro Mutagenesis kit (TAKARA) according to the manufacturers instructions. After all reversions in the fragments were confirmed by sequence analysis, the reversed fragments were ligated into the XhoIXbaI site of pME18S. The COS-7 cells transfected with each of the constructed plasmids were analysed by IFA with MAbs.
|
Immunoblot analysis.
Preparation of antisera against fragments of the capsid protein.
To find the most immunodominant region on the capsid protein, a set of four fragments of ORF2 was expressed as fusion proteins with glutathione S-transferase (GST) using the pGEX bacterial expression system (Pharmacia Biotech). The fragments of ORF2 were designated as follows: BF (nt 4722076 in ORF2, mature capsid protein), B (nt 4721257, aa 158419), CDE (nt 12581668, aa 420556) and F (nt 16692076, aa 557692). Construction of expression plasmids was performed as described previously (Tohya et al., 1999
; Matsuura et al., 2000
). The fragments were amplified by PCR using pDCV-II as template and sense and antisense primers that corresponded or were complementary to sequences of CaCV ORF2. Pairs of used primers, to which a restriction enzyme site (EcoRI or XhoI) was added, were as follows: (i) for BF, sense primer CaCV ORF2-B (5' AGATTCTCCGATAGTTCACACCCGCCTGA 3') and antisense primer CaCV ORF2-FR (5' ATGCTCGAGTCATAGTGTTGTAGCGCTACC 3'); (ii) for B, CaCV ORF2-B and CaCV ORF2-BR (5' ATTACTCGAGGGACCAGCCAAAGGTCTGT 3'); (iii) for CDE, CaCV ORF2-CDE (5' GCGAATTCCGACCAGTACACAAGGGTATTG 3') and CaCV ORF2-CDER (5' CAACTCGAGAGCGCTTTGTTCCTTCGCTAT 3'); (iv) for F, CaCV ORF2-F (5' TAGAATTCGGAGGAGCTCCCATTGGA 3') and CaCV ORF2-FR. Amplified DNA products were digested with EcoRI and XhoI and ligated into the vector pGEX-5X-1 in-frame with the GST gene. Expression in Escherichia coli, purification by SDSPAGE of the fusion proteins and inoculation to ddy mice were performed as described previously (Tohya et al., 1999
). Obtained sera were inactivated for 30 min at 56 °C and stored at -20 °C until experiments.
| Results |
|---|
|
|
|---|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The mapping study of neutralizing epitopes recognized by the MAbs was performed using antigenic variants of CaCV. Cross-neutralization tests using the variants and the IFA reactivities of MAbs to variant ORF2 products suggested that there were at least two functionally independent epitopes on CaCV. No apparent deletion in the variant ORF2s was shown by immunoblot analysis, suggesting that amino acid substitutions in the capsid conferred resistance directly, by affecting the binding of antibody to the antigen. The IFA reactivities of LD8 and 27G2 with the revertant ORF2 products indicated the mutations at amino acid positions 477 and 517 (Thr to Lys and Gly to Asp) in the E region of the capsid protein disrupted the conformational neutralizing epitopes (Table 5
and Fig. 3
).
|
In FCV studies, the 5' HVR of region E seemed to be significant as a major antigenic determinant and as an important target for neutralizing antibodies (Guiver et al., 1992
; Milton et al., 1992
; Shin et al., 1993
; Tohya et al., 1997
; Radford et al., 1999
). In MAb mapping experiments on FCV using neutralization-resistant variants (Tohya et al., 1997
), the mutations disrupting each of four linear epitopes located in the 5' HVR of region E (Fig. 3
). The region involved in the formation of the linear neutralizing epitopes was recognized by antibodies developed by FCV-infected cats (Radford et al., 1999
). A region of CaCV capsid protein that approximates to the 5' HVR of FCV appeared to be missing in CaCV (Fig. 3
), although the extreme variability in this region might make such line-ups difficult. Indeed, the GST fusion polypeptides containing fragments BF and CDE failed to induce neutralizing antibodies in spite of inducing antibodies to the mature capsid protein in immunoblot analysis, suggesting that neutralizing antibodies were only generated when properly folded capsid protein was used as an antigen. In a recent study on FCV, Neill et al. (2000)
reported that the conformational epitopes might play a major role in antigenicity and neutralization. The 3' HVR has been implicated in the formation of at least two conformational epitopes (Tohya et al., 1997
). The position of CaCV Gly517 was mapped in a region corresponding to the 3' HVR of FCV (Fig. 3
). As Thr477 of CaCV was revealed to be involved in the formation of another conformational epitope, each of the 5' and 3' HVR corresponding regions might constitute a conformational antigenic site, playing an important role in neutralization of CaCV. The conformational epitopes on the surface of the CaCV particle seemed to be more significant targets for neutralizing antibodies against CaCV than the linear epitopes, although a panel of MAbs that had neutralizing activity against CaCV may be required to determine the antigenic structure of the virus in more detail.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Guiver, M., Littler, E., Caul, E. O. & Fox, A. J. (1992). The cloning, sequencing and expression of a major antigenic region from the feline calicivirus capsid protein. Journal of General Virology 73, 2429-2433.
Laurent, S., Vautherot, J.-F., Le Gall, G., Madelaine, M.-F. & Rasschaert, D. (1997). Structural, antigenic and immunogenic relationships between European brown hare syndrome virus and rabbit haemorrhagic disease virus. Journal of General Virology 78, 2803-2811.[Abstract]
Matsuura, Y., Tohya, Y., Onuma, M., Roerink, F., Mochizuki, M. & Sugimura, T. (2000). Expression and processing of the canine calicivirus capsid precursor. Journal of General Virology 81, 195-199.
Matthew, W. D. & Sandrock, A. W. (1987). Cyclophosphamide treatment used to manipulate the immune response for the production of monoclonal antibodies. Journal of Immunological Methods 100, 73-82.[Medline]
Milton, I. D., Turner, J., Teelan, A., Gaskell, R., Turner, P. C. & Carter, M. J. (1992). Location of monoclonal antibody binding sites in the capsid protein of feline calicivirus. Journal of General Virology 73, 2435-2439.
Mochizuki, M., Kawanishi, A., Sakamoto, H., Tashiro, S., Fujimoto, R. & Ohwaki, M. (1993). A calicivirus isolated from a dog with fatal diarrhoea. Veterinary Record 132, 221-222.[Medline]
Neill, J. D. (1992). Nucleotide sequence of the capsid protein gene of two serotypes of San Miguel sea lion virus: identification of conserved and non-conserved amino acid sequences among calicivirus capsid proteins. Virus Research 24, 211-222.[Medline]
Neill, J. D., Sosnovtsev, S. V. & Green, K. Y. (2000). Recovery and altered neutralization specificities of chimeric viruses containing capsid protein domain exchanges from antigenically distinct strains of feline calicivirus. Journal of Virology 74, 1079-1084.
Prasad, B. V. V., Matson, D. O. & Smith, A. W. (1994). Three-dimensional structure of calicivirus. Journal of Molecular Biology 240, 256-264.[Medline]
Prasad, B. V. V., Hardy, M. E., Dokland, T., Bella, J., Rossmann, M. G. & Estes, M. K. (1999). X-ray crystallographic structure of the Norwalk virus capsid. Science 286, 287-290.
Priosoeryanto, B. P., Tateyama, S., Yamaguchi, R. & Uchida, K. (1995). Establishment of a cell line (MCM-B2) from a benign mixed tumour of canine mammary gland. Research in Veterinary Science 58, 272-276.[Medline]
Radford, A. D., Willoughby, K., Dawson, S., McCracken, C. & Gaskell, R. M. (1999). The capsid gene of feline calicivirus contains linear B-cell epitopes in both variable and conserved regions. Journal of Virology 73, 8496-8502.
Roerink, F., Hashimoto, M., Tohya, Y. & Mochizuki, M. (1999a). Organization of the canine calicivirus genome from the RNA polymerase gene to the poly(A) tail. Journal of General Virology 80, 929-935.[Abstract]
Roerink, F., Hashimoto, M., Tohya, Y. & Mochizuki, M. (1999b). Genetic analysis of a canine calicivirus: evidence for a new clade of animal caliciviruses. Veterinary Microbiology 69, 69-72.[Medline]
San Gabriel, M. C. S. (1996). Studies on calicivirus isolated from dogs. PhD thesis, The United Graduate School of Veterinary Science, Yamaguchi University, Japan.
San Gabriel, M. C. S., Tohya, Y., Sugimura, T., Shimizu, T., Ishiguro, S. & Mochizuki, M. (1997). Identification of canine calicivirus capsid protein and its immunoreactivity in western blotting. Journal of Veterinary Medical Science 59, 97-101.[Medline]
Schaffer, F. L., Soergel, M. E., Black, J. W., Skilling, D. E., Smith, A. W. & Cubitt, W. D. (1985). Characterization of a new calicivirus isolated from feces of a dog. Archives of Virology 84, 181-195.[Medline]
Seal, B. S., Ridpath, J. F. & Mengeling, W. L. (1993). Analysis of feline calicivirus capsid protein genes: identification of variable antigenic determinant regions of the protein. Journal of General Virology 74, 2519-2524.
Seed, B. & Aruffo, A. (1987). Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proceedings of the National Academy of Sciences, USA 84, 3365-3369.
Shin, Y.-S., Tohya, Y., Oshikamo, R., Kawaguchi, Y., Tomonaga, K., Miyazawa, T., Kai, C. & Mikami, T. (1993). Antigenic analysis of feline calicivirus capsid precursor protein and its deleted polypeptides produced in a mammalian cDNA expression system. Virus Research 30, 17-26.[Medline]
Smith, D. B. & Inglis, S. C. (1987). The mutation rate and variability of eukaryotic viruses: an analytical review. Journal of General Virology 68, 2729-2740.
Sosnovtsev, S. V., Sosnovtseva, S. A. & Green, K. Y. (1998). Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. Journal of Virology 72, 3051-3059.
Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M. & Arai, N. (1988). SR
promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecular and Cellular Biology 8, 466-472.
Thouvenin, E., Laurent, S., Madelaine, M.-F., Rasschaert, D., Vautherot, J.-F. & Hewat, E. A. (1997). Bivalent binding of a neutralising antibody to a calicivirus involves the torsional flexibility of the antibody hinge. Journal of Molecular Biology 270, 238-246.[Medline]
Tohya, Y., Taniguchi, Y., Tsubakimoto, M., Takahashi, E. & Mikami, T. (1990). Preparation and characterization of neutralizing monoclonal antibodies to feline calicivirus. Japanese Journal of Veterinary Science 52, 251-256.
Tohya, Y., Masuoka, K., Takahashi, E. & Mikami, T. (1991). Neutralizing epitopes of feline calicivirus. Archives of Virology 117, 173-181.[Medline]
Tohya, Y., Yokoyama, N., Maeda, K., Kawaguchi, Y. & Mikami, T. (1997). Mapping of antigenic sites involved in neutralization on the capsid protein of feline calicivirus. Journal of General Virology 78, 303-305.[Abstract]
Tohya, Y., Shinchi, H., Matsuura, Y., Maeda, K., Ishiguro, S., Mochizuki, M. & Sugimura, T. (1999). Analysis of the N-terminal polypeptide of the capsid precursor protein and the ORF3 product of feline calicivirus. Journal of Veterinary Medical Science 61, 1043-1047.[Medline]
Weiland, E., Thiel, H.-J., Hess, G. & Weiland, F. (1989). Development of monoclonal neutralizing antibodies against bovine viral diarrhea virus after pretreatment of mice with normal bovine cells and cyclophosphamide. Journal of Virological Methods 24, 237-244.[Medline]
Wieczorek-Krohmer, M., Weiland, F., Conzelmann, K., Kohl, D., Visser, N., van Woensel, P., Thiel, H.-J. & Weiland, E. (1996). Porcine reproductive and respiratory syndrome virus (PRRSV): monoclonal antibodies detect common epitopes on two viral proteins of European and US isolates. Veterinary Microbiology 51, 257-266.[Medline]
Received 24 November 2001;
accepted 23 February 2001.
This article has been cited by other articles:
![]() |
V. Martella, N. Decaro, E. Lorusso, A. Radogna, P. Moschidou, F. Amorisco, M. S. Lucente, C. Desario, V. Mari, G. Elia, et al. Genetic Heterogeneity and Recombination in Canine Noroviruses J. Virol., November 1, 2009; 83(21): 11391 - 11396. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shiota, M. Okame, S. Takanashi, P. Khamrin, M. Takagi, K. Satou, Y. Masuoka, F. Yagyu, Y. Shimizu, H. Kohno, et al. Characterization of a Broadly Reactive Monoclonal Antibody against Norovirus Genogroups I and II: Recognition of a Novel Conformational Epitope J. Virol., November 15, 2007; 81(22): 12298 - 12306. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Siebenga, H. Vennema, B. Renckens, E. de Bruin, B. van der Veer, R. J. Siezen, and M. Koopmans Epochal Evolution of GGII.4 Norovirus Capsid Proteins from 1995 to 2006 J. Virol., September 15, 2007; 81(18): 9932 - 9941. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chen, J. D. Neill, M. K. Estes, and B. V. V. Prasad X-ray structure of a native calicivirus: Structural insights into antigenic diversity and host specificity PNAS, May 23, 2006; 103(21): 8048 - 8053. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. Lochridge, K. L. Jutila, J. W. Graff, and M. E. Hardy Epitopes in the P2 domain of norovirus VP1 recognized by monoclonal antibodies that block cell interactions J. Gen. Virol., October 1, 2005; 86(10): 2799 - 2806. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Parker, N. Kitamoto, T. Tanaka, A. M. Hutson, and M. K. Estes Identification of Genogroup I and Genogroup II Broadly Reactive Epitopes on the Norovirus Capsid J. Virol., June 15, 2005; 79(12): 7402 - 7409. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chen, J. D. Neill, J. S. Noel, A. M. Hutson, R. I. Glass, M. K. Estes, and B. V. V. Prasad Inter- and Intragenus Structural Variations in Caliciviruses and Their Functional Implications J. Virol., June 15, 2004; 78(12): 6469 - 6479. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mochizuki, M. Hashimoto, F. Roerink, Y. Tohya, Y. Matsuura, and N. Sasaki Molecular and Seroepidemiological Evidence of Canine Calicivirus Infections in Japan J. Clin. Microbiol., July 1, 2002; 40(7): 2629 - 2631. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |