|
|
||||||||
Animal: RNA Viruses |
VirginiaMaryland Regional College of Veterinary Medicine, University of Maryland, College Park, MD 20742, USA1
Author for correspondence: Siba Samal. Fax +1 301 935 6079. e-mail ss5{at}umail.umd.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
NDV is a member of the genus Rubulavirus in the family Paramyxoviridae (Rima et al., 1995
). The genome of NDV is a non-segmented, single-stranded, negative-sense RNA of 15186 nucleotides (Krishnamurthy & Samal, 1998
; Phillips et el., 1998
; de Leeuw & Peeters, 1999
). The genomic RNA contains six genes that encode in this order the nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), haemagglutininneuraminidase (HN) and large polymerase protein (L). Two additional proteins, V and W, are produced by RNA editing during P gene transcription (Steward et al., 1993
). NDV follows the same general model for transcription and replication as other non-segmented, negative-strand RNA viruses (Peeples, 1988
; Lamb & Kolakofsky, 1996
; Pringle, 1997
). Like other non-segmented, negative-strand RNA viruses, there is a polar attenuation of transcription such that each downstream gene is transcribed less than its upstream neighbour (Peeples, 1988
; Nagai, 1999
).
The development of reverse-genetic techniques to recover negative-sense viruses from cloned cDNA (Conzelmann, 1996
) provides a means not only to investigate the function of virus proteins and genetic elements (Palese et al., 1996
; Nagai, 1999
) but also to express additional proteins by the insertion of new genes into the viral genome (Bukreyev et al., 1996
; Mebatsion et al., 1996
; Schnell et al., 1996
; Hasan et al., 1997
; He et al., 1997
). This provides a new method to generate improved vaccines and vaccine vectors. For NDV, reverse-genetic technology is currently available for avirulent strain LaSota (Römer-Oberdörfer et al., 1999
; Peeters et al., 1999
) and virulent strain Beaudette C (Krishnamurthy et al., 2000
).
Previously, we reported that virulent NDV strain Beaudette C could be used as an expression vector (Krishnamurthy et al., 2000
). This was achieved by introducing an extra transcription unit between the HN and L genes. Our previous results showed that expression of the foreign gene resulted in growth retardation and attenuation of the recombinant virus. Although these results indicated that recombinant NDV could be used as a vaccine vector, they raised concerns about the level of expression of the foreign gene and growth retardation of the avirulent vaccine strain after insertion of the foreign gene. In this report, we have addressed these concerns in studies of an avirulent NDV recombinant expressing a foreign gene. Here, we have recovered an avirulent NDV strain LaSota from cDNA and have inserted a foreign gene into a more upstream position, close to the 3' end of the NDV genome. The recovered recombinant NDV allowed robust expression of the foreign gene due to polar gradient transcription. Moreover, the replication of the recombinant NDV expressing the foreign gene in cell culture and in vivo was not retarded. These results suggest that avirulent NDV recombinants expressing heterologous proteins could be used as multivalent vaccines.
| Methods |
|---|
|
|
|---|
Assembly of the full-length clone of NDV lentogenic strain LaSota and construction of support plasmids.
|
|
Construction of a full-length plasmid containing the chloramphenicol acetyltransferase (CAT) gene.
|
Transfection and recovery of recombinant NDV.
RTPCR and demonstration of genetic marker.
RNA was isolated from recovered virus by using TRIzol reagent. RTPCR was performed with primers P1 (5' TCCCCTGGTATTTATTCCTGC, positions 56095629) and P1R (5' GTTGGCCACCCAGTCCCCGA, negative sense, positions 72867305) to amplify a fragment including the introduced MluI site in the intergenic region between the F and HN genes. Similarly, a fragment containing the SnaBI site within the HNL intergenic region was amplified with primers P2 (5' CGCATACAGCAGGCTATCTTATC, positions 75137535) and P2R (5' GGGTCATATTCTATACATGGC, negative sense, positions 97399759). The RTPCR products were then subjected to restriction enzyme digestion, the first product with MluI, the second with SnaBI. The restriction patterns were analysed by agarose gel electrophoresis. RTPCR was also performed to demonstrate the location of the CAT gene insert in the recombinant NDV expressing the CAT gene.
CAT assay and analysis of the stability of CAT expression.
Chicken embryo fibroblast DF1 cell pellets were lysed by three freezethaw cycles and 1% of the lysed pellet from a 25 cm2 flask was analysed by TLC for the ability to acetylate [14C]chloramphenicol (Amersham Pharmacia). To study the stability of CAT expression by the recombinant virus, a total of 12 serial passages were performed at a passage interval of 4 days. At each passage, 100 µl of the medium supernatant was used for passing to fresh DF1 cells in a 25 cm2 flask. Acetyltrypsin (1 µg/ml) was included in the medium of DF1 cells for cleavage of the F protein of rLaSota and rLaSota/CAT.
Northern blot hybridization.
The protocol for Northern blot hybridization was described previously (Krishnamurthy et al., 2000
). Briefly, RNA was isolated from cells infected with either rLaSota or rLaSota/CAT at an m.o.i. of 1. Total RNA was extracted with TRIzol reagent and poly(A)+ mRNA was selected by using an mRNA isolation kit (Promega). mRNA samples were subjected to electrophoresis on 1·5% agarose gels containing 0·44 M formaldehyde, transferred to nitrocellulose membrane and used for hybridization with [32P]CTP-labelled riboprobes. The negative-sense CAT and NP probes where synthesized by in vitro transcription of linearized plasmids containing these genes.
Determination of the intracerebral pathogenicity index (ICPI) in 1-day-old chicks.
ICPI was used to determine the virulence of wild-type and recombinant NDVs in 1-day-old chicks. For each ICPI test, 15 1-day-old SPF chicks were used (ten birds for test and five birds for control). The inoculum consisted of fresh, infective allantoic fluid with an HA titre >24 (1:16) for the test birds and allantoic fluid from uninfected embryonated chicken eggs for control birds. Both inocula were diluted 1:10 in sterile PBS. Each bird was inoculated intracerebrally with 0·05 ml inoculum. The birds were observed for clinical signs and mortality every 24 h for a period of 8 days. The scoring and determination of ICPI were done according to the method described by Alexander (1997)
.
| Results |
|---|
|
|
|---|
A recombinant vaccinia virus-based transfection system was used to recover recombinant NDV from cDNA. HEp-2 cells were infected with vaccinia virus strain MVA, capable of synthesizing T7 RNA polymerase. Simultaneously, the cells were transfected with plasmids pLaSota, pNP, pP and pL, to provide ribonucleoproteins and allow synthesis of full-length antigenomic RNA. Four h after transfection, the cells were washed twice and the medium was replaced with medium containing acetyltrypsin. After two passages in HEp-2 cells, 100 µl clarified supernatant was inoculated into the allantoic cavity of 10-day-old embryonated chicken eggs. The allantoic fluid was harvested 4 days after inoculation and tested for HA. After two passages in eggs, the virus was plaque-purified to eliminate vaccinia virus. The plaques produced by the virus were stained with monoclonal antibodies specific to the NDV HN protein to confirm the specificity of the recovered virus (Fig. 3
). To identify the recovered virus, two genetic markers (MluI and SnaBI) were introduced in the full-length cDNA clone. In order to verify the presence of these markers, RNA from recovered virus was subjected to RTPCR. DNA fragments encompassing the regions containing the MluI and SnaBI sites were subjected to restriction enzyme digestion with the respective enzymes. Analysis of the restriction enzyme patterns revealed the presence of both genetic markers in rLaSota, as calculated from the sizes of the bands, while RTPCR products from wild-type LaSota were not digested by the enzymes (Fig. 4a
). Nucleotide sequence analysis of RTPCR products also confirmed the presence of the genetic markers.
|
|
Expression of the CAT gene from the virus rLaSota/CAT
To examine the expression of the CAT protein from rLaSota/CAT, cell lysates from 12 passages, beginning with the third, were tested for CAT activity. For rLaSota/CAT, all passages showed similar CAT enzyme activity by CAT assay (data not shown). These results suggested that the inserted CAT gene was stable, at least up to passage 12. In our previous work, an NDVCAT chimeric transcription cassette was inserted between the HN and L genes of the full-length cDNA of virulent NDV strain Beaudette C and infectious CAT-expressing recombinant NDV (rBC/CAT) was recovered (Krisnamurthy et al., 2000
). In order to compare the level of expression of the CAT genes from rLaSota/CAT and rBC/CAT, replicate monolayers of DF1 cells were infected with each virus separately at an m.o.i. of 0·1. Four days after infection, CAT enzyme activities in the cell lysates were examined (Fig. 5
). Our results showed that the CAT enzyme activity was about 11-fold higher in cells infected with rLaSota/CAT than in cells infected with rBC/CAT. To examine the presence of CAT mRNA and the level of synthesis of the immediate downstream NP mRNA, Northern blot hybridization was performed with poly(A)+ RNA from cells infected with rLaSota or rLaSota/CAT, each at passage 6. Hybridization of the mRNA extracted from rLaSota/CAT-infected cells with a negative-sense CAT-specific riboprobe detected a single major band of the size predicted for CAT mRNA (Fig. 6
). Hybridization with a negative-sense riboprobe specific for the NP gene showed a single major band at the size predicted for NP mRNA in both rLaSota and rLaSota/CAT blots. Densitometry scanning did not show a significant difference in the level of NP mRNA synthesis between rLaSota and rLaSota/CAT. This result indicated that insertion of the CAT gene at the most 3'-proximal locus did not affect mRNA synthesis of the immediate downstream NP gene significantly.
|
|
|
| Discussion |
|---|
|
|
|---|
NDV is particularly well suited to the development of a negative-strand RNA virus vector for avian pathogens for several reasons. (i) Live NDV vaccines are widely used in the poultry industry with a proven track record of efficacy and safety (Alexander, 1997
). (ii) NDV grows to high titres and expresses proteins encoded within its genome at high levels; NDV recombinants expressing foreign proteins are therefore likely to grow to high titres and to produce the foreign proteins at high levels. (iii) NDV naturally infects the respiratory tract, leading to the induction of both mucosal and systemic immunity. Thus, NDV would be a suitable vector for antigens of agents infecting the respiratory tract.
In this report, we have constructed a recombinant, attenuated NDV expressing a foreign gene, CAT. The CAT gene was inserted into the NDV antigenomic cDNA in the upstream region of the 3'-proximal NP gene ORF. We deduced that insertion of a new cistron in the first locus would lead to the highest level of foreign gene expression, due to the polarity of transcription (Hasan et al., 1997
; Wertz et al., 1998
). The total length of the recombinant virus genome was maintained as 6n nucleotides to maximize virus replication (Calain & Roux, 1993
; Peeters et al., 2000
). Both recovered viruses (rLaSota and rLaSota/CAT) were viable, with multiple-step growth curves very similar to that of the wild-type NDV strain LaSota. rLaSota/CAT expressed a high level of the CAT protein, and expression of the CAT protein was stable over 12 low-dilution passages. The pathogenesis of the recombinant viruses was not augmented in a natural avian host.
Previous characterization in our laboratory of a virulent NDV recombinant expressing CAT protein had shown a lower level of expression of the CAT gene and growth retardation of the recombinant virus (Krishnamurthy et al., 2000
). In that report, the CAT gene was inserted into a 5' position between the HN and L genes. In this study, it was demonstrated that the level of expression of the CAT gene was much higher when the cistron was inserted in the most 3'-proximal locus, probably due to the polarity of transcription. Furthermore, it was shown that growth of the recombinant virus was not affected significantly when the foreign gene was expressed from the first locus. This result indicated that maintenance of the normal transcriptional gradient of NDV is important for replication of the virus; replication is not disrupted after the foreign gene is expressed from the most 3'-proximal locus but is disrupted after the foreign gene is expressed from an internal locus. Results from this study suggest that high-level expression of the CAT protein from an upstream position did not interfere with NDV replication. However, expression of antigens from other pathogens might interfere with NDV replication; thus, high-level expression of such antigens from a locus upstream of the NP gene might lead to attenuation and even instability of the vector.
The results described here show that it is possible to use attenuated NDV as a vaccine vector to express a foreign gene. Development of recombinant NDV as a vaccine vector has several applications. Based on studies with other non-segmented, negative-strand RNA viruses, it should be possible to insert and express several foreign genes in the same virus and to obtain simultaneous immune responses to the expressed antigens in inoculated animals. For example, a single recombinant NDV could be generated that expressed the immunogenic proteins of multiple avian pathogens. Alternatively, several NDVs, each expressing various heterologous antigens, could be administered as a multivalent vaccine. A further extension would be to use NDV vectors in non-avian species, where NDV is capable of undergoing incomplete replication to the extent necessary to express inserted genes. Thus, development of NDV as a vector should prove to be useful against avian and non-avian diseases for which suitable vaccines are not currently available.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bukreyev, A., Camargo, E. & Collins, P. L. (1996). Recovery of infectious respiratory syncytial virus expressing an additional, foreign gene. Journal of Virology 70, 6634-6641.
Byrappa, S., Gavin, D. K. & Gupta, K. C. (1995). A highly efficient procedure for site-specific mutagenesis of full-length plasmids using Vent DNA polymerase. Genome Research 5, 404-407.
Calain, P. & Roux, L. (1993). The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. Journal of Virology 67, 4822-4830.
Conzelmann, K.-K. (1996). Genetic manipulation of non-segmented negative-strand RNA viruses. Journal of General Virology 77, 381-389.
de Leeuw, O. & Peeters, B. (1999). Complete nucleotide sequence of Newcastle disease virus: evidence for the existence of a new genus within the subfamily Paramyxovirinae. Journal of General Virology 80, 131-136.[Abstract]
Haglund, K., Forman, J., Kräusslich, H. G. & Rose, J. K. (2000). Expression of human immunodeficiency virus type 1 Gag protein precursor and envelope proteins from a vesicular stomatitis virus recombinant: high-level production of virus-like particles containing HIV envelope. Virology 268, 112-121.[Medline]
Hasan, M. K., Kato, A., Shioda, T., Sakai, Y., Yu, D. & Nagai, Y. (1997). Creation of an infectious recombinant Sendai virus expressing the firefly luciferase gene from the 3' proximal first locus. Journal of General Virology 78, 2813-2820.[Abstract]
He, B., Paterson, R. G., Ward, C. D. & Lamb, R. A. (1997). Recovery of infectious SV5 from cloned DNA and expression of a foreign gene. Virology 237, 249-260.[Medline]
Kingsbury, D. W. (1966). Newcastle disease virus. I. Isolation and preliminary characterization of RNA from virus particles. Journal of Molecular Biology 18, 195-203.[Medline]
Krishnamurthy, S. & Samal, S. K. (1998). Nucleotide sequences of the trailer, nucleocapsid protein gene and intergenic regions of Newcastle disease virus strain Beaudette C and completion of the entire genome sequence. Journal of General Virology 79, 2419-2424.[Abstract]
Krishnamurthy, S., Huang, Z. & Samal, S. K. (2000). Recovery of a virulent strain of Newcastle disease virus from cloned cDNA: expression of a foreign gene results in growth retardation and attenuation. Virology 278, 168-182.[Medline]
Lamb, R. A. & Kolakofsky, D. (1996). Paramyxoviridae: the viruses and their replication. In Fields Virology , pp. 1177-1204. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Mebatsion, T., Schnell, M. J., Cox, J. H., Finke, S. & Conzelmann, K. K. (1996). Highly stable expression of a foreign gene from rabies virus vectors. Proceedings of the National Academy of Sciences, USA 93, 7310-7314.
Nagai, Y. (1999). Paramyxovirus replication and pathogenesis. Reverse genetics transforms understanding. Reviews in Medical Virology 9, 83-99.[Medline]
Palese, P., Zheng, H., Engelhardt, O. G., Pleschka, S. & Garcia-Sastre, A. (1996). Negative-strand RNA viruses: genetic engineering and applications. Proceedings of the National Academy of Sciences, USA 93, 11354-11358.
Peeples, M. E. (1988). Newcastle disease virus replication. In Newcastle Disease , pp. 45-78. Edited by D. J. Alexander. Dordrecht:Kluwer Academic.
Peeters, B. P., de Leeuw, O. S., Koch, G. & Gielkens, A. L. (1999). Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence. Journal of Virology 73, 5001-5009.
Peeters, B. P., Gruijthuijsen, Y. K., de Leeuw, O. S. & Gielkens, A. L. (2000). Genome replication of Newcastle disease virus: involvement of the rule-of-six. Archives of Virology 145, 1829-1845.[Medline]
Phillips, R. J., Samson, A. R. & Emmerson, P. T. (1998). Nucleotide sequence of the 5'-terminus of Newcastle disease virus and assembly of the complete genomic sequence: agreement with the rule of six. Archives of Virology 143, 1993-2002.[Medline]
Pringle, C. R. (1997). The order Mononegavirales current status. Archives of Virology 142, 2321-2326.[Medline]
Rima, B., Alexander, D. J., Billeter, M. A., Collins, P. L., Kingsbury, D. W., Lipkind, M. A., Nagai, Y., Örvell, C., Pringle, C. R. & ter Meulen, V. (1995). Family Paramyxoviridae. In Virus Taxonomy. Sixth Report of the International Committee on the Taxonomy of Viruses , pp. 268-274. Edited by F. A. Murphy, C. M. Fauquet, D. H. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York:Springer-Verlag.
Römer-Oberdörfer, A., Mundt, E., Mebatsion, T., Buchholz, U. J. & Mettenleiter, T. C. (1999). Generation of recombinant lentogenic Newcastle disease virus from cDNA. Journal of General Virology 80, 2987-2995.
Sakai, Y., Kiyotani, K., Fukumura, M., Asakawa, M., Kato, A., Shioda, T., Yoshida, T., Tanaka, A., Hasegawa, M. & Nagai, Y. (1999). Accommodation of foreign genes into the Sendai virus genome: sizes of inserted genes and viral replication. FEBS Letters 456, 221-226.[Medline]
Schnell, M. J., Buonocore, L., Whitt, M. A. & Rose, J. K. (1996). The minimal conserved transcription stopstart signal promotes stable expression of a foreign gene in vesicular stomatitis virus. Journal of Virology 70, 2318-2323.
Steward, M., Vipond, I. B., Millar, N. S. & Emmerson, P. T. (1993). RNA editing in Newcastle disease virus. Journal of General Virology 74, 2539-2547.
Wertz, G. W., Perepelitsa, V. P. & Ball, L. A. (1998). Gene rearrangement attenuates expression and lethality of a nonsegmented negative strand RNA virus. Proceedings of the National Academy of Sciences, USA 95, 3501-3506.
Received 21 December 2000;
accepted 13 March 2001.
This article has been cited by other articles:
![]() |
B. Nayak, S. Kumar, J. M. DiNapoli, A. Paldurai, D. R. Perez, P. L. Collins, and S. K. Samal Contributions of the Avian Influenza Virus HA, NA, and M2 Surface Proteins to the Induction of Neutralizing Antibodies and Protective Immunity J. Virol., March 1, 2010; 84(5): 2408 - 2420. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Carnero, W. Li, A. V. Borderia, B. Moltedo, T. Moran, and A. Garcia-Sastre Optimization of Human Immunodeficiency Virus Gag Expression by Newcastle Disease Virus Vectors for the Induction of Potent Immune Responses J. Virol., January 15, 2009; 83(2): 584 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N. Rout and S. K. Samal The Large Polymerase Protein Is Associated with the Virulence of Newcastle Disease Virus J. Virol., August 15, 2008; 82(16): 7828 - 7836. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Elankumaran, D. Rockemann, and S. K. Samal Newcastle Disease Virus Exerts Oncolysis by both Intrinsic and Extrinsic Caspase-Dependent Pathways of Cell Death J. Virol., August 1, 2006; 80(15): 7522 - 7534. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takeda, Y. Nakatsu, S. Ohno, F. Seki, M. Tahara, T. Hashiguchi, and Y. Yanagi Generation of Measles Virus with a Segmented RNA Genome J. Virol., May 1, 2006; 80(9): 4242 - 4248. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bukreyev, Z. Huang, L. Yang, S. Elankumaran, M. St. Claire, B. R. Murphy, S. K. Samal, and P. L. Collins Recombinant Newcastle Disease Virus Expressing a Foreign Viral Antigen Is Attenuated and Highly Immunogenic in Primates J. Virol., November 1, 2005; 79(21): 13275 - 13284. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Huang, S. Elankumaran, A. S. Yunus, and S. K. Samal A Recombinant Newcastle Disease Virus (NDV) Expressing VP2 Protein of Infectious Bursal Disease Virus (IBDV) Protects against NDV and IBDV J. Virol., September 15, 2004; 78(18): 10054 - 10063. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Huang, A. Panda, S. Elankumaran, D. Govindarajan, D. D. Rockemann, and S. K. Samal The Hemagglutinin-Neuraminidase Protein of Newcastle Disease Virus Determines Tropism and Virulence J. Virol., April 15, 2004; 78(8): 4176 - 4184. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao and B. P. H. Peeters Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication J. Gen. Virol., April 1, 2003; 84(4): 781 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakaya, J. Cros, M.-S. Park, Y. Nakaya, H. Zheng, A. Sagrera, E. Villar, A. Garcia-Sastre, and P. Palese Recombinant Newcastle Disease Virus as a Vaccine Vector J. Virol., December 1, 2001; 75(23): 11868 - 11873. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |