J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Evlashev, A.
Right arrow Articles by Horvat, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Evlashev, A.
Right arrow Articles by Horvat, B.
Agricola
Right arrow Articles by Evlashev, A.
Right arrow Articles by Horvat, B.
Journal of General Virology (2001), 82, 2125-2129.
© 2001 Society for General Microbiology


Animal: RNA Viruses

Differential permissivity to measles virus infection of human and CD46-transgenic murine lymphocytes

Alexey Evlashev1, Hélène Valentin1, Pierre Rivailler1, Olga Azocar1, Chantal Rabourdin-Combe1 and Branka Horvat1,2

INSERM U503, Immunobiologie Fondamentale et Clinique1 and INSERM U404, Immunité et Vaccination, CERVI2, 21 Av. Tony Garnier, 69365 Lyon, France

Author for correspondence: Branka Horvat (at CERVI). Fax +33 437 28 23 91. e-mail horvat{at}cervi-lyon.inserm.fr


   Abstract
TOP
Abstract
Main text
References
 
Analysis of measles virus (MV) pathogenesis requires the development of an adequate small animal model of MV infection. In this study, permissivity to MV infection was compared in human and transgenic murine T lymphocytes, expressing different levels of the human MV receptor, CD46. Whereas MV binding and entry correlated with CD46 expression, higher levels of MV replication were always observed in human T lymphocytes. This suggests the existence of intracellular factors, acting posterior to virus entry, that could limit MV replication in murine lymphocytes and should be considered when creating new animal models of MV infection.


   Main text
TOP
Abstract
Main text
References
 
Measles virus (MV) is a morbillivirus that belongs to the order Mononegavirales. MV infection strongly affects the human immune system, leading to impaired lymphocyte function, and is still the major cause of infant mortality in developing countries (Murray & Lopez, 1997Down ). Since humans are the only natural hosts for MV, the study of MV pathogenesis has been hampered by the lack of a convenient animal model. The identification of human CD46, the regulator of complement activation, as a cellular receptor for MV (Naniche et al., 1993Down ; Dorig et al., 1993Down ) has led to the development of CD46-transgenic animals as a possible animal model (Rall et al., 1997Down ; Horvat et al., 1996Down ; Niewiesk et al., 1997Down ; Mrkic et al., 1998Down ; Blixenkrone-Moller et al., 1998Down ; Oldstone et al., 1999Down ; Evlashev et al., 2000Down ), where the major target has been to generate transgenic rodents that express the MV receptor at a level resembling expression in human tissues. Although intracranial injection of MV was efficient in inducing specific pathology in some of these models, peripheral administration of the virus was linked to much lower permissivity and was not associated with any clinical symptom of measles.

In order to investigate the importance of the level of expression of the MV receptor and to analyse the nature of the different sensitivity to MV infection of human and murine cells, we have compared distinct steps of the MV (Hallé strain) life-cycle in activated human peripheral blood lymphocytes (PBL) and activated CD46-transgenic murine splenocytes obtained from three transgenic lines expressing different levels of CD46: MCP-3, MCP-7 (Horvat et al., 1996Down ; Evlashev et al., 2000Down ) and MCP-B (Thorley et al., 1997Down ).

Firstly, we analysed CD46 expression on murine and human lymphocytes. Human PBL were obtained from donor blood after Ficoll and Percoll density centrifugation and activated for 2 days with 5 µg/ml anti-CD3 MAb (OKT3) and human recombinant IL-2 (5 U/ml) in RPMI 1640, 10% FCS. Splenocytes from wild-type and CD46-transgenic murine lines were purified and activated by mixed lymphocyte reaction or by anti-CD3 MAb and IL-2 and cultured as described previously (Horvat et al., 1996Down ). These activation procedures preferentially activate and expand T lymphocytes, which represent a predominant cell population used in all our experiments. Two days after activation, cells were stained for CD46 expression (Fig. 1ADown). The level of CD46 on activated human PBL was equivalent to the expression detected on the MCP-B line. MCP-7 and MCP-3 expressed approximately 5 and 50 times less CD46 than did MCP-B, corresponding to what has been described previously with non-activated lymphocytes (Horvat et al., 1996Down ; Thorley et al., 1997Down ).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. CD46 expression on transgenic murine and human lymphocytes correlates with MV binding. (A) Lymphocytes from three CD46-transgenic murine lines (MCP-3, MCP-7 and MCP-B) and human PBL were activated and analysed by cytofluorometry for CD46, with anti-CD46 biotinylated MAb MCI20.6, followed by streptavidin–PE. Thick lines show anti-CD46 staining; the shaded histograms show isotype-control staining. (B) Alternatively, cells were incubated with either MV or a mock preparation (containing virus-free supernatant from uninfected Vero cells prepared under the same conditions) for 3 h, washed thoroughly and analysed for H by staining with biotinylated anti-H MAb cl55 followed by streptavidin–PE. Thick lines show MV-exposed cells; shaded histograms show mock-treated cells.

 
Binding of MV was then analysed on activated murine lymphocytes and human PBL incubated for 3 h with MV (Hallé strain, 1 p.f.u. per cell). After extensive washing, cells were stained for MV haemagglutinin (H) protein as described previously (Naniche et al., 1993Down ). MV binding was detected on all cells tested and was proportional to levels of initial CD46 expression for each line (Fig. 1 BUp), being virtually equal in the human PBL and the murine MCP-B line.

We next measured virus entry into lymphocytes 3 h after infection by real-time PCR (LightCycler, Roche). Activated cells, infected as above, were additionally subjected to 30 min Pronase digestion to ensure elimination of virus from the cell surface, which was confirmed by virus-binding assay (Naniche et al., 1992Down ). Total RNA was isolated and cDNA was prepared using 3' primers specific for glyceraldehyde-3-phosphate dehydrogenase (G3PDH), as described previously (Horvat et al., 1996Down ), and for the MV F gene (5' GCTTCCCTCTGGCCGAACAATATCG 3') in the same reaction. In order to amplify genomic viral RNA, cDNA was analysed by PCR using CYBR green I fluorescent dye and primers specific for the H gene (Horvat et al., 1996Down ), which is located downstream of F in the viral genome. We performed PCR specific for H and G3PDH in MV-infected human PBL, non-transgenic BALB/c lymphocytes or lymphocytes obtained from the three CD46-transgenic lines. The cycle number when the PCR product was first detected (crossing point), being inversely proportional to the relative abundance of the target sequence, was determined in two different experiments. The specificity of the amplified product was confirmed by melting-curve analysis, which demonstrated the presence of a single peak for each of the two PCRs, and by gel electrophoresis, where bands of the expected sizes (377 bp for H and 529 bp for G3PDH) were detected (data not shown). Our results indicate that the abundance of MV-specific template correlated with the CD46 expression level: similar quantities of the H product (crossing points 25·6 and 25·7, respectively) were detected in human cells and in the MCP-B transgenic line, suggesting that virus entry was equivalent in the two cell types. Lower amplification of H was detected in MCP-7 (28·0), MCP-3 (29·8) and non-transgenic (33·6) lymphocytes. Finally, the G3PDH target sequence was present in similar amounts in all samples tested (crossing point between 12·9 and 13·9), indicating similar conditions for cDNA synthesis in all samples tested. Altogether, these results suggest that the first steps of MV infection in MCP-B murine lymphocytes, expressing the highest level of CD46, are as efficient as in human lymphocytes.

Viral mRNA production in infected cells was studied by Northern blot hybridization. Cells activated as above were harvested 48 h after MV infection and 15 µg total RNA was resolved on a formaldehyde–agarose gel, transferred to a Hybond-N membrane, hybridized with a 32P-labelled, nucleoprotein (NP)-specific DNA probe, stripped and finally rehybridized with a {beta}-actin-specific probe (Horvat et al., 1996Down ), which cross-reacts with murine and human mRNA. Blots were exposed to a PhosphorImager screen (Molecular Dynamics) and the resulting images were quantified by using the ImageQuant software (Fig. 2ADown). NP mRNA was observed in all CD46-transgenic murine lines. However, the relative level of NP after normalization for {beta}-actin mRNA expression in all three transgenic lines (0·05–0·07) was much lower than in human cells (5). Similar results were observed for H-specific mRNA (data not shown). Although the level of NP expression followed the initial level of CD46 expression in murine cells (Fig. 1Up), it was much lower compared with human lymphocytes, suggesting the existence of murine factors that limit/inhibit MV replication after virus entry.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Expression of MV proteins in infected transgenic murine and human lymphocytes. Activated lymphocytes were infected with MV and analysed by Northern blot and cytofluorometry. (A) Relative abundance of MV NP mRNA, calculated as the NP mRNA/{beta}-actin mRNA band volume ratio after Northern blot hybridization with specific NP and {beta}-actin probes, detected by phosphorimager. Results are expressed as means±SD from two experiments. (B) Expression of H protein on MV-infected murine CD46-transgenic and human lymphocytes. Activated murine and human lymphocytes were infected with MV and analysed by flow cytometry for expression of MV H protein (using biotinylated anti-H MAb cl55 followed by streptavidin–PE). Dead cells were excluded from further analysis by propidium iodide staining. Thick lines show MV-infected cells; shaded histograms show cells incubated with UV-inactivated MV. Numbers in the upper-right corners of histograms are the mean fluorescence intensities of the H-positive cell populations. Results are representative of three experiments.

 
MV protein expression on the surface of activated murine and human lymphocytes was analysed by cytofluorometry, 48 h after infection (Fig. 2BUp). As was observed from Northern blot analysis, H expression was much higher in human cells than in murine transgenic lymphocytes. These results were confirmed for the other time-points after MV infection and similar data were obtained when murine T lymphocytes were activated either by anti-CD3 MAb and IL-2 or by mixed lymphocyte reaction (data not shown). F protein expression was also detected in MCP-7 and MCP-B lines, but was generally much lower than that of H protein (data not shown).

Finally, production of infectious particles was analysed as described previously (Horvat et al., 1996Down ). Briefly, T lymphocytes infected as above were harvested at different time-points after MV infection and serial dilutions of lymphocytes were co-cultured with highly permissive Vero cells. Cytopathic effect resulting in formation of lytic plaques (p.f.u.) was determined 4 days later. For all three CD46 murine lines, production of infectious particles peaked at 48 h after infection and was at least 10 times lower than that for human PBL (Fig. 3Down). These results showed that the initial difference between the transgenic lines, related to the level of CD46 expression, was lost in the later steps of MV replication, arguing against the critical importance of high expression of the MV receptor in obtaining efficient MV replication in transgenic murine lymphocytes. However, the species difference was greatly increased, correlating with greater production of MV-specific mRNA and viral proteins in human compared with murine lymphocytes.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Production of infectious particles from MV-infected murine MCP-B ({circ}), MCP-7 ({triangleup}) and MCP-3 ({square}) CD46-transgenic and human ({bullet}) lymphocytes. Lymphocytes from non-transgenic BALB/c mice ({lozenge}) were included as negative controls. Activated lymphocytes were infected with MV (1 p.f.u. per cell) and, at different times after infection, cells were incubated with Vero fibroblasts and the production of lytic plaques was determined 4 days later. The results are expressed as numbers of p.f.u. derived from 106 infected lymphocytes and are representative of three different experiments.

 
Taken together, these results suggest that, although MV binding and entry into murine transgenic T cells can be equivalent to that in human lymphocytes, additional factors limit later steps of MV replication in murine cells. This may reflect a different activation level, less suitable for MV replication, in murine T lymphocytes, which does not approach that of human T cells, regardless of the different activation procedures we tested. The production of and/or sensitivity to IFN type I may be different between human and murine lymphocytes, since CD46-transgenic mice are more permissive to MV infection if crossed into an IFN{alpha}/{beta} receptor-deficient background (Mrkic et al., 1998Down ). Less susceptible intracellular conditions could be related to inefficient MV budding, as has been demonstrated recently for a murine fibroblast line (Vincent et al., 1999Down ), but could implicate some other factors, specific for murine lymphocytes, as different cell proteins were shown to be required for MV replication (Moyer et al., 1990Down ). Although the barriers to MV replication seen in CD46-transgenic lymphocytes do not seem to be as drastic as has been shown in the case of human immunodeficiency virus (HIV) replication in CD4- and CCR5-transgenic lymphocytes, where HIV could not be cultured at all (Browning et al., 1997Down ), they may still hinder the creation of an adequate transgenic murine model of MV pathogenesis. Whether MV binding to the recently identified human MV receptor SLAM (CDw150), expressed specifically on activated lymphocytes (Tatsuo et al., 2000Down ), could modulate the intracellular environment in lymphocytes, making them more suitable for MV replication, needs to be determined.


   Acknowledgments
 
We thank Drs F. Pradel, P. André, F. Wild, R. Buckland, J. Marie and N. Davoust for helpful discussion during realization of this work. This work was supported in part by institutional grants from INSERM and MENRT (PRFMMIP) and by grants from ARC (CRC 6108), Ligue Nationale Contre le Cancer (B.H.). A.E. was supported by a fellowship from MENESR-MAF (1997/98) and FRM (1998/99).


   References
TOP
Abstract
Main text
References
 
Blixenkrone-Moller, M., Bernard, A., Bencsik, A., Sixt, N., Diamond, L. E., Logan, J. S. & Wild, T. F. (1998). Role of CD46 in measles virus infection in CD46 transgenic mice. Virology 249, 238-248.[Medline]

Browning, J., Horner, J. W., Pettoello-Mantovani, M., Raker, C., Yurasov, S., DePinho, R. A. & Goldstein, H. (1997). Mice transgenic for human CD4 and CCR5 are susceptible to HIV infection. Proceedings of the National Academy of Sciences, USA 94, 14637-14641.[Abstract/Free Full Text]

Dorig, R. E., Marcil, A., Chopra, A. & Richardson, C. D. (1993). The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 75, 295-305.[Medline]

Evlashev, A., Moyse, E., Valentin, H., Azocar, O., Trescol-Biemont, M. C., Marie, J. C., Rabourdin-Combe, C. & Horvat, B. (2000). Productive measles virus brain infection and apoptosis in CD46 transgenic mice. Journal of Virology 74, 1373-1382.[Abstract/Free Full Text]

Horvat, B., Rivailler, P., Varior-Krishnan, G., Cardoso, A., Gerlier, D. & Rabourdin-Combe, C. (1996). Transgenic mice expressing human measles virus (MV) receptor CD46 provide cells exhibiting different permissivities to MV infection. Journal of Virology 70, 6673-6681.[Abstract/Free Full Text]

Moyer, S. A., Baker, S. C. & Horikami, S. M. (1990). Host cell proteins required for measles virus reproduction. Journal of General Virology 71, 775-783.[Abstract/Free Full Text]

Mrkic, B., Pavlovic, J., Rulicke, T., Volpe, P., Buchholz, C. J., Hourcade, D., Atkinson, J. P., Aguzzi, A. & Cattaneo, R. (1998). Measles virus spread and pathogenesis in genetically modified mice. Journal of Virology 72, 7420-7427.[Abstract/Free Full Text]

Murray, C. J. & Lopez, A. D. (1997). Mortality by cause for eight regions of the world: Global Burden of Disease Study. Lancet 349, 1269-1276.[Medline]

Naniche, D., Wild, T. F., Rabourdin-Combe, C. & Gerlier, D. (1992). A monoclonal antibody recognizes a human cell surface glycoprotein involved in measles virus binding. Journal of General Virology 73, 2617-2624.[Abstract/Free Full Text]

Naniche, D., Varior-Krishnan, G., Cervoni, F., Wild, T. F., Rossi, B., Rabourdin-Combe, C. & Gerlier, D. (1993). Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. Journal of Virology 67, 6025-6032.[Abstract/Free Full Text]

Niewiesk, S., Schneider-Schaulies, J., Ohnimus, H., Jassoy, C., Schneider-Schaulies, S., Diamond, L., Logan, J. S. & ter Meulen, V. (1997). CD46 expression does not overcome the intracellular block of measles virus replication in transgenic rats. Journal of Virology 71, 7969-7973.[Abstract]

Oldstone, M. B., Lewicki, H., Thomas, D., Tishon, A., Dales, S., Patterson, J., Manchester, M., Homann, D., Naniche, D. & Holz, A. (1999). Measles virus infection in a transgenic model: virus-induced immunosuppression and central nervous system disease. Cell 98, 629-640.[Medline]

Rall, G. F., Manchester, M., Daniels, L. R., Callahan, E. M., Belman, A. R. & Oldstone, M. B. (1997). A transgenic mouse model for measles virus infection of the brain. Proceedings of the National Academy of Sciences, USA 94, 4659-4663.[Abstract/Free Full Text]

Tatsuo, H., Ono, N., Tanaka, K. & Yanagi, Y. (2000). SLAM (CDw150) is a cellular receptor for measles virus. Nature 406, 893-897.[Medline]

Thorley, B. R., Milland, J., Christiansen, D., Lanteri, M. B., McInnes, B., Moeller, I., Rivailler, P., Horvat, B., Rabourdin-Combe, C., Gerlier, D., McKenzie, I. F. & Loveland, B. E. (1997). Transgenic expression of a CD46 (membrane cofactor protein) minigene: studies of xenotransplantation and measles virus infection. European Journal of Immunology 27, 726-734.[Medline]

Vincent, S., Spehner, D., Manié, S., Delorme, R., Drillien, R. & Gerlier, D. (1999). Inefficient measles virus budding in murine L.CD46 fibroblasts. Virology 265, 185-195.[Medline]

Received 11 April 2001; accepted 4 June 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
S. Vincent, I. Tigaud, H. Schneider, C. J. Buchholz, Y. Yanagi, and D. Gerlier
Restriction of Measles Virus RNA Synthesis by a Mouse Host Cell Line: trans-Complementation by Polymerase Components or a Human Cellular Factor(s)
J. Virol., May 13, 2002; 76(12): 6121 - 6130.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Evlashev, A.
Right arrow Articles by Horvat, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Evlashev, A.
Right arrow Articles by Horvat, B.
Agricola
Right arrow Articles by Evlashev, A.
Right arrow Articles by Horvat, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS