|
|
||||||||
Animal: DNA Viruses |
Departments of Microbiology & Immunology1, Pediatrics, and Epidemiology & Social Medicine2, Comprehensive Cancer Center, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York, 10461, USA
Author for correspondence: Robert Burk. Fax +1 718 430 8975. e-mail burk{at}aecom.yu.edu
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
We have isolated and characterized a novel genital HPV type that was amplified and cloned from cervicovaginal cells obtained from a 37-year-old Hispanic woman with cervical intraepithelial neoplasia grade 1 (CIN1) by the overlapping PCR method (Terai & Burk, 2001
). The overlapping PCR method is a technique which facilitates the complete characterization of HPV DNA from specimens with low copy numbers. Here, we describe candHPV86, a novel HPV genome, and present the complete nucleotide sequence, genome organization, predicted proteins and phylogenetic analyses.
The clinical sample was found to be HPV DNA-positive by PstI cleavage and Southern blot bybridization but not by MY09/MY11 amplification during the course of a clinical study (Burk et al., 1996
; Ho et al., 1998
). To further characterize this HPV genome, amplification with the GP5+/6+ primers was performed and the PCR product was sequenced (de Roda Husman et al., 1995
). The initial overlapping PCR primers were designed by alignment of closely related HPV genomes determined by basic local alignment sequence tool (BLAST) analysis using the sequence of the partial L1 region. Additional primers were designed to amplify the entire genome in two large fragments. Two sets of primers were designed (Fig. 1a
): for amplification of fragment no. 1, forward primer 1-F (5' TTTTACTATTAGTGCCGCTAC 3') and reverse primer 1-R (5' GCATCTAAACGATCGGCTAG 3'); and for amplification of fragment no. 2, forward primer, 2-F (5' GTATGGCAATACGCAGGTGG 3') and reverse primer, 2-R (5' AGAGGGGTCATATTCAGAGG 3'). Amplification was performed using either Gold Taq DNA polymerase (Perkin-Elmer Applied Biosystems) or an equal mixture of Gold Taq and Pwo DNA polymerase (Platinum Taq DNA Polymerase High Fidelity, Gibco-BRL). Pwo polymerase has an inherent 3'
5' exonuclease proofreading activity. The PCR products were separated by electrophoresis in agarose gels, stained with ethidium bromide, and visualized under ultraviolet (UV) illumination. After confirmation of appropriate product size, each PCR product was purified (Qiagen Gel Extraction Kit, Qiagen) and ligated into the pGEM-T Easy vector (Promega) according to the manufacturers instructions. To determine the nucleotide sequence, each DNA insert was initially sequenced using SP6 and T7 primers flanking the HPV insert. Additional primers were designed by sequence walking (Delius & Hofmann, 1994
). Sequencing was performed on an ABI Prism Model 377 automated sequencer (Perkin-Elmer Applied Biosystems) in the Einstein DNA sequencing core facility. The sequence of the overlapping fragments was assembled manually and confirmed by sequencing the complementary strand. Several additional primers were designed and used to clarify sequence ambiguities. Once assembled, the sequence was analysed for homology to other HPVs using the BLAST software (Altschul et al., 1997
). The same software was used to determine protein sequence homologies. Phylogenetic trees were created using HPV published sequences available from the Human Papillomaviruses Compendiums On Line (http://www.stdgen.lanl.gov/stdgen/virus/hpv/compendium/htdocs) and GenBank. Phylogenetic trees were derived from individual ORFs and long control regions (LCRs) to determine the relationship of candHPV86 to the available HPV sequences using public domain software (Higgins & Sharp, 1988
).
|
The candHPV86 genome displayed the same ORF distribution and potential genes found in other sequenced HPV types. The predicted ORFs are summarized in Table 1
(a). Table 1(b)
shows the homology of putative candHPV86 proteins to the analogous proteins of several closely related HPV types identified by BLAST searches. The candHPV86 proteins were closely related to HPVHAN2294, HPV84, HPV61, HPV72 and HPV83 proteins.
|
|
Comparison of the LCRs from candHPV86, HPVHAN2294 and HPV84 are shown in Fig. 2(b)
. Papillomavirus LCRs contain multiple binding sites for transcriptional regulatory factors including AP-1 (Chan et al., 1990
), NF-1 (Apt et al., 1993
), SP-1 (Gloss & Bernard, 1990
), transcriptional enhancer factor (TEF)-1 (Ishiji et al., 1992
) and YY-1 (Dong et al., 1994
; May et al., 1994
). The candHPV86 LCR contains many of these canonical binding sites. The E6/E7 promoter TATA box was identified at positions 79407946, 38 bases upstream from the start codon of the E6 ORF.
Papillomavirus ORIs typically contain an E1-binding site between two E2-binding sites (ACCN6GGT) (Brown et al., 1999
; Chow & Leong, 1999
; Lu et al., 1993
; Sun et al., 1996
). The candHPV86 LCR contains three exact E2-binding sites and four E2-binding sites with one base mismatch. A closely related, putative E1-binding site (one base mismatch; candHPV86 and HPVHAN2294 at position 7867 and 7994, respectively) was found within both candHPV86 and HPVHAN2294 LCRs. In addition, there are two TEF-1 sites and a single poly(A) signal. Although the candHPV86 LCR is closely related to the LCR from HPVHAN2294 (73·5%) and HPV84 (73·2%), the organization of many regulatory elements is different, as shown in Fig. 2(b)
.
candHPV86 was cloned from a clinical specimen by use of the overlapping PCR method (Terai & Burk, 2001
). The overlapping PCR technique facilitates obtaining full-length sequences of HPVs from samples with low copy numbers. The sequence of candHPV86 was generated using polymerases with low sequence error rates and all predicted ORFs were intact; however, an error rate less than 1 per 1000 cannot be excluded. Novel HPV types are still emerging, and the clinical significance of such types is unknown. The prevalence of candHPV86 and its association with cervicovaginal neoplasia could not be determined since this genome was not amplified with the MY09/MY11 PCR system (MY09 primer, four bases mismatch at position 70477066; MY11 primer, three bases mismatch at position 66156634, respectively). The candHPV86-containing phylogenetic branch within the A3 clade includes HPV84 and HPVHAN2294. HPV84 is a highly prevalent type detected in normal and human immunodeficiency virus (HIV)-1 infected women (Terai & Burk, 2001
). HPVHAN2294 is similar to HPV partial sequences, uwCerv274-XS4b (98% homology) and HPVXS4 (96% homology), which were detected in the genital tract of an HIV-infected woman and from a hyperkeratotic papilloma on the forearm of a renal transplant recipient, respectively (Berkhout et al., 2000
). Based on the phylogenetic tree analysis, it is postulated that candHPV86 is associated with low grade cervical lesions. Detailed characterization of HPV genomes, HPV variants and their organization and comparative analysis of nucleotide and amino acid sequences of viral genes and predicted proteins should provide insight into their biological and clinical behaviour.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Apt, D., Chong, T., Liu, Y. & Bernard, H. U. (1993). Nuclear factor and epithelial cell-specific transcription of human papillomavirus type 16. Journal of Virology 67, 4455-4463.
Berkhout, R. J. M., Bouwes Bavinck, J. N. & ter Schegget, J. (2000). Persistence of human papillomavirus DNA in benign and (pre)malignant skin lesions from renal transplant recipients. Journal of Clinical Microbiology 38, 2087-2096.
Bosch, F. X., Manos, M. M., Munoz, N., Sherman, M., Jansen, A. M., Peto, J., Schiffman, M. H., Moreno, V., Kurman, R. & Shah, K. V. (1995). Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. Journal of the National Cancer Institute 87, 796-802.
Brown, D. R., McClowry, T. L., Woods, K. & Fife, K. H. (1999). Nucleotide sequence and characterization of human papillomavirus type 83, a novel genital papillomavirus. Virology 260, 165-172.[Medline]
Burk, R. D., Ho, G. Y. F., Beardsley, L., Lempa, M., Peters, M. & Bierman, R. (1996). Sexual behavior and partner characteristics are the predominant risk factors for genital human papillomavirus infection in young women. Journal of Infectious Diseases 174, 679-689.[Medline]
Chan, W. K., Chong, T., Bernard, H. U. & Klock, G. (1990). Transcription of the transforming genes of the oncogenic human papillomavirus-16 is stimulated by tumor promoters through AP1 binding sites. Nucleic Acids Research 18, 763-769.
Chan, S. Y., Delius, H., Halpern, A. L. & Bernard, H. U. (1995). Analysis of genomic sequences of 95 papillomavirus types: uniting typing, phylogeny, and taxonomy. Journal of Virology 69, 3074-3083.[Abstract]
Chow, V. T. K. & Leong, P. W. F. (1999). Complete nucleotide sequence, genomic organization and phylogenetic analysis of a novel genital human papillomavirus type, HLT7474-S. Journal of General Virology 80, 2923-2929.
Delius, H. & Hofmann, B. (1994). Primer-directed sequencing of human papillomavirus types. Current Topics in Microbiology and Immunology 186, 13-31.[Medline]
Delius, H., Saegling, B., Bergmann, K., Shamanin, V. & de Villiers, E. M. (1998). The genome of three of four novel HPV types, defined by differences of their L1 genes, show high conservation of the E7 gene and the URR. Virology 240, 359-365.[Medline]
de Roda Husman, A.-M., Walboomers, J. M. M., van den Brule, A. J. C., Meijer, C. J. L. M. & Snijders, P. J. F. (1995). The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. Journal of General Virology 76, 1057-1062.
Dong, X. P., Stubenrauch, F., Beyer-Finkler, E. & Pfister, H. (1994). Prevalence of deletions of YY1-binding sites in episomal HPV16 DNA from cervical cancers. International Journal of Cancer 58, 803-808.
Gloss, B. & Bernard, H. U. (1990). The E6/E7 promoter of human papillomavirus type 16 is activated in the absence of E2 proteins by a sequence-aberrant Sp1 distal element. Journal of Virology 64, 5577-5584.
Higgins, D. G. & Sharp, P. M. (1988). CLUSTAL: a package for performing multiple sequence alignments on a microcomputer. Gene 73, 237-244.[Medline]
Ho, G. Y. F., Bierman, R., Beardsley, L., Chang, C. J. & Burk, R. D. (1998). Natural history of cervicovaginal papillomavirus infection in young women. New England Journal of Medicine 338, 423-428.
Ishiji, T., Lace, M. J., Parkkinen, S., Anderson, R. D., Haugen, T. H., Cripe, T. P., Xiao, J. H., Davidson, I., Chambon, P. & Turek, L. P. (1992). Transcriptional enhancer factor (TEF)-1 and its cell-specific co-activator activate human papillomavirus-16 E6 and E7 oncogene transcription in keratinocytes and cervical carcinoma cells. EMBO Journal 11, 2271-2281.[Medline]
Lu, J. Z., Sun, Y. N., Rose, R. C., Bonnez, W. & McCance, D. J. (1993). Two E2 binding sites (E2BS) alone or one E2BS plus an A/T-rich region are minimal requirements for the replication of the human papillomavirus type 11 origin. Journal of Virology 67, 7131-7139.
May, M., Dong, X. P., Beyer-Finkler, E., Stubenrauch, F., Fuchs, P. G. & Pfister, H. (1994). The E6 and E7 promoter of extrachromosomal HPV16 DNA in cervical cancers escapes from cellular repression by mutation of target sequences for YY1. EMBO Journal 13, 1460-1466.[Medline]
Sun, Y. N., Lu, J. Z. & McCance, D. J. (1996). Mapping of HPV11 E1 binding site and determination of other important cis elements for replication of the origin. Virology 216, 219-222.[Medline]
Sundberg, J. P., van Ranst, M., Burk, R. D. & Jenson, A. B. (1994). The nonhuman (animal) papillomaviruses: host range, epitope conservation, and molecular diversity. In Human Papillomavirus Infections in Dermatovenereology. Edited by G. Gross & G. von Krogh. Boca Raton: CRC Press.
Terai, M. & Burk, R. D. (2001). Complete nucleotide sequence and analysis of a novel human papillomavirus (HPV84) genome cloned by an overlapping PCR method. Virology 279, 109-115.[Medline]
Received 4 April 2001;
accepted 1 June 2001.
This article has been cited by other articles:
![]() |
M. Ortiz, M. Torres, L. Munoz, E. Fernandez-Garcia, J. Canals, A. I. Cabornero, E. Aguilar, J. Ballesteros, J. del Amo, and A. Garcia-Saiz Oncogenic Human Papillomavirus (HPV) Type Distribution and HPV Type 16 E6 Variants in Two Spanish Population Groups with Different Levels of HPV Infection Risk J. Clin. Microbiol., April 1, 2006; 44(4): 1428 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, M. Terai, L. Fu, R. Herrero, R. DeSalle, and R. D. Burk Diversifying Selection in Human Papillomavirus Type 16 Lineages Based on Complete Genome Analyses J. Virol., June 1, 2005; 79(11): 7014 - 7023. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Menzo, A. Monachetti, C. Trozzi, A. Ciavattini, G. Carloni, P. E. Varaldo, and M. Clementi Identification of Six Putative Novel Human Papillomaviruses (HPV) and Characterization of Candidate HPV Type 87 J. Virol., December 1, 2001; 75(23): 11913 - 11919. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |