|
|
||||||||
Plant |
Department of Botany, The University of British Columbia, Vancouver, British Columbia, CanadaV6T 1Z41
Pacific Agri-Food Research Centre, Summerland, British Columbia, CanadaV0H 1Z02
Author for correspondence: Hélène Sanfaçon. Fax +1 250 494 0755. e-mail SanfaconH{at}em.agr.ca
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
To test for the presence of possible cleavage sites in the N-terminal region of P2, an in vitro processing assay was used. Plasmid pT7-N-termFL, containing the entire N-terminal region of P2 under the control of the T7 polymerase promoter (Fig. 1a
), was constructed by amplifying a cDNA fragment from plasmid pMR14 (Rott et al., 1991a
) using Pfu polymerase (Stratagene) and primers PX6 [5' TTTCCATGGGCGAAAAATCTGGTGATATTCC 3', containing an engineered NcoI site (underlined) and corresponding to ToRSV RNA2 nucleotides 425 (numbering according to Rott et al., 1991a
)] and PX4 [5' CAAGAATTCTCCCCTATCGACAACCCTC 3', containing an engineered EcoRI site (underlined) and complementary to ToRSV RNA2 nucleotides 28312813]. The cDNA fragment was digested with NcoI and EcoRI and inserted into the corresponding sites of plasmid pCITE (4a+) (Novagen). This resulted in an in-frame fusion of the viral sequence with an ATG present in the vector and with some non-viral sequences (Fig. 1a
). The labelled polyprotein precursor was synthesized using a coupled transcription/translation rabbit reticulocyte system (TNT, Promega) in the presence of [35S]methionine and separated by SDSPAGE as described (Wang et al., 1999
). A predominant protein of approximately 120 kDa (calculated molecular mass for the precursor is 112·3 kDa) was observed (Fig. 1b
, lane 1). Additional minor proteins were also produced, presumably through internal translation initiation. Purified recombinant ToRSV proteinase was added to the translation products and incubated at 15 °C (as described in Wang & Sanfaçon, 2000
). Two additional proteins with relative molecular masses of approximately 75 and 40 kDa were observed (Fig. 1b
, lanes 2 and 3). These proteins did not appear when the translation products were incubated at 15 °C in the absence of exogenous proteinase (Fig. 1b
, lanes 4 and 5), demonstrating that they were produced by proteolytic cleavage of the N-termFL precursor at a new cleavage site by the ToRSV proteinase. Processing at this site was relatively inefficient in vitro with only partial cleavage observed after overnight incubation under conditions that allow complete cleavage of precursors containing the XMP and MPCP cleavage sites in 3 h (Carrier et al., 1999
; Wang & Sanfaçon, 2000
). Examination of the deduced amino acid sequence of the N-terminal region of the P2 polyprotein revealed the presence of only two putative cleavage sites (dipeptides Q301/G and Q319/G, Fig. 1a
). A valine was present at the -2 position of the putative sites, which is in agreement with the criteria established for ToRSV cleavage sites (Carrier et al., 1999
). The sizes of the 40 and 75 kDa proteins were consistent with the predicted size of cleaved products obtained after proteolytic processing at either one of the putative sites (38·5 and 73·8 kDa for Q301/G; 40·4 and 71·9 kDa for Q319/G).
|
1 and N-term
2) were studied that contained deletion of sequences at either the N or the C terminus of the N-termFL precursor (Fig. 1a
1 was constructed by amplification of a cDNA fragment using primers PX4 and W034 (Wang & Sanfaçon, 2000
2 was constructed by first ligating an 811 nt SmaIHindIII cDNA fragment (corresponding to ToRSV RNA2 nucleotides 3631234) into the EcoRIHindIII sites of pET21B (Novagen). The cleaved EcoRI site of plasmid pET21B had been filled-in using the Klenow fragment of DNA polymerase I to create a blunt end prior to the ligation. The NruINotI 649 nt fragment from this intermediate plasmid was then ligated with the large NruINotI fragment of plasmid pT7-N-TermFL to create plasmid pT7-N-term
2. Coupled in vitro transcription/translation of plasmids pT7-N-term
1 and pT7-N-term
2 resulted in the production of predominant proteins of approximately 90 and 55 kDa, respectively (Fig. 1b
1 (84·5 kDa) and N-term
2 (49·1 kDa). As above, some minor proteins were also produced, presumably through internal translation initiation. The 75 kDa protein was produced upon incubation of the N-term
1 precursor in the presence of ToRSV proteinase (Fig. 1b
2 precursor (Fig. 1b
To further study the proteolytic processing at the new cleavage site(s), point mutations at the two putative sites were introduced into the N-termFL and N-term
2 precursors. We have previously shown that mutation of the conserved Q at the -1 position of the cleavage site to an A results in a complete inhibition of processing (Carrier et al., 1999
). Site-directed mutagenesis was done on plasmids pT7-N-termFL and pT7-N-term
2 to introduce an A at the -1 position of the Q301/G and Q319/G dipeptides using the Quickchange site-directed mutagenesis kit (PDI bioscience). Oligonucleotides KC-55 (5' GGTCTCAGCCTGTTGCAGGGGGCTTCTCCC 3'; mutated nucleotides shown in bold) and KC-56 (5' GGGAGAAGCCCCCTGCAACAGGCTGAGACC 3') were used for the A301 mutation while oligonucleotides KC-57 (5' GTCGCTCCCACCGTTGCGGGTGTGGTGCGCGC 3') and KC-58 (5' GCGCGCACCACACCCGCAACGGTGGGAGCGAC 3') were used for the A319 mutation. The results from in vitro processing experiments of the wild-type and mutated precursors were similar regardless of the precursor (N-termFL and N-term
2) into which the mutations were introduced. The precursors containing the A319 mutation were cleaved by the exogenous proteinase in vitro, resulting in cleavage patterns similar to those observed with the corresponding wild-type precursors (Fig. 1c
, compare lane 3 to lane 1, and lane 7 to lane 5). In contrast, cleavage was not detected in precursors containing the A301 mutation (Fig. 1c
, lanes 2 and 6) or a double mutation (A301+A319; Fig. 1c
, lanes 4 and 8). These results suggest that cleavage occurred at the Q301/G dipeptide in vitro. Confirmation of this cleavage site by direct N-terminal amino acid sequencing of the 75 kDa product released from the N-termFL or N-term
1 precursors was not successful as it was produced in low amounts and ran in close proximity to other labelled proteins on SDSPAGE. Cleavage at the new cleavage site (presumably at dipeptide Q301/G) is predicted to allow the release of two proteins from the N-terminal region of P2: a 34 kDa protein (assuming translation initiation at the first AUG codon), arbitrarily called X3, and a 71 kDa protein (X4; see Fig. 2
). Although Q301/G is suggested as the new cleavage site based on in vitro processing experiments, we cannot exclude the possibility that both the Q301/G and the Q319/G dipeptides are recognized in vivo or that the Q319/G dipeptide may act as an alternative cleavage site.
|
-helix conformation. The three-dimensional structure of the precursor may therefore play a role in the recognition of the cleavage sites as suggested for poliovirus and comovirus cleavage sites (Ypma-Wong et al., 1988
Our results show that the ToRSV proteinase recognizes a third cleavage site on P2 in vitro. This observation contrasts with results obtained with other nepoviruses (Fig. 2
). Indeed, analysis of the proteolytic processing of the P2 polyproteins of Grapevine fanleaf virus (GFLV; a nepovirus from subgroup A) and of Tomato black ring virus and Grapevine chrome mosaic virus (two nepoviruses from subgroup B) revealed the presence of only two cleavage sites (Margis et al., 1993
; Demangeat et al., 1991
; Hibrand et al., 1992
). Blackcurrant reversion virus (BRV) is the only other member of nepovirus subgroup C for which the entire sequence of the RNA2 is available (Latvala-Kilby & Lehto, 1999
). As with ToRSV, BRV has a large P2, which raises the possibility that a third cleavage site may be present. Since the only BRV cleavage site identified so far is rather unusual (D/S; Latvala et al., 1998
), it is difficult to predict additional cleavage sites based on the deduced amino acid sequence. The presence of two protein domains in the N-terminal region of the ToRSV P2 may therefore either represent a unique feature of ToRSV or a feature common to other nepoviruses of subgroup C.
The possible function of the X3 and X4 proteins in the ToRSV replication cycle is not known. A protein sequence homology search using BLAST (Altschul et al., 1990
) did not reveal any similarities of the X4 protein to other known proteins. The X3 protein contains extensive regions of homology to the X1 protein domain present at the N terminus of P1 (Wang & Sanfaçon, 2000
; Fig. 2
), including an alanine-rich motif also present in the N-terminal region of the BRV P2 (Latvala-Kilby & Lehto, 1999
) and in the N-terminal region of other nepovirus P1 polyproteins (Mayo & Robinson, 1996
). The X3 protein also contains several proline motifs which are also present in the RNA2-encoded 28 kDa protein of GFLV. The GFLV 28 kDa protein and the corresponding 58 kDa protein of Cowpea mosaic virus (genus Comovirus) are critical for the replication of RNA2 (Van Bokhoven et al., 1993
; Gaire et al., 1999
). Further studies will be aimed at detecting the putative X3, X4 and/or X3X4 proteins in infected plants and at examining the role of these proteins in the ToRSV replication cycle.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Carrier, K., Hans, F. & Sanfaçon, H. (1999). Mutagenesis of amino acids at two tomato ringspot nepovirus cleavage sites: effect on proteolytic processing in cis and in trans by the 3C-like protease. Virology 258, 161-175.[Medline]
Clark, A. J., Bertens, P., Wellink, J., Shanks, M. & Lomonossoff, G. P. (1999). Studies on hybrid comoviruses reveal the importance of three-dimensional structure for processing of the viral coat protein and show that the specificity of cleavage is greater in trans than in cis. Virology 263, 184-194.[Medline]
Demangeat, G., Hemmer, O., Fritsch, C., Le Gall, O. & Candresse, T. (1991). In vitro processing of the RNA-2-encoded polyprotein of two nepoviruses: tomato black ring virus and grapevine chrome mosaic virus. Journal of General Virology 72, 247-252.
Gaire, F., Schmitt, C., Stussi-Garaud, C., Pinck, L. & Ritzenthaler, C. (1999). Protein 2A of grapevine fanleaf nepovirus is implicated in RNA2 replication and colocalizes to the replication site. Virology 264, 25-36.[Medline]
Guermeur, Y., Geourjon, C., Gallinari, P. & Deleage, G. (1999). Improved performance in protein secondary structure prediction by inhomogeneous score combination. Bioinformatics 14, 413-421.
Hans, F. & Sanfaçon, H. (1995). Tomato ringspot nepovirus protease: characterization and cleavage site specificity. Journal of General Virology 76, 917-927.
Hibrand, L., Le Gall, O., Candresse, T. & Dunez, J. (1992). Immunodetection of the proteins encoded by grapevine chrome mosaic nepovirus RNA2. Journal of General Virology 73, 2093-2098.
Latvala, S., Susi, P., Kalkkinen, N. & Lehto, K. (1998). Characterization of the coat protein gene of mite-transmitted blackcurrant reversion associated nepovirus. Virus Research 53, 1-11.[Medline]
Latvala-Kilby, S. & Lehto, K. (1999). The complete nucleotide sequence of RNA2 of blackcurrant reversion nepovirus. Virus Research 65, 87-92.[Medline]
Margis, R., Ritzenthaler, C., Reinbolt, J., Pinck, M. & Pinck, L. (1993). Genome organization of grapevine fanleaf nepovirus RNA2 deduced from the 122K polyprotein P2 in vitro cleavage products. Journal of General Virology 74, 1919-1926.
Mayo, M. A. & Robinson, D. J. (1996). Nepoviruses: molecular biology and replication. In The Plant Viruses , pp. 139-185. Edited by B. D. Harrison & A. F. Murant. New York:Plenum Press.
Rott, M. E., Tremaine, J. H. & Rochon, D. M. (1991a). Nucleotide sequence of tomato ringspot virus RNA-2. Journal of General Virology 76, 465-473.
Rott, M. E., Tremaine, J. H. & Rochon, D. M. (1991b). Comparison of the 5' and 3' termini of tomato ringspot virus RNA1 and RNA2: evidence for RNA recombination. Virology 185, 468-472.[Medline]
Sanfaçon, H. (1995). Nepovirus. In Pathogenesis and Host Specificity in Plant Disease: Histopathological, Biochemical & Molecular Bases, vol. III, Viruses & Viroids , pp. 129-141. Edited by R. P. Singh, U. S. Singh & K. Kohmoto. Oxford:Pergamon Press.
Van Bokhoven, H., Le Gall, O., Kasteel, D., Verver, J., Wellink, J. & Van Kammen, A. (1993). Cis- and trans-acting elements in cowpea mosaic virus RNA replication. Virology 195, 377-386.[Medline]
Wang, A. & Sanfaçon, H. (2000). Proteolytic processing at a novel cleavage site in the N-terminal region of the tomato ringspot nepovirus RNA1-encoded polyprotein in vitro. Journal of General Virology 81, 2771-2781.
Wang, A., Carrier, K., Chisholm, J., Wieczorek, A., Huguenot, C. & Sanfaçon, H. (1999). Proteolytic processing of tomato ringspot nepovirus 3C-like protease precursors: definition of the domains for the VPg, protease and putative RNA-dependent RNA polymerase. Journal of General Virology 80, 799-809.[Abstract]
Ypma-Wong, M. F., Filman, D. J., Hogle, J. M. & Semler, B. L. (1988). Structural domains of the poliovirus polyprotein are major determinants for proteolytic processing at GlnGly pairs. Journal of Biological Chemistry 263, 17846-17856.
Received 2 February 2001;
accepted 22 March 2001.
This article has been cited by other articles:
![]() |
J. Jovel, M. Walker, and H. Sanfacon Recovery of Nicotiana benthamiana Plants from a Necrotic Response Induced by a Nepovirus Is Associated with RNA Silencing but Not with Reduced Virus Titer J. Virol., November 15, 2007; 81(22): 12285 - 12297. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Han and H. Sanfacon Tomato Ringspot Virus Proteins Containing the Nucleoside Triphosphate Binding Domain Are Transmembrane Proteins That Associate with the Endoplasmic Reticulum and Cofractionate with Replication Complexes J. Virol., December 6, 2002; 77(1): 523 - 534. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |