|
|
||||||||
Animal: RNA Viruses |
Department of Human Retrovirology, Academic Medical Center, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands1
Amsterdam Institute of Viral Genomics, Amsterdam, The Netherlands2
Author for correspondence: Rui Mang. Fax +31 20 5669062. e-mail r.mang{at}amc.uva.nl
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
Recently, three distinct classes of full-length PERV sequences, designated PERV-A, -B and -C, were found in the pig genome (Patience et al., 1997
; Le Tissier et al., 1997
; Akiyoshi et al., 1998
). PERV-A, -B and -C all belong to the mammalian type C retrovirus group and are closely related to each other in the gag and pol genes but differ in their env genes, especially in the region encoding the surface component (Takeuchi et al., 1998
). Aside from pig cell lines, PERV-A and -B can infect several human cell lines in vitro, but PERV-C can replicate only in porcine cells (Takeuchi et al., 1998
; Czauderna et al., 2000
). Tests based on DNA, RNA and protein technology to provide evidence of pig-to-human PERV transmission have been performed on recent recipients of living pig tissue or organs. As yet, no pig-to-human transmission has been observed (Paradis et al., 1999
; Patience et al., 1998a
; Heneine et al., 1998
), but concern remains.
Since vertebrate genomes may contain several endogenous retrovirus sequences, we examined the pig genome for the existence of additional endogenous retroviruses. Total genomic DNA was extracted from pig peripheral blood mononuclear cells using a procedure with silica and guanidium thiocyanate (Boom et al., 1990
). PCR amplifications were performed with an upstream, 5' TGGACTCGACTTCCCCAGGG 3', and a downstream, 5' TATAGCGGCCGCAGGAGGTCATCTACATA 3', primer set derived from the most conserved region of the baboon endogenous virus (BaEV) reverse transcriptase (RT) gene. Denaturation for 5 min at 94 °C was followed by 10 cycles of amplification for 1 min at 94 °C, 2 min at 45 °C and 3 min at 72 °C. After an additional 30 cycles of amplification for 30 s at 94 °C, 1 min at 55 °C and 1 min at 72 °C, there was a final extension step of 10 min at 72 °C. The target fragment of approximately 130 bp long was cloned into the pCRII-TOPO vector (Invitrogen). A total of 24 clones was sequenced and two distinct RT sequences, which we named PS0 and PS1, were identified. At the nucleotide level, PS1 shows 98% similarity to the RT gene of known PERVs, indicating that PS1 is derived from one of the provirus PERV sequences. No known virus had more than 90% similarity to the RT fragment of clone PS0. Taken together, these results suggested that, aside from the known PERVs, at least one other endogenous retrovirus is present in the pig genome.
About 60000 lambda phage plaques from a domestic pig genomic library (Stratagene) were screened by using a [
-32P]dCTP-labelled PS0 RT fragment. A total of 16 positive clones was identified. The inserts of two positive clones, P1.1 and P14.1, were sequenced completely and P14.1 was found to contain a novel, complete retrovirus sequence of 8072 nt, which we named PERV-E (GenBank accession no. AF356697). The genomic organization of PERV-E is identical to that of all known simple retroviruses in that the gag, pol and env genes are flanked by 5' and 3' long terminal repeats (LTRs). Genomic clone P1.1 contained a PERV-E-like provirus sequence (GenBank accession no. AF356698), but part of the virus genome from the 5' LTR to the 3' end of the gag untranslated region is missing. However, the remaining 7130 nt of the provirus sequence showed a high level of nucleotide similarity (90%) to the provirus sequence from clone P14.1, including a very similar 3' LTR.
The virus sequence identified from P14.1 contains two LTRs, 434 and 431 nt at the 5' and 3' end, respectively. The P14.1 LTR sequence could not be aligned with any other retrovirus LTR, but consensus sequences of basic regulatory elements, for example, a TATA box and a polyadenylation site, were present. The 5' LTR of P14.1 is followed by a primer-binding site complementary to the 3' end of human tRNAGly, which is also used to initiate virus amplification of PERV-A and -B.
Comparison with other retroviruses, for example, Moloney murine leukaemia virus (MoMLV) and HERV 4-1, identified the gag, pol and env open reading frames (ORFs) of P14.1 and P1.1. All ORFs of these two clones were full-length, but they were interrupted by multiple premature stop codons and frame-shift mutations. However, amino acid sequences could be estimated by comparing them to homologous genes of exogenous retroviruses. The gag ORF of clone P14.1 probably starts with the ATG codon at nt 1059 and ends with a stop codon at nt 2618. The pol ORF of clone P14.1 probably ranges from nt 2619 to 6236. The env ORF of P14.1 probably starts from the ATG codon at nt 6093 (overlapping the 3' end of the pol gene by 147 nt) and ends at the stop codon at nt 7622.
To estimate the level of divergence between PERV-E and other retroviruses, gag, pol and env amino acid sequences from various mammalian type C retroviruses, including BaEV and gibbon ape leukaemia virus (GALV) (nonhuman primates), MoMLV (mice), feline leukaemia virus (FeLV) (cats), PERV-B and -C (pigs), two strains of the HERV-E family (GenBank accession no. AL023280 and HERV 4-1), as well as four type D viruses (monkeys), simian retrovirus (SRV) types 1 and 2, simian sarcoma virus (SMRV) and simian endogenous retrovirus (SERV), were aligned with the estimated gag, pol and env amino acid sequences of PERV-E using CLUSTAL W (Thompson et al., 1994
). Phylogenetic analyses were performed with the neighbour-joining (NJ) method based on P distance (Kimura, 1980
), as implemented in the MEGA package (Kumar et al., 1993
). A total of 100 bootstrap replicates was analysed. In the resulting gag and pol phylogenetic trees (Fig. 1a
, b
), we found two main clusters, representing type C and D retroviruses. The type C cluster contained two subclusters. In the first subcluster, MoMLV and FeLV are closely related to each other and cluster together with BaEV; PERVs and GALV were also found in this subcluster. Interestingly, the gag and pol genes of P14.1 and P1.1 are closely related to those of HERV 4-1 and AL023280 and together they form the second type C subcluster, with a high bootstrap value (100). In the env phylogenetic tree (Fig. 1c
), P14.1, P1.1 and HERV-E are only distantly related to the env genes of other type C and D retroviruses; they formed a completely distinct cluster with a high bootstrap value (100). Analysis of the env genes of all other retrovirus groups, including the avian type C, mammalian type B and human T-cell leukaemia virus groups, as well as lentiviruses and spumaviruses, suggested that there was no significant homology between any env gene and the PERV-E env gene. Within the transmembrane region of Env, a 26 residue immunosuppressive polypeptide fragment is highly conserved among retroviruses, especially type C and D retroviruses (Cianciolo et al., 1984
; Schulz et al., 1992
). A similar peptide is found in the P14.1, P1.1, HERV 4-1 and AL023280 transmembrane regions (Fig. 1d
). Alignment of this peptide sequence with reference sequences indicated, again, that the env genes of PERV-E and HERV 4-1-like viruses are only distantly related to the env genes of type C and D retroviruses. Comparison of the gag, pol and env ORFs of HERV 4-1 and P14.1 showed that they shared 62, 68 and 61% identity at the amino acid level, respectively.
|
|
|
Previously, Patience et al. (1997)
and Akiyoshi et al. (1998)
reported that the provirus copy number of PERV-A/B and PERV-C was approximately 50 and between 8 and 15 in the pig genome, respectively. These copy numbers, which were determined by Southern blotting using PERV pol or env gene-derived probes, are much higher than the copy numbers reported by us, which were estimated using limiting dilution and nested PCR. Since the specificity of gene hybridization is less than that of PCR amplification, it is possible that the copy number determined by using gene hybridization was overestimated due to cross hybridization.
Domestication of the pig is estimated to have occurred less than 5000 years ago, with the wild boar being the most likely ancestor of our modern breeds (Rothschild & Ruvinsky, 1998
). Surprisingly, all domesticated pig breeds contain much higher copy numbers of PERV-E and PERV proviruses than the wild pig, suggesting that copy numbers have increased during (in)breeding. Most probably, PERV-C has arisen in modern breeding times, as it is absent from the wild pig genome. However, it must be noted that only a single wild boar has been tested in our study.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Auchincloss, H.Jr & Sachs, D. H. (1998). Xenogeneic transplantation. Annual Review of Immunology 16, 433-470.[Medline]
Bengtsson, A., Svalander, C. T., Mölne, J., Rydberg, L. & Breimer, M. E. (1998). Extracorporeal (ex vivo) connection of pig kidneys to humans. III. Studies of plasma complement activation and complement deposition in the kidney tissue. Xenotransplantation 5, 176-183.[Medline]
Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M. & Noordaa, J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.
Bosch, S., Arnauld, C. & Jestin, A. (2000). Study of full-length porcine endogenous retrovirus genomes with envelope gene polymorphism in a specific-pathogen-free Large White swine herd. Journal of Virology 74, 8575-8581.
Cianciolo, G. J., Kipnis, R. J. & Snyderman, R. (1984). Similarity between p15E of murine and feline leukaemia viruses and p21 of HTLV. Nature 311, 515.[Medline]
Czauderna, F., Fischer, N., Boller, K., Kurth, R. & Tonjes, R. (2000). Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. Journal of Virology 74, 4028-4038.
Deacon, T., Schumacher, J., Dinsmore, J., Thomas, C., Palmer, P., Kott, S., Edge, A., Penney, D., Kassissieh, S., Dempsey, P. & Isacson, O. (1997). Histological evidence of fetal pig neural cell survival after transplantation into a patient with Parkinsons disease. Nature Medicine 3, 350-353.[Medline]
Groth, C. G., Korsgren, O., Tibell, A., Tollemar, J., Möller, E., Bolinder, J., Ostman, J., Reinholt, F. P., Hellerström, C. & Andersson, A. (1994). Transplantation of porcine fetal pancreas to diabetic patients. Lancet 344, 1402-1404.[Medline]
Heneine, W., Tibell, A., Switzer, W. M., Sandstrom, P., Rosales, G. V., Mathews, A., Korsgren, O., Chapman, L. E., Folks, T. M. & Groth, C. G. (1998). No evidence of infection with porcine endogenous retrovirus in recipients of porcine islet-cell xenografts. Lancet 352, 695-699.[Medline]
Kimura, M. A. (1980). A simple method for estimating evolutionary rate of base substitution through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]
Kumar, S., Tamura, K. & Nei, M. (1993). MEGA: Molecular Evolutionary Genetics Analysis, version 1.01. The Pennsylvania State University, University Park, PA, USA.
Le Tissier, P., Stoye, J. P., Takeuchi, Y., Patience, C. & Weiss, R. A. (1997). Two sets of human-tropic pig retrovirus. Nature 389, 681-682.[Medline]
Mang, R., Goudsmit, J. & van der Kuyl, A. C. (1999). Novel endogenous type C retrovirus in baboons: complete sequence, providing evidence for baboon endogenous virus gagpol ancestry. Journal of Virology 73, 7021-7026.
Ouspenskaia, M. V., Johnston, D. A., Roberts, W. M., Estrov, Z. & Zipf, T. F. (1995). Accurate quantitation of residual B-precursor acute lymphoblastic leukemia by limiting dilution and a PCR-based detection system: a description of the method and the principles involved. Leukemia 9, 321-328.[Medline]
Paradis, K., Langford, G., Long, Z., Heneine, W., Sandstrom, P., Switzer, W. M., Chapman, L. E., Lockey, C., Onions, D. & Otto, E. (1999). Search for cross-species transmission of porcine endogenous retrovirus in patients treated with living pig tissue. Science 285, 1236-1241.
Patience, C., Takeuchi, Y. & Weiss, R. A. (1997). Infection of human cells by an endogenous retrovirus of pigs. Nature Medicine 3, 282-286.[Medline]
Patience, C., Patton, G. S., Takeuchi, Y., Weiss, R. A., McClure, M. O., Rydberg, L. & Breimer, M. E. (1998a). No evidence of pig DNA or retroviral infection in patients with short-term extracorporeal connection to pig kidneys. Lancet 352, 699-701.[Medline]
Patience, C., Takeuchi, Y. & Weiss, R. A. (1998b). Zoonosis in xenotransplantation. Current Opinion in Immunology 10, 539-542.[Medline]
Rodrigo, A. G., Goracke, P. C., Rowhanian, K. & Mullins, J. I. (1997). Quantitation of target molecules from polymerase chain reaction-based limiting dilution assays. AIDS Research and Human Retroviruses 13, 737-742.[Medline]
Rothschild, M. F. & Ruvinsky, A. (1998). The Genetics of the Pig. New York: CAB International.
Schulz, T. F., Jameson, B. A., Lopalco, L., Siccardi, A. G., Weiss, R. A. & Moore, J. P. (1992). Conserved structural features in the interaction between retroviral surface and transmembrane glycoproteins? AIDS Research and Human Retroviruses 8, 1571-1580.[Medline]
Sykes, P. J., Neoh, S. H., Brisco, M. J., Hughes, E., Condon, J. & Morley, A. A. (1992). Quantitation of targets for PCR by use of limiting dilution. Biotechniques 13, 444-449.[Medline]
Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P. & Stoye, J. P. (1998). Host range and interference studies of three classes of pig endogenous retrovirus. Journal of Virology 72, 9986-9991.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
van der Kuyl, A. C. & Goudsmit, J. (1999). Xenotransplantation: about baboon hearts and pig livers. Trends in Microbiology 6, 431-432.
van der Kuyl, A. C., Mang, R., Dekker, J. T. & Goudsmit, J. (1997). Complete nucleotide sequence of simian endogenous type D retrovirus with intact genome organization: evidence for ancestry to simian retrovirus and baboon endogenous virus. Journal of Virology 71, 3666-3676.[Abstract]
Weiss, R. A. (1998). Transgenic pigs and virus adaptation. Nature 391, 327-328.[Medline]
Weiss, R. A. (1999). Xenografts and retroviruses. Science 285, 1221-1222.
Received 18 December 2000;
accepted 27 March 2001.
This article has been cited by other articles:
![]() |
N. Klymiuk, M. Muller, G. Brem, and B. Aigner Phylogeny, recombination and expression of porcine endogenous retrovirus {gamma}2 nucleotide sequences. J. Gen. Virol., April 1, 2006; 87(Pt 4): 977 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bartosch, D. Stefanidis, R. Myers, R. Weiss, C. Patience, and Y. Takeuchi Evidence and Consequence of Porcine Endogenous Retrovirus Recombination J. Virol., December 15, 2004; 78(24): 13880 - 13890. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Klymiuk, M. Muller, G. Brem, and B. Aigner Recombination analysis of human-tropic porcine endogenous retroviruses J. Gen. Virol., October 1, 2003; 84(10): 2729 - 2734. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Scheef, N. Fischer, E. Flory, I. Schmitt, and R. R. Tonjes Transcriptional Regulation of Porcine Endogenous Retroviruses Released from Porcine and Infected Human Cells by Heterotrimeric Protein Complex NF-Y and Impact of Immunosuppressive Drugs J. Virol., November 13, 2002; 76(24): 12553 - 12563. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Klymiuk, M. Muller, G. Brem, and B. Aigner Characterization of Porcine Endogenous Retrovirus {gamma}pro-pol Nucleotide Sequences J. Virol., October 11, 2002; 76(22): 11738 - 11743. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Lee, G. C. Webb, R. D. M. Allen, and C. Moran Characterizing and Mapping Porcine Endogenous Retroviruses in Westran Pigs J. Virol., May 3, 2002; 76(11): 5548 - 5556. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |