|
|
||||||||
Animal: RNA Viruses |
Intervet Norbio, Thormøhlensgate 58, N-5008 Bergen, Norway1
Department of Fisheries and Marine Biology, University of Bergen, Norway2
Intervet International BV, Wim de Körverstraat 35, 5831 Boxmeer, The Netherlands3
Department of Medical Genetics, Haukeland Hospital, Bergen, Norway4
National Veterinary Institute, Oslo, Norway5
Author for correspondence: Bjørn Krossøy at Intervet Norbio. Fax +47 55 96 01 35. e-mail bjorn.krossoy{at}ifm.uib.no
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Influenza A and B viruses contain two surface glycoproteins, the haemagglutinin (HA) with receptor binding and membrane fusion activities and the neuraminidase (NA) with receptor-destroying activity. In contrast, influenza C viruses contain only a single surface glycoprotein, the HAesterasefusion protein (HEF), which has all three activities. HA and HEF are synthesized as precursor proteins that generate the C terminus of HA1/HEF1 and the N terminus of HA2/HEF2 after cleavage, respectively. This cleavage event primes the membrane fusion potential of HA/HEF, which is required for the virus to be infectious. Fusion of the viral and cellular membranes takes place as the fusion activity of HA/HEF is triggered by the low-pH environment of the endosome (reviewed by Skehel & Wiley, 2000
; Wiley & Skehel, 1987
). ISAV has been shown to possess both haemagglutinating and receptor-destroying activity; the latter has been suggested to be an acetylesterase (Falk et al., 1997
). Trypsin treatment was used to show that the membrane fusion activity is activated by proteolytic activity (Falk et al., 1997
). Recently, Eliassen et al. (2000)
demonstrated that ISAV replicates in a manner similar to the influenza viruses, with binding of virus particles to NA-sensitive determinants on cell surface glycoproteins or glycolipids. Furthermore, it was shown that virus particles are internalized into endosomes and lysosomes where a low pH-dependent fusion with the cell membrane occurs.
Among influenza viruses, the most polymorphic gene has been shown to be that of the HA (reviewed by Webster et al., 1992
). Accordingly, this sequence is useful to identify and separate closely related isolates. Sequence comparisons of ISAV gene segments 2 and 8 have shown distinct differences between isolates originating from the eastern region of North America and Europe (Blake et al., 1999
; Cunningham & Snow, 2000
; Krossøy et al., 2001
), but it has not been possible to differentiate between the European isolates using these segments.
In the present study, we report the cloning, expression and identification of the gene encoding the ISAV HA. We present data indicating that ISAV HA, in contrast to influenza virus HA, is not posttranslationally cleaved. A highly polymorphic region that may be useful as an epidemiological marker is also described.
| Methods |
|---|
|
|
|---|
Virus isolation and construction of a cDNA library.
Screening of the bacteriophage lambda cDNA library.
Library screening was performed using an anti-ISAV HA monoclonal antibody (MAb), 3H6F8 (Falk et al., 1998
), and a polyclonal anti-ISAV rabbit sera (see below) with the picoBlue immunoscreening kit (Stratagene). PCR products from clones suspected to be derived from ISAV were produced using vector-specific primers and the PCR products were then sequenced. One set of internal gene-specific PCR primers was constructed for each sequence and this primer pair was then used on cDNA from ISAV-infected and uninfected cells to determine whether the sequence was viral or cellular. For one of the clones, tentatively designated 9Z, the PCR primer pair 9ZF1 (5' cgcctgtttacagtcgtctatgtctt 3') and 9ZR1 (5' gtgtgttgaaatatccgcatccgttga 3') was used. The pBlueScript plasmid was then excised from the ISAV-positive clones using the ExAssist helper phage and the SOLR strain of E. coli (Stratagene). Complete sequencing was performed on the isolated plasmids. To obtain full-length cDNA sequences, 5'RACE was performed with the 5'RACE system, version 2.0 (Life Technologies). 5'RACE products were cloned into the pCR 2·1-TOPO vector using the TOPO TA Cloning kit (Invitrogen) and sequenced as described below.
DNA sequencing and assembly.
Plasmids and PCR products were sequenced using the BigDye Terminator Sequencing kit and an ABI 377 DNA analyser (PE Biosystems). Sequences were assembled using the Sequencher software (Gene Codes Corporation). GenBank searches were performed using BLAST software, version 2.0.
Preparation of antisera.
ISAV was purified on a continuous sucrose gradient using the Glesvaer 90 isolate, as described previously (Falk et al., 1997
). Polyclonal antisera were prepared by immunizing rabbits three times at 6 week intervals using approximately 50 µg of purified ISAV for each immunization. The first and second immunizations were administered subcutaneously in Freund's complete and Freund's incomplete adjuvant (Difco), respectively. The third immunization was administered intravenously in saline. Animals were bled 10 days after the third immunization. Eurogentec prepared the peptide antisera against the 9Z protein by using the peptides MGDSRSDQSRVNPQSC and CPKMVKDFDQTSLGNT coupled to keyhole limpet haemocyanin. The conjugated peptides were pooled and injected into two rabbits, according to Eurogentec's procedures.
Northern blot.
Northern blotting was performed with the Northern Max kit (Ambion). Briefly, approximately 15 µg of total RNA from either ISAV-infected ASK (3 days p.i.) or uninfected cells was separated by formaldehydeagarose gel electrophoresis and blotted onto a positively charged nylon membrane (Boehringer Mannheim). The DIG-labelled RNA molecular mass marker 1 (Boehringer Mannheim) was also run in parallel. PCR using the primer pair 9ZF1/9ZR1 produced a 552 bp DNA probe that was DIG-labelled and used according to the DIG High Prime Labelling and Detection Starter kit 2 (Boehringer Mannheim).
Baculovirus expression of 9Z cDNA.
9Z cDNA was amplified using primers 5' ttggcgcgcaaagatggcacgattc 3' and 5' ggggtaccgttgtctttctttcataatc 3' and cloned into the BssHII and KpnI sites of the pFASTBAC1 vector (Life Technologies). The construct was transformed into TOP 10 cells (Invitrogen) and the isolated plasmids were used to transform DH10BAC competent cells (Life Technologies). Recombinant baculoviruses were constructed according to the recommendations of Life Technologies.
Immunofluorescence in Sf9 cells.
Sf9 cells infected with 9Z-recombinant or non-recombinant baculovirus were grown in microtitre plates at 28 °C. At 5 days p.i., cells were fixed in formolcalcium and washed. Cells were then incubated with anti-ISAV HA MAb 3H6F8 for 1 h at 37 °C. After washing with PBS, fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Southern Biotechnology Associates) was added and cells were incubated at room temperature for 1 h. After washing, cell nuclei were stained with propidium iodide, mounted using the SlowFade Antifade kit (Molecular Probes) and examined using a confocal microscope (Leica).
Immunoprecipitation.
Anti-mouse IgG-conjugated polystyrene magnetic beads (Dynabeads M-280, Dynal) were coated with the anti-ISAV HA MAb. In brief, the beads were washed twice in PBS containing 0·1% BSA (PBS/BSA), incubated with MAb 3H6F8 for 1 h at room temperature and washed three times with lysis buffer (PBS/BSA containing 1% Triton X-100). Coated beads were then incubated at room temperature for 3 h with lysates from Sf9 cells infected with either the 9Z-recombinant or non-recombinant baculovirus (0·1 mg beads per 1 ml supernatant). Antibodyantigen complexes were washed once with RIPA buffer (PBS, pH 7·4, 1% Triton X-100, 0·1% BSA, 1% sodium deoxycholate, 0·1% SDS and 0·5 M lithium chloride), once with lysis buffer, once with PBS and once with 1 M TrisHCl pH 6·8. The washed beads were then analysed by SDSPAGE and Western blotting, as described below.
SDSPAGE and Western blot.
Lysates of Sf9 cells, immunoprecipitated Sf9 lysates and ISAV purified by sucrose gradient centrifugation were prepared in dissociation buffer (50 mM TrisHCl, pH 6·8, 1% SDS, 50 mM DTT, 8 mM EDTA and 0·01% bromophenol blue). After heating for 5 min at 95 °C, proteins were separated by SDSPAGE using a 0·5 mm thin pre-cast 12·5% polyacrylamide gel (ExcelGel SDS, Amersham Pharmacia) and transferred to a nitrocellulose membrane in a semi-dry electroblotter (NovaBlot, Amersham Pharmacia). The protein blot was then treated with blocking solution (10 mM PBS containing 0·1% Tween 20 and 5% non-fat dry milk) overnight at 4 °C. The primary rabbit antiserum (pre-absorbed by incubation on acetone-fixed monolayers of SHK-1 cells) diluted 1:2000 in blocking solution was added and incubated for 2 h at room temperature. The membrane was then washed three times in blocking solution and incubated with a 1:1000 dilution of goat anti-rabbit horseradish peroxidase (HRP)-conjugated antibody (Amdex, Amersham Pharmacia) for 1 h at room temperature. Diaminobenzidine was used as the colour reagent for the detection of bound HRP conjugate. The protein blot was scanned in a desktop scanner (Sharp JX-330) and subsequently analysed and printed using Gel-Pro gel scanning software (Media Cybernetics). The low molecular mass markers that were used ranged from 14·4 to 94·0 kDa (Amersham Pharmacia).
Haemadsorption assays.
Blood sampled from Atlantic salmon (S. salar) and brown trout (S. trutta) was washed three times in PBS (1·5% NaCl) by centrifuging at 110 g for 10 min at 4 °C. A 0·25% suspension was then prepared in L-15 medium (BioWittaker) and added to cell monolayers 4 days after infection with either 9Z-recombinant or non-recombinant baculovirus. Cells were then incubated at room temperature for 45 min, washed in L-15 medium to remove unattached erythrocytes, counterstained in Diff Quick (DADE) and examined in an inverted microscope. To examine the inhibition of haemadsorption, insect cells were incubated with dilutions of anti-ISAV antisera or mouse ascites fluid containing MAb 3H6F8 for 45 min at room temperature before the addition of erythrocytes. As a control, pre-serum or mouse ascites fluid containing a MAb against HIV-1 reverse transcriptase (Szilvay et al., 1992
) was used.
Sequence comparisons and analysis.
ISAV isolates were collected from salmon during ISA outbreaks occurring in salmon farms in Norway, Scotland and Canada (Table 1
). The isolates were propagated in ASK cells and RNA was extracted with Trizol. Reverse transcription was performed using M-MLV reverse transcriptase (Promega) with random hexamers as primers. cDNA sequences corresponding to the 9Z gene were amplified by PCR using the sense primer 5' gcaaagatggcacgattc 3' and the anti-sense primer 5' gttgtctttctttcataatc 3'. PCR products were purified on Qiaquick PCR Purification columns (Qiagen) and sequenced as described above. The Vector NTI Suite software package (InforMAx) was used for sequence data analysis and multiple alignments of partial nucleotide and protein sequences were performed with CLUSTAL W (Thompson et al., 1994
). Protein secondary structure of the Bremnes 98 sequence was analysed using the Jpred2 program, version 2.0 (The Barton Group, EMBLEuropean Bioinformatics Institute; http://barton.ebi.ac.uk), and transmembrane regions in the protein were predicted using the TMHMM program, version 1.0 (Center for Biological Sequence Analysis, The Technical University of Denmark; http://www.cbs.dtu.dk).
|
| Results |
|---|
|
|
|---|
-helix structure in the C-terminal end of the protein (Fig. 1
|
|
As demonstrated by immunofluorescence, the anti-ISAV HA MAb bound to insect cells expressing the recombinant 9Z protein, whereas it did not bind to cells infected with non-recombinant baculovirus (Fig. 3A
, B
). The polyclonal antiserum and the peptide serum, however, reacted specifically with Sf9 cells infected with the 9Z-recombinant baculovirus.
|
Sequence comparisons of ISAV isolates
Sequence alignment of the predicted 9Z proteins from different ISAV isolates is presented in Fig. 1
. Pairwise comparisons of the sequences from the seven isolates show identities varying between 84 and 98% at the amino acid level, with the Canadian (Bay of Fundy 97) isolates clearly separated from the European isolates. All sequences contained two potential N-glycosylation sites, except the Canadian isolate, which contained an additional site at position 151153 (Fig. 1
). However, this sequence (NPT) is considered to be weak glycosylation sequon that is probably not in use (Feldmann et al., 1988
). One of the N-glycosylation sites is located at the cytoplasmic side of the predicted transmembrane region, which, if this prediction is correct, leaves us with only one potential N-glycosylation site that is shared by all isolates. A highly polymorphic region (HPR), corresponding to a predicted difference in molecular mass of 1·4 kDa between the isolates Hitra 99 and Bremnes 98/Loch Nevis 98, was identified in close proximity to the predicted membrane-spanning region.
| Discussion |
|---|
|
|
|---|
As shown by Western blotting analyses, peptide antisera prepared against the putative HA and polyclonal antisera prepared against whole virus preparations reacted with a similar 43 kDa protein from purified virus. When the same antisera were used on baculovirus-expressed recombinant protein, a narrow band with a slightly smaller molecular mass was detected, although it showed partial co-localization with the native protein. The ISAV HA sequences probably contain only one N-glycosylation site outside the predicted transmembrane sequence. We have not investigated if this site is glycosylated, but it is known that recombinant glycoproteins expressed in insect cells may exhibit a slightly lower molecular mass when compared with native proteins following SDSPAGE (Wagner et al., 1996
). The differences observed might therefore be related to different glycosylation patterns in insect cells as compared with salmon cells, which may result in truncated oligosaccharides. Western blot analyses with recombinant protein revealed two major and one minor protein bands. The molecular mass of the larger of the two major proteins was approximately twice the mass of the smaller and we believe that this protein probably represents a tightly bound dimer that could not be separated by the SDSPAGE dissociation buffer. The minor protein probably represents a breakdown product or a non-complete recombinant protein. The relationship of these polypeptides to the recombinant HA protein was demonstrated further by the binding of all three proteins to the anti-ISAV HA MAb, as shown by immunoprecipitation.
The predicted molecular mass of HA is similar to that observed by SDSPAGE and Western blotting using purified virus preparation as antigen. In contrast to the influenza viruses, it appears that no proteolytic cleavage of the ISAV HA occurs. Or, that only a small part undetectable by gel-electrophoresis is removed. It is known from studying influenza viruses that uncleaved HA precursors show specific haemagglutinating activity and that this activity remains unaffected by cleavage into HA1/HEF1 and HA2/HEF2 (Herrler et al., 1979
; Lazarowitz et al., 1973
). However, proteolytic cleavage of the precursors is required to trigger the pH-dependent activation of the fusion activity of these proteins (Huang et al., 1981
; Kitame et al., 1982
; Maeda & Ohnishi, 1980
; Maeda et al., 1981
; Ohuchi et al., 1982
; White et al., 1981
). It has been demonstrated previously that addition of trypsin to the culture medium during ISAV replication has a beneficial effect on the production of infectious virus particles (Falk et al., 1997
). A low pH-dependent endosomal fusion activity in the ISAV replication cycle has also been demonstrated (Eliassen et al., 2000
), suggesting that the binding and uptake of ISAV is, in principle, the same as that for influenza viruses. However, our results indicate that the ISAV HA is different compared with the influenza virus HA (with regard to proteolytic cleavage) and that the presence of two disulfide-linked chains similar to influenza virus HA1HA2 is unlikely. It is possible that fusion activity is linked with another, as yet unidentified, surface protein. It has been shown that three polypeptides of 24, 43 and 53 kDa are associated with the detergent-soluble fraction of purified viruses (K. Falk, unpublished data) and it is tempting to speculate that this profile represents the matrix protein, the HA and a possible fusion protein, respectively.
Most of the sequence variation in the HA gene was found between the isolate from Canada and the European isolates and the difference is slightly more than that found when segments 2 and 8 are used for comparison (Blake et al., 1999
; Cunningham & Snow, 2000
; Krossøy et al., 2001
). The higher sequence variation in the HA gene is to be expected, as natural selection from host immune systems should drive the evolution of this surface protein, while the internal or non-structural proteins most probably encoded by segments 2 and 8 may have virus-specific functional constraints on evolution (Webster et al., 1992
). The HPR provides most of the variation between the European isolates, while the difference between the Canadian isolate and the European isolates is evenly spread throughout the sequence. The significance of this polymorphic region is not yet understood, but it may be suitable as an epidemiological marker in the study of ISAV isolate distribution: the changes between the isolates seem to be non-random changes. However, sequences from more ISAV isolates are required to verify this observation. At present, there is only limited information available about the ISAV genes and their products. The present study of the HA sequence, with the identification of a HPR that is potentially useful in epidemiological studies, should add some valuable information to the situation.
In conclusion, this study reports the identification of the ISAV HA. We tie the haemagglutinating activity to the 43 kDa ISAV protein and support our conclusion by the following observations: (i) a MAb shown previously to react with the ISAV HA reacted with insect cells expressing the 9Z gene; (ii) the 9Z-expressing insect cells also adsorbed erythrocytes from Atlantic salmon, but not from brown trout, which is in agreement with the properties of ISAV; (iii) haemadsorption was inhibited by both the anti-ISAV HA MAb and the polyclonal ISAV whole virus antiserum; (iv) the polyclonal antiserum, which was shown to react with all the major viral proteins, also recognized the recombinant 9Z protein; (v) an antiserum prepared against two peptides derived from the 9Z/HA sequence recognized one major band in purified virus preparations that co-localized with the 43 kDa virus protein; (vi) a protein band that partly co-localized with the 43 kDa protein was detected in lysates of insect cells expressing the recombinant protein; and (vii) this recombinant protein was also immunoprecipitated with the anti-ISAV HA MAb. The ISAV HA seems to differ from corresponding proteins in influenza viruses in that it does not appear to be posttranslationally cleaved and, therefore, does not carry fusion activity, which may be found on a separate surface protein. However, further experiments are needed to clarify these points. Compared with members of the Orthomyxoviridae family, the differences in the ISAV HA support the opinion that ISAV represents a new group of orthomyxoviruses (Falk et al., 1997
; Krossøy et al., 1999
).
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Cunningham, C. O. & Snow, M. (2000). Genetic analysis of infectious salmon anaemia virus (ISAV) from Scotland. Diseases of Aquatic Organisms 41, 1-8.[Medline]
Devold, M., Krossøy, B., Aspehaug, V. & Nylund, A. (2000). Use of RTPCR for diagnosis of infectious salmon anaemia virus (ISAV) in carrier sea trout Salmo trutta after experimental infection. Diseases of Aquatic Organisms 40, 9-18.[Medline]
Eliassen, T. M., Frøystad, M. K., Dannevig, B. H., Jankowska, M., Brech, A., Falk, K., Romøren, K. & Gjøen, T. (2000). Initial events in infectious salmon anaemia virus infection: evidence for the requirement of a low-pH step. Journal of Virology 74, 218-227.
Falk, K., Namork, E., Rimstad, E., Mjaaland, S. & Dannevig, B. H. (1997). Characterization of infectious salmon anaemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). Journal of Virology 71, 9016-9023.[Abstract]
Falk, K., Namork, E. & Dannevig, B. H. (1998). Characterization and applications of a monoclonal antibody against infectious salmon anaemia virus. Diseases of Aquatic Organisms 34, 77-85.[Medline]
Feldmann, H., Kretzschmar, E., Klingeborn, B., Rott, R., Klenk, H. D. & Garten, W. (1988). The structure of serotype H10 haemagglutinin of influenza A virus: comparison of an apathogenic avian and a mammalian strain pathogenic for mink. Virology 165, 428-437.[Medline]
Herrler, G., Compans, R. W. & Meier-Ewert, H. (1979). A precursor glycoprotein in influenza C virus. Virology 99, 49-56.[Medline]
Huang, R. T., Rott, R. & Klenk, H. D. (1981). Influenza viruses cause hemolysis and fusion of cells. Virology 110, 243-247.[Medline]
Kibenge, F. S. B., Lyaku, J. R., Rainnie, D. & Hammell, K. L. (2000). Growth of infectious salmon anaemia virus in CHSE-214 cells and evidence for phenotypic differences between virus strains. Journal of General Virology 81, 143-150.
Kitame, F., Sugawara, K., Ohwada, K. & Homma, M. (1982). Proteolytic activation of hemolysis and fusion by influenza C virus. Archives of Virology 73, 357-361.[Medline]
Koren, C. W. R. & Nylund, A. (1997). Morphology and morphogenesis of infectious salmon anaemia virus replicating in the endothelium of Atlantic salmon Salmo salar. Diseases of Aquatic Organisms 29, 99-109.
Krossøy, B., Hordvik, I., Nilsen, F., Nylund, A. & Endresen, C. (1999). The putative polymerase sequence of infectious salmon anaemia virus suggests a new genus within the Orthomyxoviridae. Journal of Virology 73, 2136-2142.
Krossøy, B., Nilsen, F., Falk, K., Endresen, C. & Nylund, A. (2001). Phylogenetic analysis of infectious salmon anaemia virus isolates from Norway, Canada and Scotland. Diseases of Aquatic Organisms 44, 1-6.[Medline]
Lazarowitz, S. G., Compans, R. W. & Choppin, P. W. (1973). Proteolytic cleavage of the haemagglutinin polypeptide of influenza virus. Function of the uncleaved polypeptide HA. Virology 52, 199-212.[Medline]
Maeda, T. & Ohnishi, S. (1980). Activation of influenza virus by acidic media causes hemolysis and fusion of erythrocytes. FEBS Letters 122, 283-287.[Medline]
Maeda, T., Kawasaki, K. & Ohnishi, S. (1981). Interaction of influenza virus haemagglutinin with target membrane lipids is a key step in virus-induced hemolysis and fusion at pH 5·2. Proceedings of the National Academy of Sciences, USA 78, 4133-4137.
Mjaaland, S., Rimstad, E., Falk, K. & Dannevig, B. H. (1997). Genomic characterization of the virus causing infectious salmon anaemia in Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. Journal of Virology 71, 7681-7686.[Abstract]
Mullins, J. E., Groman, D. & Wadowska, D. (1998). Infectious salmon anaemia in salt water Atlantic salmon (Salmo salar L.) in New Brunswick, Canada. Bulletin of the European Association of Fish Pathologists 18, 110-114.
Ohuchi, M., Ohuchi, R. & Mifune, K. (1982). Demonstration of hemolytic and fusion activities of influenza C virus. Journal of Virology 42, 1076-1079.
Rodger, H. D., Turnbull, T., Muir, F., Millar, S. & Richards, R. H. (1998). Infectious salmon anaemia (ISA) in the United Kingdom. Bulletin of the European Association of Fish Pathologists 18, 115-116.
Rosenthal, P. B., Zhang, X., Formanowski, F., Fitz, W., Wong, C. H., Meier-Ewert, H., Skehel, J. J. & Wiley, D. C. (1998). Structure of the haemagglutininesterasefusion glycoprotein of influenza C virus. Nature 396, 92-96.[Medline]
Sandvik, T., Rimstad, E. & Mjaaland, S. (2000). The viral RNA 3'- and 5'-end structure and mRNA transcription of infectious salmon anaemia virus resemble those of influenza viruses. Archives of Virology 145, 1659-1669.[Medline]
Skehel, J. J. & Wiley, D. C. (2000). Receptor binding and membrane fusion in virus entry: the influenza haemagglutinin. Annual Review of Biochemistry 69, 531-569.[Medline]
Szilvay, A. M., Nornes, S., Haugan, I. R., Olsen, L., Prasad, V. R., Endresen, C., Goff, S. P. & Helland, D. E. (1992). Epitope mapping of HIV reverse transcriptase with monoclonal antibodies that inhibit the polymerase and RNase H activity. Journal of Acquired Immune Deficiency Syndromes 5, 647-657.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
Thorud, K. & Djupvik, H. O. (1988). Infectious salmon anaemia in Atlantic salmon (Salmo salar L.). Bulletin of the European Association of Fish Pathologists 8, 109-111.
Wagner, R., Geyer, H., Geyer, R. & Klenk, H.-D. (1996). N-acetyl-
-glucosaminidase accounts for differences in glycosylation of influenza virus hemagglutinin expressed in insect cells from a baculovirus vector. Journal of Virology 70, 4103-4109.[Abstract]
Webster, R. G., Bean, W. J., Gorman, O. T., Chambers, T. M. & Kawaoka, Y. (1992). Evolution and ecology of influenza A viruses. Microbiological Reviews 56, 152-179.
White, J., Matlin, K. & Helenius, A. (1981). Cell fusion by Semliki Forest, influenza, and vesicular stomatitis viruses. Journal of Cell Biology 89, 674-679.
Wiley, D. C. & Skehel, J. J. (1987). The structure and function of the haemagglutinin membrane glycoprotein of influenza virus. Annual Review of Biochemistry 56, 365-394.[Medline]
Received 1 November 2000;
accepted 26 February 2001.
This article has been cited by other articles:
![]() |
F. S. B. Kibenge, M. J. T. Kibenge, Y. Wang, B. Qian, S. Hariharan, and S. McGeachy Mapping of putative virulence motifs on infectious salmon anemia virus surface glycoprotein genes J. Gen. Virol., November 1, 2007; 88(11): 3100 - 3111. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Devold, M. Karlsen, and A. Nylund Sequence analysis of the fusion protein gene from infectious salmon anemia virus isolates: evidence of recombination and reassortment J. Gen. Virol., July 1, 2006; 87(7): 2031 - 2040. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Aspehaug, A. B. Mikalsen, M. Snow, E. Biering, and S. Villoing Characterization of the Infectious Salmon Anemia Virus Fusion Protein J. Virol., October 1, 2005; 79(19): 12544 - 12553. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hellebo, U. Vilas, K. Falk, and R. Vlasak Infectious Salmon Anemia Virus Specifically Binds to and Hydrolyzes 4-O-Acetylated Sialic Acids J. Virol., March 15, 2004; 78(6): 3055 - 3062. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Falk, V. Aspehaug, R. Vlasak, and C. Endresen Identification and Characterization of Viral Structural Proteins of Infectious Salmon Anemia Virus J. Virol., March 15, 2004; 78(6): 3063 - 3071. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Joseph, M. T. Kibenge, and F. S. B. Kibenge Antibody-mediated growth of infectious salmon anaemia virus in macrophage-like fish cell lines J. Gen. Virol., July 1, 2003; 84(7): 1701 - 1710. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Clouthier, T. Rector, N. E. C. Brown, and E. D. Anderson Genomic organization of infectious salmon anaemia virus J. Gen. Virol., February 1, 2002; 83(2): 421 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. B. Kibenge, M. J. T. Kibenge, P. K. McKenna, P. Stothard, R. Marshall, R. R. Cusack, and S. McGeachy Antigenic variation among isolates of infectious salmon anaemia virus correlates with genetic variation of the viral haemagglutinin gene J. Gen. Virol., December 1, 2001; 82(12): 2869 - 2879. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |