|
|
||||||||
Animal: RNA Viruses |
INSERM U503, Immunobiologie Fondamentale et Clinique1 and INSERM U404, Immunité et Vaccination, CERVI2, 21 Av. Tony Garnier, 69365 Lyon, France
Author for correspondence: Branka Horvat (at CERVI). Fax +33 437 28 23 91. e-mail horvat{at}cervi-lyon.inserm.fr
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
In order to investigate the importance of the level of expression of the MV receptor and to analyse the nature of the different sensitivity to MV infection of human and murine cells, we have compared distinct steps of the MV (Hallé strain) life-cycle in activated human peripheral blood lymphocytes (PBL) and activated CD46-transgenic murine splenocytes obtained from three transgenic lines expressing different levels of CD46: MCP-3, MCP-7 (Horvat et al., 1996
; Evlashev et al., 2000
) and MCP-B (Thorley et al., 1997
).
Firstly, we analysed CD46 expression on murine and human lymphocytes. Human PBL were obtained from donor blood after Ficoll and Percoll density centrifugation and activated for 2 days with 5 µg/ml anti-CD3 MAb (OKT3) and human recombinant IL-2 (5 U/ml) in RPMI 1640, 10% FCS. Splenocytes from wild-type and CD46-transgenic murine lines were purified and activated by mixed lymphocyte reaction or by anti-CD3 MAb and IL-2 and cultured as described previously (Horvat et al., 1996
). These activation procedures preferentially activate and expand T lymphocytes, which represent a predominant cell population used in all our experiments. Two days after activation, cells were stained for CD46 expression (Fig. 1A
). The level of CD46 on activated human PBL was equivalent to the expression detected on the MCP-B line. MCP-7 and MCP-3 expressed approximately 5 and 50 times less CD46 than did MCP-B, corresponding to what has been described previously with non-activated lymphocytes (Horvat et al., 1996
; Thorley et al., 1997
).
|
We next measured virus entry into lymphocytes 3 h after infection by real-time PCR (LightCycler, Roche). Activated cells, infected as above, were additionally subjected to 30 min Pronase digestion to ensure elimination of virus from the cell surface, which was confirmed by virus-binding assay (Naniche et al., 1992
). Total RNA was isolated and cDNA was prepared using 3' primers specific for glyceraldehyde-3-phosphate dehydrogenase (G3PDH), as described previously (Horvat et al., 1996
), and for the MV F gene (5' GCTTCCCTCTGGCCGAACAATATCG 3') in the same reaction. In order to amplify genomic viral RNA, cDNA was analysed by PCR using CYBR green I fluorescent dye and primers specific for the H gene (Horvat et al., 1996
), which is located downstream of F in the viral genome. We performed PCR specific for H and G3PDH in MV-infected human PBL, non-transgenic BALB/c lymphocytes or lymphocytes obtained from the three CD46-transgenic lines. The cycle number when the PCR product was first detected (crossing point), being inversely proportional to the relative abundance of the target sequence, was determined in two different experiments. The specificity of the amplified product was confirmed by melting-curve analysis, which demonstrated the presence of a single peak for each of the two PCRs, and by gel electrophoresis, where bands of the expected sizes (377 bp for H and 529 bp for G3PDH) were detected (data not shown). Our results indicate that the abundance of MV-specific template correlated with the CD46 expression level: similar quantities of the H product (crossing points 25·6 and 25·7, respectively) were detected in human cells and in the MCP-B transgenic line, suggesting that virus entry was equivalent in the two cell types. Lower amplification of H was detected in MCP-7 (28·0), MCP-3 (29·8) and non-transgenic (33·6) lymphocytes. Finally, the G3PDH target sequence was present in similar amounts in all samples tested (crossing point between 12·9 and 13·9), indicating similar conditions for cDNA synthesis in all samples tested. Altogether, these results suggest that the first steps of MV infection in MCP-B murine lymphocytes, expressing the highest level of CD46, are as efficient as in human lymphocytes.
Viral mRNA production in infected cells was studied by Northern blot hybridization. Cells activated as above were harvested 48 h after MV infection and 15 µg total RNA was resolved on a formaldehydeagarose gel, transferred to a Hybond-N membrane, hybridized with a 32P-labelled, nucleoprotein (NP)-specific DNA probe, stripped and finally rehybridized with a
-actin-specific probe (Horvat et al., 1996
), which cross-reacts with murine and human mRNA. Blots were exposed to a PhosphorImager screen (Molecular Dynamics) and the resulting images were quantified by using the ImageQuant software (Fig. 2A
). NP mRNA was observed in all CD46-transgenic murine lines. However, the relative level of NP after normalization for
-actin mRNA expression in all three transgenic lines (0·050·07) was much lower than in human cells (5). Similar results were observed for H-specific mRNA (data not shown). Although the level of NP expression followed the initial level of CD46 expression in murine cells (Fig. 1
), it was much lower compared with human lymphocytes, suggesting the existence of murine factors that limit/inhibit MV replication after virus entry.
|
Finally, production of infectious particles was analysed as described previously (Horvat et al., 1996
). Briefly, T lymphocytes infected as above were harvested at different time-points after MV infection and serial dilutions of lymphocytes were co-cultured with highly permissive Vero cells. Cytopathic effect resulting in formation of lytic plaques (p.f.u.) was determined 4 days later. For all three CD46 murine lines, production of infectious particles peaked at 48 h after infection and was at least 10 times lower than that for human PBL (Fig. 3
). These results showed that the initial difference between the transgenic lines, related to the level of CD46 expression, was lost in the later steps of MV replication, arguing against the critical importance of high expression of the MV receptor in obtaining efficient MV replication in transgenic murine lymphocytes. However, the species difference was greatly increased, correlating with greater production of MV-specific mRNA and viral proteins in human compared with murine lymphocytes.
|
/
receptor-deficient background (Mrkic et al., 1998| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Browning, J., Horner, J. W., Pettoello-Mantovani, M., Raker, C., Yurasov, S., DePinho, R. A. & Goldstein, H. (1997). Mice transgenic for human CD4 and CCR5 are susceptible to HIV infection. Proceedings of the National Academy of Sciences, USA 94, 14637-14641.
Dorig, R. E., Marcil, A., Chopra, A. & Richardson, C. D. (1993). The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 75, 295-305.[Medline]
Evlashev, A., Moyse, E., Valentin, H., Azocar, O., Trescol-Biemont, M. C., Marie, J. C., Rabourdin-Combe, C. & Horvat, B. (2000). Productive measles virus brain infection and apoptosis in CD46 transgenic mice. Journal of Virology 74, 1373-1382.
Horvat, B., Rivailler, P., Varior-Krishnan, G., Cardoso, A., Gerlier, D. & Rabourdin-Combe, C. (1996). Transgenic mice expressing human measles virus (MV) receptor CD46 provide cells exhibiting different permissivities to MV infection. Journal of Virology 70, 6673-6681.
Moyer, S. A., Baker, S. C. & Horikami, S. M. (1990). Host cell proteins required for measles virus reproduction. Journal of General Virology 71, 775-783.
Mrkic, B., Pavlovic, J., Rulicke, T., Volpe, P., Buchholz, C. J., Hourcade, D., Atkinson, J. P., Aguzzi, A. & Cattaneo, R. (1998). Measles virus spread and pathogenesis in genetically modified mice. Journal of Virology 72, 7420-7427.
Murray, C. J. & Lopez, A. D. (1997). Mortality by cause for eight regions of the world: Global Burden of Disease Study. Lancet 349, 1269-1276.[Medline]
Naniche, D., Wild, T. F., Rabourdin-Combe, C. & Gerlier, D. (1992). A monoclonal antibody recognizes a human cell surface glycoprotein involved in measles virus binding. Journal of General Virology 73, 2617-2624.
Naniche, D., Varior-Krishnan, G., Cervoni, F., Wild, T. F., Rossi, B., Rabourdin-Combe, C. & Gerlier, D. (1993). Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. Journal of Virology 67, 6025-6032.
Niewiesk, S., Schneider-Schaulies, J., Ohnimus, H., Jassoy, C., Schneider-Schaulies, S., Diamond, L., Logan, J. S. & ter Meulen, V. (1997). CD46 expression does not overcome the intracellular block of measles virus replication in transgenic rats. Journal of Virology 71, 7969-7973.[Abstract]
Oldstone, M. B., Lewicki, H., Thomas, D., Tishon, A., Dales, S., Patterson, J., Manchester, M., Homann, D., Naniche, D. & Holz, A. (1999). Measles virus infection in a transgenic model: virus-induced immunosuppression and central nervous system disease. Cell 98, 629-640.[Medline]
Rall, G. F., Manchester, M., Daniels, L. R., Callahan, E. M., Belman, A. R. & Oldstone, M. B. (1997). A transgenic mouse model for measles virus infection of the brain. Proceedings of the National Academy of Sciences, USA 94, 4659-4663.
Tatsuo, H., Ono, N., Tanaka, K. & Yanagi, Y. (2000). SLAM (CDw150) is a cellular receptor for measles virus. Nature 406, 893-897.[Medline]
Thorley, B. R., Milland, J., Christiansen, D., Lanteri, M. B., McInnes, B., Moeller, I., Rivailler, P., Horvat, B., Rabourdin-Combe, C., Gerlier, D., McKenzie, I. F. & Loveland, B. E. (1997). Transgenic expression of a CD46 (membrane cofactor protein) minigene: studies of xenotransplantation and measles virus infection. European Journal of Immunology 27, 726-734.[Medline]
Vincent, S., Spehner, D., Manié, S., Delorme, R., Drillien, R. & Gerlier, D. (1999). Inefficient measles virus budding in murine L.CD46 fibroblasts. Virology 265, 185-195.[Medline]
Received 11 April 2001;
accepted 4 June 2001.
This article has been cited by other articles:
![]() |
S. Vincent, I. Tigaud, H. Schneider, C. J. Buchholz, Y. Yanagi, and D. Gerlier Restriction of Measles Virus RNA Synthesis by a Mouse Host Cell Line: trans-Complementation by Polymerase Components or a Human Cellular Factor(s) J. Virol., May 13, 2002; 76(12): 6121 - 6130. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |