J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Agricola
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Journal of General Virology (2001), 82, 1695-1702.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Identification of conformational neutralizing epitopes on the capsid protein of canine calicivirus

Yuichi Matsuura1, Yukinobu Tohya2, Masami Mochizuki3, Kozo Takase1 and Takaaki Sugimura1

Laboratory of Veterinary Microbiology, Department of Veterinary Medicine, Faculty of Agriculture, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan1
Department of Veterinary Microbiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan2
Laboratory of Clinical Microbiology, Kyoritsu Shoji Corporation, 1-12-4 Kudan-Kita, Chiyoda-ku, Tokyo 102-0073, Japan3

Author for correspondence: Yukinobu Tohya. Fax +81 3 5841 8184. e-mail aytohya{at}jvm2.vm.a.u-tokyo.ac.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Two neutralizing monoclonal antibodies (MAbs) against canine calicivirus (CaCV), which has a distinct antigenicity from feline calicivirus (FCV), were obtained. Both MAbs recognized conformational epitopes on the capsid protein of CaCV and were used to identify these epitopes. Neutralization-resistant variants of CaCV were selected in the presence of individual MAbs in a cell culture. Cross-neutralization tests using the variants indicated that the MAbs recognized functionally independent epitopes on the capsid protein. Recombinantly expressed ORF2 products (capsid precursors) of the variants showed no reactivity to the MAbs used for the selection, suggesting that the resistance was induced by a failing in binding of the MAbs to the variant capsid proteins. Several nucleotide changes resulting in amino acid substitutions in the capsid protein were found by sequence analysis. Reactivities of the MAbs to the revertant ORF2 products produced from each variant ORF2 by site-directed mutagenesis identified a single amino acid substitution in each variant capsid protein responsible for the failure of MAb binding. The amino acid residues related to forming the conformational neutralizing epitopes were located in regions equivalent to the 5' and 3' hypervariable regions of the FCV capsid protein, where antigenic sites were demonstrated in previous studies. The recombinant ORF2 products expressed in bacteria failed to induce neutralizing antibody, suggesting that neutralizing antibodies were only generated when properly folded capsid protein was used as an antigen. In CaCV, the conformational epitopes may play a more important role in neutralization than do linear epitopes.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Canine calicivirus (CaCV) No. 48 strain was isolated from a 2-month-old Japanese domestic dog with fatal diarrhoea (Mochizuki et al., 1993Down ). Characteristics of the No. 48 strain are similar to those of the first strain reported as CaCV (Schaffer et al., 1985Down ). CaCV was shown to have an antigenicity distinct from feline calicivirus (FCV), which belongs to the genus Vesivirus, containing swine vesicular exanthema virus as prototype. Sequence analysis of a region from the RNA polymerase gene to the 3' poly(A) tail of the positive-sense RNA genome of CaCV demonstrated the presence of three open reading frames (ORFs) in its genome (Roerink et al., 1999aDown ). Homology analysis of the RNA polymerase genes of caliciviruses suggested that CaCV No. 48 strain was a new clade in the genus Vesivirus (Roerink et al., 1999bDown ). The second ORF (ORF2) encoded a 75 kDa capsid precursor that was cleaved by a viral proteinase and was processed into the mature 57 kDa capsid protein (Matsuura et al., 2000Down ).

Capsid precursors of caliciviruses can be divided into six regions, designated as A to F (Neill, 1992Down ). As shown in Fig. 1Down, in both FCV and CaCV, the A regions are cleaved by the proteinase encoded in ORF1 of FCV (Sosnovtsev et al., 1998Down ; Matsuura et al., 2000Down ). The A regions were identified as a 14 kDa polypeptide in the FCV-infected cells (Tohya et al., 1999Down ), and as a 22 kDa polypeptide in CaCV (Matsuura et al., 2000Down ). The B regions contain sequences that are highly conserved among all the caliciviruses (Neill, 1992Down ; Roerink et al., 1999aDown ). In CaCV, little is known about regions C to F. However, the C and E regions of FCV have been proposed to contain antigenic determinants (Milton et al., 1992Down ; Guiver et al., 1992Down ; Shin et al., 1993Down ). The E region of FCV is further divided into 5' and 3' hypervariable regions (HVRs) separated by a conserved central domain (Seal et al., 1993Down ; Geissler et al., 1997Down ; Radford et al., 1999Down ). The D and F regions are moderately conserved among caliciviruses. The F region is thought to be at least partially exposed on the surface of the virion (Milton et al., 1992Down ).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Diagram of CaCV and FCV capsid precursors encoded in ORF2. (a) Region A of CaCV (nt 1–471, aa 1–157) was cleaved from the capsid precursor (Matsuura et al., 2000Down ). The matured capsid protein consists of the B–F region (nt 472–2076 in ORF2, aa 158–692). The B region (nt 472–1257, aa 158–419) was the most highly conserved among caliciviruses (Roerink et al., 1999a). (b) The FCV capsid protein has been divided into regions B to F (Neill, 1992Down ). The E region contains 5' and 3' HVRs (Seal et al., 1993Down ; Geissler et al., 1997Down ; Radford et al., 1999Down ).

 
Monoclonal antibodies (MAbs) are useful for analysing antigenic properties of viruses. In previous studies on FCV, the MAb mapping experiments by Tohya et al. (1991)Down demonstrated the presence of seven neutralizing epitopes on the FCV capsid. The sequence analysis of MAb neutralization-resistant variants indicated four linear epitopes localized in the 5' HVR and two conformational ones in the 3' HVR (Tohya et al., 1997Down ). Although little is known about neutralizing epitopes on the CaCV capsid protein, San Gabriel (1996)Down succeeded in producing a neutralizing MAb (LD8) against CaCV No. 48 strain. It has been difficult to establish more MAbs against CaCV because of a high incidence of false positives and the presence of antibodies against cellular constituents in contaminated purified CaCV preparations. In this study, to eliminate such undesired antibodies against foreign constituents, the mice were immunized after induction of tolerance against cytoplasmic antigens. Neutralizing MAbs against the No. 48 strain of CaCV were used for the selection of neutralization-resistant variants. Based on sequence analysis of the variant ORF2s, we attempted to map neutralizing epitopes on the CaCV capsid protein.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Virus and cells.
CaCV No. 48 strain was propagated in Miyazaki University canine mammary gland mixed tumour (MCM-B2) cells (Priosoeryanto et al., 1995Down ) and stored at -80 °C until needed. CaCV-infected cells for indirect fluorescent antibody assay (IFA) and immunoblot analysis were prepared from cells incubated at 37 °C for 4 h after infection. CaCV purification was performed as previously described (San Gabriel et al., 1997Down ).

{blacksquare} Production of MAbs against CaCV.
To diminish undesired antibodies against antigens from the canine cells, which were present even in the purified virus preparation, immunotolerance against uninfected cells was induced in BALB/c mice according to the methods described previously (Matthew & Sandrock, 1987Down ; Weiland et al., 1989Down ; Wieczorek-Krohmer et al., 1996Down ). Three weeks after the last immunotolerizing treatment, the first immunization with the purified CaCV was administered, followed by the second immunization 2 weeks later. Using IFA with the CaCV-infected MCM-B2 cells, antiviral antibodies were evaluated in sera collected 15 days after the second immunization. Seropositive mice, which showed a high titre of antibodies against CaCV, were inoculated with the purified CaCV by the intravenous route as the third immunization. Three days after the third immunization, spleen cells of the mice were taken out and fused with P3U1 myeloma cells (Tohya et al., 1990Down ). Hybridomas secreting antibodies against CaCV were detected by IFA and a neutralization test against 100 TCID50 of CaCV. Cultures producing virus-specific antibodies were subcloned by limiting dilution, followed by recloning and preparation of ascitic fluid. Immunoglobulin subtypes of the MAbs were determined by a MAb typing kit for mouse tissue culture supernatants (The Binding Site).

{blacksquare} IFA with the products expressed from CaCV ORF2.
The CaCV ORF2 expression plasmid (pDCV-II) constructed as described previously (Matsuura et al., 2000Down ) was transfected into COS-7 cells according to the previously described method with minor modifications (Seed & Aruffo, 1987Down ; Shin et al., 1993Down ). The transfected COS-7 cells were smeared on glass slides, air-dried and then fixed in acetone. The fixed cells were reacted with the MAbs and then stained with anti-mouse IgG sheep antibody conjugated with fluorescein isothiocyanate. The cells were mounted in buffered glycerol and examined by fluorescence microscopy.

{blacksquare} Isolation of neutralization-resistant variants.
Neutralization-resistant variants of CaCV No. 48 were selected by the methods described for FCV (Tohya et al., 1990Down ). CaCV No. 48 was allowed to react with ascitic fluids for 1 h at 37 °C and appropriate dilutions of the mixture were inoculated onto monolayers of MCM-B2 cells. Following incubation at 37 °C for 90 min, the cells were overlaid with 0·8% agar medium containing ascitic fluids. After incubation at 37 °C for 2 days, the monolayers were stained with 0·01% neutral red in agar overlay medium. Variant plaques were picked up and subjected to two more cycles of selection. Frequencies of variants resistant to neutralization by the MAbs in cloned virus stocks were measured as previously described (Smith & Inglis, 1987Down ; Tohya et al., 1997Down ). Neutralization-resistant variants were designated ‘res’ followed by the name of the neutralizing MAbs.

{blacksquare} Cross-neutralization test with the variants.
The cross-neutralization test was performed according to the microneutralization test procedure (San Gabriel et al., 1997Down ). Briefly, the ascitic fluids of MAbs, and anti-CaCV serum obtained from hyperimmunized mice, were serially twofold-diluted with Dulbecco’s modified Eagle medium containing nutrient mixture F-12 (Life Technologies) with 1% foetal bovine serum. Twenty-five µl of each diluted ascitic fluid or serum was dispensed in each well of a 96-well plate. A dose of 100 TCID50 variants or parental virus as challenge virus in 25 µl was then added to each well. After 1 h incubation at 37 °C with occasional shaking, 50 µl of MCM-B2 cell suspension (2x106 cells/ml) was added. The plates were then observed at 48 and 72 h after infection. Neutralization titres of ascitic fluids and the serum against CaCV were expressed as the reciprocal of 50% neutralization end-point dilution.

{blacksquare} Construction and transient expression of variant ORF2 expression plasmids.
RNA was extracted from MCM-B2 cells infected with each of the variants using an RNA micro-isolation Spin Cartridge system (Life Technologies). Each variant ORF2 was amplified with RT–PCR as previously described (Matsuura et al., 2000Down ). The amplified fragments were cloned into the XhoI–XbaI site of the pME18S expression vector driven by the SR{alpha} promoter (Takebe et al., 1988Down ). The constructed plasmids were transfected into COS-7 cells according to the methods described above. The transfected cells were analysed by IFA with MAbs.

{blacksquare} Sequence analysis for detection of mutations in the variant ORF2s.
For each of the variants, two clones obtained from separate PCR experiments were sequenced. Sequencing was carried out using a BigDye Terminator Cycle Sequencing FS Ready Reaction kit (PE/Applied Biosystems) and analysed on an ABI PRISM 310 Genetic Analyser. Sequencing of the ORF2s was completed using primers derived from the sequence of parental CaCV ORF2 (Roerink et al., 1999aDown ). Amino acid translation was carried out using GENETYX-MAC version 8.0b. Detection of mutations in the variant ORF2s was carried out using CLUSTAL W, accessed through DDJB via the web. In this paper, amino acid position 1 of the CaCV ORF2 product is the start methionine. Nucleotide position 1 corresponds to nt 1086 in the nucleotide sequence deposited in GenBank (accession no. AF053720).

{blacksquare} Alignment of the deduced amino acids of CaCV with FCV and San Miguel sea lion virus (SMSV) strains.
The deduced amino acid sequences of ORF2 products have been submitted to GenBank and assigned the following accession numbers: D90357 (FCV F4), L40021 (FCV Urbana), U13992 (FCV CFI/68), Z11536 (FCV F9), M87482 (SMSV4), U52005 (SMSV17), U15301 (SMSV1). The alignment of the deduced amino acid of CaCV ORF2 product with that of FCV/SMSV was carried out as described above. The E region of the CaCV capsid protein was considered to be the region corresponding to the E region of FCV/SMSV, based on the alignment of CaCV with the FCV/SMSV capsid protein.

{blacksquare} Construction of revertant ORF2 expression plasmids by site-directed mutagenesis.
In order to confirm the amino acid residues related to forming the epitopes of the MAbs, nucleotide sequences of mutated amino acids of the variants were reverted to those of the parental virus by site-directed mutagenesis. Initially, the BamHI fragment containing the ORF2 of a variant was excised from the variant ORF2 expression plasmid and ligated into pBluescript II KS(+) (Stratagene). The reversion of amino acid position 442 (Gly442) (GTA to ATA for Asp) and the reversion of Lys477 (AAA to ACA for Thr) in the capsid precursor of resLD8, and the Arg478 reversion (CGA to CAA for Gln) and the Asp517 reversion (GAT to GGT for Gly) of res27G2 were introduced into the fragments with the use of synthetic oligonucleotides (Table 1Down) and the TaKaRa LA PCR in vitro Mutagenesis kit (TAKARA) according to the manufacturer’s instructions. After all reversions in the fragments were confirmed by sequence analysis, the reversed fragments were ligated into the XhoI–XbaI site of pME18S. The COS-7 cells transfected with each of the constructed plasmids were analysed by IFA with MAbs.


View this table:
[in this window]
[in a new window]
 
Table 1. PCR oligonucleotide primer sequences for site-directed mutagenesis

 
{blacksquare} Immunoblot analysis.
Cells transfected with ORF2 expression plasmids, CaCV-infected cells and purified CaCV were separated by 10% SDS–PAGE and electro-transferred onto a polyvinylidene difluoride filter (San Gabriel et al., 1997Down ). The transferred proteins were reacted with the MAbs and serum monospecific to the CaCV capsid protein (Matsuura et al., 2000Down ). Bound antibodies were detected with peroxidase-conjugated goat anti-mouse immunoglobulins. The bands were visualized with 3,3’-diaminobenzidine tetrahydrochloride in the presence of hydrogen peroxide.

{blacksquare} Preparation of antisera against fragments of the capsid protein.
To find the most immunodominant region on the capsid protein, a set of four fragments of ORF2 was expressed as fusion proteins with glutathione S-transferase (GST) using the pGEX bacterial expression system (Pharmacia Biotech). The fragments of ORF2 were designated as follows: BF (nt 472–2076 in ORF2, mature capsid protein), B (nt 472–1257, aa 158–419), CDE (nt 1258–1668, aa 420–556) and F (nt 1669–2076, aa 557–692). Construction of expression plasmids was performed as described previously (Tohya et al., 1999Down ; Matsuura et al., 2000Down ). The fragments were amplified by PCR using pDCV-II as template and sense and antisense primers that corresponded or were complementary to sequences of CaCV ORF2. Pairs of used primers, to which a restriction enzyme site (EcoRI or XhoI) was added, were as follows: (i) for BF, sense primer CaCV ORF2-B (5' AGATTCTCCGATAGTTCACACCCGCCTGA 3') and antisense primer CaCV ORF2-FR (5' ATGCTCGAGTCATAGTGTTGTAGCGCTACC 3'); (ii) for B, CaCV ORF2-B and CaCV ORF2-BR (5' ATTACTCGAGGGACCAGCCAAAGGTCTGT 3'); (iii) for CDE, CaCV ORF2-CDE (5' GCGAATTCCGACCAGTACACAAGGGTATTG 3') and CaCV ORF2-CDER (5' CAACTCGAGAGCGCTTTGTTCCTTCGCTAT 3'); (iv) for F, CaCV ORF2-F (5' TAGAATTCGGAGGAGCTCCCATTGGA 3') and CaCV ORF2-FR. Amplified DNA products were digested with EcoRI and XhoI and ligated into the vector pGEX-5X-1 in-frame with the GST gene. Expression in Escherichia coli, purification by SDS–PAGE of the fusion proteins and inoculation to ddy mice were performed as described previously (Tohya et al., 1999Down ). Obtained sera were inactivated for 30 min at 56 °C and stored at -20 °C until experiments.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Production and characterization of MAbs
Fusion of spleen cells from the mice was carried out five times. Several lines of hybridomas producing MAbs against CaCV were obtained from the fusions. However, as the result of recloning, only two lines stably produced MAbs with specific reactivity to CaCV in IFA. As one of the MAbs had neutralizing activity, this one was selected for this study and was designated as 27G2. Finally, two neutralizing MAbs, LD8 (San Gabriel, 1996Down ) and 27G2 were used in this study and characterized. LD8 and 27G2 belong to IgG2b and 2a subclasses, respectively. As shown in Table 2Down, both the MAbs showed positive reactivities with the ORF2 product in COS-7 cells transfected with pDCV-II in IFA, although no protein recognized by the MAbs was detected by immunoblot analysis using infected cells or purified CaCV. These results indicated that the MAbs recognized neutralizing epitopes with a conformational nature on the capsid protein.


View this table:
[in this window]
[in a new window]
 
Table 2. Characterization of MAbs against CaCV

 
Isolation of neutralization-resistant variants and their reactivities with the MAbs
For the purpose of analysing the epitopes of the neutralizing MAbs on the CaCV capsid protein, selection of neutralization-resistant variants of CaCV was attempted using LD8 and 27G2. The frequencies of resLD8 and res27G2 were 10-3·74 and 10-6·72, respectively. This result indicated that the neutralizing epitope for LD8 might be more variable than that for 27G2. The variants were equally neutralized by the anti-CaCV serum (Table 3Down), suggesting that their mutations did not have a profound effect on their overall antigenicity. Each variant was resistant to neutralization by the homologous MAb used for its selection but not by the heterologous one (Table 3Down). IFA using cells infected with each variant showed that variant-infected cells did not bind the homologous MAb (data not shown). Further IFA on COS-7 cells transfected with variant ORF2 expression plasmids was tried with MAbs. The expressed products of the variant ORF2s were not detected with the homologous MAb although the ORF2 products were confirmed to be expressed in COS-7 cells by IFA using anti-CaCV serum and the heterologous MAbs (Table 3Down). Based on the reactivity pattern of IFA and neutralization between variants and MAbs, the neutralizing resistance was thought to be induced by a failure to bind MAbs. The resistant ORF2 products were detected as a 75 kDa capsid precursor by immunoblot analysis using the serum against CaCV capsid protein (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 3. Neutralizing and immunofluorescence reactivities of MAbs with variants

 
Sequence analysis for detection of mutation in the variant ORF2s
In the previous study on neutralizing epitopes of FCV, a single point mutation was found in one of the HVRs on the capsid protein of each variant resistant to a MAb neutralizing FCV (Tohya et al., 1997Down ). The altered nucleotide was expected to be capable of determining resistance to the neutralizing MAb. Sequence analysis of the ORF2 encoding the capsid precursor of CaCV variants indicated that two or three nucleotide changes resulting in amino acid substitutions were present in each ORF2 of the variants (Table 4Down). The amino acid substitutions of resLD8 were located at positions 442 (D to G; Asp to Gly) and 477 (T to K; Thr to Lys) on the capsid precursor. Those of res27G2 were located at positions 442 (D to G), 478 (Q to R; Gln to Arg) and 517 (G to D; Gly to Asp). At the other positions, no amino acid change was observed in the sequences of the two clones obtained from separate PCR experiments for each of the variants.


View this table:
[in this window]
[in a new window]
 
Table 4. Changes in nucleotide and deduced amino acid sequences of resistant variants

 
Reactivities of the MAbs with revertant ORF2 products in IFA
In order to identify the location of substitutions capable of conferring resistance of the variants, ORF2 expression plasmids with amino acid reversions were constructed by site-directed mutagenesis. IFA using COS-7 cells transfected with the revertant ORF2 expression plasmids was performed. As shown in Table 5Down), the ORF2 expression product of the Lys477 revertant of resLD8 had reactivity with LD8 in IFA, but the Gly442 revertant had no reactivity. In res27G2, the product of the Asp517 revertant recovered reactivity with 27G2, but the Arg478 revertant product did not. The mutations at positions 442 and 478 may have been spontaneous mutations of the single-strand RNA virus and not responsible for the antigenic characteristics of the virus.


View this table:
[in this window]
[in a new window]
 
Table 5. Reactivity pattern of MAbs with revertants

 
Reactivities of the sera against GST fusion proteins with fragments of the capsid protein
Production of fusion proteins with fragments of the CaCV capsid protein was analysed by Coomassie blue staining after 10% SDS–PAGE. The level of expression was high in every case. All sera obtained from immunized mice, except serum against the GST–F fusion protein, showed strong reactivity with the 57 kDa capsid protein in the CaCV-infected cells by immunoblot analysis (Fig. 2Down). However, no virus-neutralizing activity was observed in neutralization tests against 100 TCID50 of CaCV using any of the sera. The anti-GST serum prepared as a control showed no reactivity with the viral proteins in the infected cells and no neutralizing activity.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 2. Reactivity of the different sera with the mature capsid protein in CaCV-infected cells by immunoblot analysis. Infected cells were solubilized and electrophoresed in a 10% SDS–polyacrylamide gel. The resolved proteins were electro-transferred onto a membrane and then the membrane was cut into strips. Strips were incubated with 1:500 dilution of sera (anti-B, -CDE, -F and -BF) which were raised against the defined parts of the capsid protein expressed as GST fusion protein in bacteria. The sera monospecific to CaCV capsid protein (anti-capsid) and to GST (anti-GST) were prepared as described previously (Tohya et al., 1999Down ; Matsuura et al., 2000Down ).

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In the previous preparation of MAbs using ELISA as the screening method, MAbs from most of the hybridomas reacted against cellular components contained in the purified virus preparation (San Gabriel, 1996Down ). Schaffer et al. (1985)Down reported that CaCV virions were strongly cell-associated and difficult to purify completely. In this study, the induction of tolerance against cellular components results in a low background reactivity of antibodies in the screening of hybridomas. This attempt seemed useful for the production of MAb against the CaCV virion. However, the number of established MAbs in this experiment was two and only one of them showed neutralizing activity. It is likely that screening methods might need to be more sensitive in order to obtain a panel of MAbs against CaCV.

The mapping study of neutralizing epitopes recognized by the MAbs was performed using antigenic variants of CaCV. Cross-neutralization tests using the variants and the IFA reactivities of MAbs to variant ORF2 products suggested that there were at least two functionally independent epitopes on CaCV. No apparent deletion in the variant ORF2s was shown by immunoblot analysis, suggesting that amino acid substitutions in the capsid conferred resistance directly, by affecting the binding of antibody to the antigen. The IFA reactivities of LD8 and 27G2 with the revertant ORF2 products indicated the mutations at amino acid positions 477 and 517 (Thr to Lys and Gly to Asp) in the E region of the capsid protein disrupted the conformational neutralizing epitopes (Table 5Up and Fig. 3Down).



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 3. Alignment of predicted amino acid sequences of the E region in the capsid precursor of vesiviruses. 5' and 3' HVRs of FCV in region E are separated by a central conserved domain. Arrowheads (amino acid positions 441, 448, 449 and 455 in the capsid precursor of FCV F4) and asterisks (amino acid positions 493 and 494) indicate sites of mutations that disrupt linear and conformational neutralizing epitopes, respectively, in FCV F4 (Tohya et al., 1997Down ). The amino acid residues identified as the mutations responsible for resistance to the conformational neutralizing MAb against CaCV are indicated by arrows.

 
The MAbs against rabbit haemorrhagic disease virus that displayed neutralizing activity in an in vivo test were found to recognize epitopes localized on the surface arch of the virus-like particles (Thouvenin et al., 1997Down ; Laurent et al., 1997Down ). In the structural studies on the primate calicivirus (Pan-1) and Norwalk virus (NV), the protruding (P) domain localized on the C-terminal half of the capsid protein was suggested to form the protruding arches of the virion (Prasad et al., 1994Down , 1999Down ). The P2 subdomain containing a highly variable region was the most exposed region in the three-dimensional structure of NV (Prasad et al., 1999Down ). These findings suggested that the E region of CaCV, shown to be involved in the formation of neutralizing epitopes in this study, might be consistent with the P2 subdomain and be located on the surface of the CaCV particle, although the three-dimensional structure of CaCV has not been analysed.

In FCV studies, the 5' HVR of region E seemed to be significant as a major antigenic determinant and as an important target for neutralizing antibodies (Guiver et al., 1992Down ; Milton et al., 1992Down ; Shin et al., 1993Down ; Tohya et al., 1997Down ; Radford et al., 1999Down ). In MAb mapping experiments on FCV using neutralization-resistant variants (Tohya et al., 1997Down ), the mutations disrupting each of four linear epitopes located in the 5' HVR of region E (Fig. 3Up). The region involved in the formation of the linear neutralizing epitopes was recognized by antibodies developed by FCV-infected cats (Radford et al., 1999Down ). A region of CaCV capsid protein that approximates to the 5' HVR of FCV appeared to be missing in CaCV (Fig. 3Up), although the extreme variability in this region might make such line-ups difficult. Indeed, the GST fusion polypeptides containing fragments BF and CDE failed to induce neutralizing antibodies in spite of inducing antibodies to the mature capsid protein in immunoblot analysis, suggesting that neutralizing antibodies were only generated when properly folded capsid protein was used as an antigen. In a recent study on FCV, Neill et al. (2000)Down reported that the conformational epitopes might play a major role in antigenicity and neutralization. The 3' HVR has been implicated in the formation of at least two conformational epitopes (Tohya et al., 1997Down ). The position of CaCV Gly517 was mapped in a region corresponding to the 3' HVR of FCV (Fig. 3Up). As Thr477 of CaCV was revealed to be involved in the formation of another conformational epitope, each of the 5' and 3' HVR corresponding regions might constitute a conformational antigenic site, playing an important role in neutralization of CaCV. The conformational epitopes on the surface of the CaCV particle seemed to be more significant targets for neutralizing antibodies against CaCV than the linear epitopes, although a panel of MAbs that had neutralizing activity against CaCV may be required to determine the antigenic structure of the virus in more detail.


   Acknowledgments
 
This work was supported by grants from Japan Society for the Promotion of Science. The authors thank Dr Frank Roerink of Tsukuba Central Laboratories, Kyoritsu Shoji Corporation for critical reviewing of the manuscript and Dr S. Ohashi, Laboratory of Clinical Virology, Kyushu Research Station, National Institute of Animal Health, for help in preparation of the figures.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Geissler, K., Schneider, K., Platzer, G., Truyen, B., Kaaden, O.-R. & Truyen, U. (1997). Genetic and antigenic heterogeneity among feline calicivirus isolates from distinct disease manifestations. Virus Research 48, 193-206.[Medline]

Guiver, M., Littler, E., Caul, E. O. & Fox, A. J. (1992). The cloning, sequencing and expression of a major antigenic region from the feline calicivirus capsid protein. Journal of General Virology 73, 2429-2433.[Abstract/Free Full Text]

Laurent, S., Vautherot, J.-F., Le Gall, G., Madelaine, M.-F. & Rasschaert, D. (1997). Structural, antigenic and immunogenic relationships between European brown hare syndrome virus and rabbit haemorrhagic disease virus. Journal of General Virology 78, 2803-2811.[Abstract]

Matsuura, Y., Tohya, Y., Onuma, M., Roerink, F., Mochizuki, M. & Sugimura, T. (2000). Expression and processing of the canine calicivirus capsid precursor. Journal of General Virology 81, 195-199.[Abstract/Free Full Text]

Matthew, W. D. & Sandrock, A. W. (1987). Cyclophosphamide treatment used to manipulate the immune response for the production of monoclonal antibodies. Journal of Immunological Methods 100, 73-82.[Medline]

Milton, I. D., Turner, J., Teelan, A., Gaskell, R., Turner, P. C. & Carter, M. J. (1992). Location of monoclonal antibody binding sites in the capsid protein of feline calicivirus. Journal of General Virology 73, 2435-2439.[Abstract/Free Full Text]

Mochizuki, M., Kawanishi, A., Sakamoto, H., Tashiro, S., Fujimoto, R. & Ohwaki, M. (1993). A calicivirus isolated from a dog with fatal diarrhoea. Veterinary Record 132, 221-222.[Medline]

Neill, J. D. (1992). Nucleotide sequence of the capsid protein gene of two serotypes of San Miguel sea lion virus: identification of conserved and non-conserved amino acid sequences among calicivirus capsid proteins. Virus Research 24, 211-222.[Medline]

Neill, J. D., Sosnovtsev, S. V. & Green, K. Y. (2000). Recovery and altered neutralization specificities of chimeric viruses containing capsid protein domain exchanges from antigenically distinct strains of feline calicivirus. Journal of Virology 74, 1079-1084.[Abstract/Free Full Text]

Prasad, B. V. V., Matson, D. O. & Smith, A. W. (1994). Three-dimensional structure of calicivirus. Journal of Molecular Biology 240, 256-264.[Medline]

Prasad, B. V. V., Hardy, M. E., Dokland, T., Bella, J., Rossmann, M. G. & Estes, M. K. (1999). X-ray crystallographic structure of the Norwalk virus capsid. Science 286, 287-290.[Abstract/Free Full Text]

Priosoeryanto, B. P., Tateyama, S., Yamaguchi, R. & Uchida, K. (1995). Establishment of a cell line (MCM-B2) from a benign mixed tumour of canine mammary gland. Research in Veterinary Science 58, 272-276.[Medline]

Radford, A. D., Willoughby, K., Dawson, S., McCracken, C. & Gaskell, R. M. (1999). The capsid gene of feline calicivirus contains linear B-cell epitopes in both variable and conserved regions. Journal of Virology 73, 8496-8502.[Abstract/Free Full Text]

Roerink, F., Hashimoto, M., Tohya, Y. & Mochizuki, M. (1999a). Organization of the canine calicivirus genome from the RNA polymerase gene to the poly(A) tail. Journal of General Virology 80, 929-935.[Abstract]

Roerink, F., Hashimoto, M., Tohya, Y. & Mochizuki, M. (1999b). Genetic analysis of a canine calicivirus: evidence for a new clade of animal caliciviruses. Veterinary Microbiology 69, 69-72.[Medline]

San Gabriel, M. C. S. (1996). Studies on calicivirus isolated from dogs. PhD thesis, The United Graduate School of Veterinary Science, Yamaguchi University, Japan.

San Gabriel, M. C. S., Tohya, Y., Sugimura, T., Shimizu, T., Ishiguro, S. & Mochizuki, M. (1997). Identification of canine calicivirus capsid protein and its immunoreactivity in western blotting. Journal of Veterinary Medical Science 59, 97-101.[Medline]

Schaffer, F. L., Soergel, M. E., Black, J. W., Skilling, D. E., Smith, A. W. & Cubitt, W. D. (1985). Characterization of a new calicivirus isolated from feces of a dog. Archives of Virology 84, 181-195.[Medline]

Seal, B. S., Ridpath, J. F. & Mengeling, W. L. (1993). Analysis of feline calicivirus capsid protein genes: identification of variable antigenic determinant regions of the protein. Journal of General Virology 74, 2519-2524.[Abstract/Free Full Text]

Seed, B. & Aruffo, A. (1987). Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. Proceedings of the National Academy of Sciences, USA 84, 3365-3369.[Abstract/Free Full Text]

Shin, Y.-S., Tohya, Y., Oshikamo, R., Kawaguchi, Y., Tomonaga, K., Miyazawa, T., Kai, C. & Mikami, T. (1993). Antigenic analysis of feline calicivirus capsid precursor protein and its deleted polypeptides produced in a mammalian cDNA expression system. Virus Research 30, 17-26.[Medline]

Smith, D. B. & Inglis, S. C. (1987). The mutation rate and variability of eukaryotic viruses: an analytical review. Journal of General Virology 68, 2729-2740.[Abstract/Free Full Text]

Sosnovtsev, S. V., Sosnovtseva, S. A. & Green, K. Y. (1998). Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. Journal of Virology 72, 3051-3059.[Abstract/Free Full Text]

Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M. & Arai, N. (1988). SR{alpha} promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Molecular and Cellular Biology 8, 466-472.[Abstract/Free Full Text]

Thouvenin, E., Laurent, S., Madelaine, M.-F., Rasschaert, D., Vautherot, J.-F. & Hewat, E. A. (1997). Bivalent binding of a neutralising antibody to a calicivirus involves the torsional flexibility of the antibody hinge. Journal of Molecular Biology 270, 238-246.[Medline]

Tohya, Y., Taniguchi, Y., Tsubakimoto, M., Takahashi, E. & Mikami, T. (1990). Preparation and characterization of neutralizing monoclonal antibodies to feline calicivirus. Japanese Journal of Veterinary Science 52, 251-256.

Tohya, Y., Masuoka, K., Takahashi, E. & Mikami, T. (1991). Neutralizing epitopes of feline calicivirus. Archives of Virology 117, 173-181.[Medline]

Tohya, Y., Yokoyama, N., Maeda, K., Kawaguchi, Y. & Mikami, T. (1997). Mapping of antigenic sites involved in neutralization on the capsid protein of feline calicivirus. Journal of General Virology 78, 303-305.[Abstract]

Tohya, Y., Shinchi, H., Matsuura, Y., Maeda, K., Ishiguro, S., Mochizuki, M. & Sugimura, T. (1999). Analysis of the N-terminal polypeptide of the capsid precursor protein and the ORF3 product of feline calicivirus. Journal of Veterinary Medical Science 61, 1043-1047.[Medline]

Weiland, E., Thiel, H.-J., Hess, G. & Weiland, F. (1989). Development of monoclonal neutralizing antibodies against bovine viral diarrhea virus after pretreatment of mice with normal bovine cells and cyclophosphamide. Journal of Virological Methods 24, 237-244.[Medline]

Wieczorek-Krohmer, M., Weiland, F., Conzelmann, K., Kohl, D., Visser, N., van Woensel, P., Thiel, H.-J. & Weiland, E. (1996). Porcine reproductive and respiratory syndrome virus (PRRSV): monoclonal antibodies detect common epitopes on two viral proteins of European and US isolates. Veterinary Microbiology 51, 257-266.[Medline]

Received 24 November 2001; accepted 23 February 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
T. Shiota, M. Okame, S. Takanashi, P. Khamrin, M. Takagi, K. Satou, Y. Masuoka, F. Yagyu, Y. Shimizu, H. Kohno, et al.
Characterization of a Broadly Reactive Monoclonal Antibody against Norovirus Genogroups I and II: Recognition of a Novel Conformational Epitope
J. Virol., November 15, 2007; 81(22): 12298 - 12306.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. J. Siebenga, H. Vennema, B. Renckens, E. de Bruin, B. van der Veer, R. J. Siezen, and M. Koopmans
Epochal Evolution of GGII.4 Norovirus Capsid Proteins from 1995 to 2006
J. Virol., September 15, 2007; 81(18): 9932 - 9941.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Chen, J. D. Neill, M. K. Estes, and B. V. V. Prasad
X-ray structure of a native calicivirus: Structural insights into antigenic diversity and host specificity
PNAS, May 23, 2006; 103(21): 8048 - 8053.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. P. Lochridge, K. L. Jutila, J. W. Graff, and M. E. Hardy
Epitopes in the P2 domain of norovirus VP1 recognized by monoclonal antibodies that block cell interactions
J. Gen. Virol., October 1, 2005; 86(10): 2799 - 2806.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. D. Parker, N. Kitamoto, T. Tanaka, A. M. Hutson, and M. K. Estes
Identification of Genogroup I and Genogroup II Broadly Reactive Epitopes on the Norovirus Capsid
J. Virol., June 15, 2005; 79(12): 7402 - 7409.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Chen, J. D. Neill, J. S. Noel, A. M. Hutson, R. I. Glass, M. K. Estes, and B. V. V. Prasad
Inter- and Intragenus Structural Variations in Caliciviruses and Their Functional Implications
J. Virol., June 15, 2004; 78(12): 6469 - 6479.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
M. Mochizuki, M. Hashimoto, F. Roerink, Y. Tohya, Y. Matsuura, and N. Sasaki
Molecular and Seroepidemiological Evidence of Canine Calicivirus Infections in Japan
J. Clin. Microbiol., July 1, 2002; 40(7): 2629 - 2631.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.
Agricola
Right arrow Articles by Matsuura, Y.
Right arrow Articles by Sugimura, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS