|
|
||||||||
Animal: RNA Viruses |
Cell Biology and Imaging1 and Divisions of Retrovirology2, Virology3 and Immunobiology4, National Institute for Biological Standards & Control, Blanche Lane, South Mimms, Potters Bar, Herts EN6 3QG, UK
CAMR, Porton Down, Salisbury, Wilts SP4 0JG, UK5
Author for correspondence: Neil Almond. Fax +44 1707 649865. e-mail nalmond{at}nibsc.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Animals.
Virus.
The challenge virus was derived from the molecular clone SIVmac32H (J5) (Rud et al., 1994
). The virus was derived from the 3/92 stock J5M (Cranage et al., 1997
) by passaging on lymphocytes from a single uninfected cynomolgus macaque. The virus stock referred to as J5C was titrated in vitro on C8166 cells and had an end-point titre of 103 TCID50/ml. Based on the titration, a dose of 103 TCID50 was used to challenge all macaques in this study.
Plan of study.
Two experiments were performed in this study. In the first, six macaques, N17N22, were challenged by intravenous inoculation of 1000 TCID50 of the J5C virus stock. Pairs of macaques were killed humanely at 7 (N17, N18), 14 (N19, N20) and 28 (N21, N22) days after challenge and the presence of virus was determined in blood, inguinal, axillary and superior mesenteric lymph nodes, spleen, thymus and lungs. In the second experiment, four macaques, P213P216, were challenged with 1000 TCID50 of virus and pairs of macaques were sacrificed at 4 (P213, P214) and 7 (P215, P216) days after challenge; the presence of virus was determined in the ileum in addition to the lymphoid tissues studied previously.
Detection of virus by co-culture and DNA PCR.
Re-isolation of virus from PBMC or lymphocytes recovered from disrupted lymphoid tissues was achieved by co-cultivation with C8166 cells. Cultures were maintained for 28 days and virus was detected by the appearance of syncytia and confirmed with an SIV p27 antigen-capture assay (Rose et al., 1995
). Virus loads were determined by co-cultivating dilutions of PBMC or lymphocytes containing between 5x106 and 102 cells with indicator cells as described above.
SIV DNA was detected in blood or tissue by specific amplification of a region within the gag gene using PCR and nested primers, as described previously (Rose et al., 1995
). Quantification of SIV DNA load was determined by an end-point dilution as described previously (Slade et al., 1995
) except that specific amplification of a 147 bp portion of the SIV gag gene was achieved by a single round of PCR with primers SG131N (5' TTGGATTAGCAGAAAGCCTG 3') and SG277C (5' TCTCTTCTGCGTGAATGCAC 3') with Amplitaq Gold (PE Applied Biosystems) and thermocycling conditions of 94 °C for 10 min followed by 40 cycles of 94 °C for 15 s, 55 °C for 15 s and 72 °C for 30 s and finished with 72 °C for 10 min. Following agarose gel electrophoresis and transfer to nylon membrane (Hybond-N, Amersham) by Southern blotting, specific PCR products were identified by hybridization with the 32P-end-labelled oligonucleotide SG176N (5' AATACTTTCGGTCTTAGCTC 3') as described previously (Rose et al., 1995
).
Serological assays.
Anti-SIV envelope antibodies in plasma were detected by ELISA, performed with recombinant SIV gp140 (Repligen, ADP625.1) as antigen, as described previously (Kent et al., 1994
). Neutralizing activity in serum was determined as described previously (Kent et al., 1994
).
Preparation of digoxigenin-labelled DNA probes for ISH.
Single-stranded DNA probes labelled with digoxigenin were prepared by using asymmetric nested PCR as described by An et al. (1992)
. Briefly, three pairs of oligonucleotide primers were used to amplify by PCR regions of the SIV gag (SG1411N, 5' GAAACTATGCCAAAAACAAGT 3'; SG2154C, 5' TAATCTAGCCTTCTGTCCTGG 3'), env (SE7054N, 5' GCACAGGCTTGGAACAAG 3'; SE7695C, 5' AGTTCCAGTATACCTGGGATG 3') and nef (SN9500N, 5' AGACATGTACTTAGAAAAGGA 3'; SN9866, 5' TCAGCGAGTTTCCTTCTTGT 3') genes. Following purification of PCR products using glassmilk (Geneclean II, Bio101) and quantification, approximately 60 ng product from the first-round amplification was transferred to a second round of 40 cycles of amplification containing a single oligonucleotide primer and a dNTP mix containing digoxigenin-labelled dUTP (Boehringer Mannheim).
Two probes were prepared from each product of the first round of amplification. Probes that were identical to sequences within SIV transcripts were produced by using primers SG1829N (5' CAG GAG ATG GAT CCA ACT 3'), SE7386N (5' GAG ACA CAG ACT TCT ACT TGG 3') and SN9641N (5' TGC AGC CAG CTC AAA CTT C 3'). Probes that were complementary to SIV transcripts were obtained by using primers SG1617C (5' ATA GGG GAG GCA GCC TTC TGA CAG 3'), SE7305C (5' CAA AGC ATA ACC TGG AGG TGC 3') and SN9763C (5' GGG TAT CTA ACA TAT GCC TC 3'). Incorporation of digoxigenindUTP into each final product was assessed by end-point dilution and materials supplied in the DIG nucleic acid detection kit (Boehringer Mannheim) following the manufacturers instructions.
In situ hybridization (ISH).
Tissue samples were immersed in 10% (v/v) formal saline for 2496 h at 4 °C before processing. Sections (4 µm) of paraffin wax-embedded tissues were mounted onto glass slides coated with 3-aminopropyl triethoxysilane (APES, Sigma). Prior to hybridization, sections were dewaxed, rehydrated and permeabilized with proteinase K (Boehringer Mannheim) for 30 min at 37 °C before refixing and dehydration in ethanol.
Hybridization of digoxigenin-labelled probes was performed with the Omnislide system (Hybaid). Labelled probes were diluted up to 1:40 and a cocktail of all three probes that were normal to or three probes that were complementary to SIV transcripts was mixed in hybridization buffer [2xSET (50 mM TrisHCl, pH 7·4, 300 mM NaCl, 2 mM EDTA) containing 50% (v/v) formamide, 10% (w/v) dextran sulphate, 0·05% (w/v) SDS, 0·05% (w/v) PVP and 500 µg/ml boiled, sonicated salmon sperm DNA] and allowed to hybridize by incubation overnight at 37 °C. Following hybridization, slides were washed in hybridization buffer containing 0·1% (v/v) Triton X-100 at 42 °C for 3 min.
The location of digoxigenin-labelled probes was visualized using an alkaline phosphatase-conjugated sheep anti-digoxigenin antibody (Boehringer Mannheim) and NBT/BCIP solution (Gibco-BRL) as chromogenic substrate following conditions recommended by the manufacturers. Sections were counterstained with neutral red and mounted in Glycergel (Vector Laboratories).
In order to evaluate the comparative sensitivity of this method with that using 35S-labelled RNA probes, we sent sections consecutive to those analysed in this study to T. Reinhart (formerly of Glaxo Wellcome, Stevenage, UK, now of the University of Pittsburgh, USA). Using methods described previously (Reinhart et al., 1997
), the frequency and distribution of hybridization-positive cells were indistinguishable when determined by the two methods (T. A. Reinhart, personal communication).
Analysis of ISH.
For each section, the area of lymphoid tissue present was calculated by outlining the relevant region from low-power micrographs mounted on a digitizing tablet (Kontron Digiplan). ISH-positive cells were enumerated independently by two people. The statistical difference of the density of hybridizing cells (number of positive cells/mm2) was assessed by the non-parametric MannWhitney U-test.
Immunolabelling of SIV Gag, Nef and envelope proteins in histological sections.
Sections (4 µm) from paraffin wax-embedded tissue were mounted onto 3-APES-coated slides, dewaxed, dehydrated and incubated in ethanol containing 0·5% (v/v) hydrogen peroxide (BDH) at room temperature for 20 min to block endogenous peroxidase activity. The slides were immersed in 10 mM citrate buffer (pH 6·0) and cooked at high power in a microwave oven on two occasions for 5 min. Once the sections had cooled to room temperature, they were rinsed in TBS (20 mM TrisHCl, pH 7·5, 225 mM NaCl) and immersed in TBS containing 5% (w/v) non-fat milk powder for 60 min at room temperature. Monoclonal antibodies (MAbs) of the IgG1 isotype to SIV Gag p17/p27 (KK59/KK64; Kent et al., 1991
), envelope (KK13; Kent et al., 1991
) and Nef (KK75; Arnold et al., 1999
) were respectively diluted 1:50, 1:2 and 1:50 in TBS containing 1% (w/v) BSA, added to the section and incubated overnight at 4 °C. After extensive washing in TBS, bound antibodies were visualized by using a biotinylated universal horse anti-mouse/rabbit antibody (Vector Laboratories) and an avidin/biotinylated horseradish peroxidase complex (ABC, Vector Laboratories) using 3,3'-diaminobenzidine tetrahydrochloride (DAB) as chromogenic substrate. Sections were counterstained with haematoxylin (R. A. Lamb) and mounted in DPX (R. A. Lamb).
| Results |
|---|
|
|
|---|
|
ISH
A non-radioactive ISH technique was established to determine the relative position of SIV-infected cells within lymphoid tissues. Prior to the analyses of tissues from macaques in the study, the relative ability of the protocol to detect viral transcripts and virus RNA from double-stranded SIV DNA was assessed. Digoxigenin-labelled normal and complementary strand probes were allowed to bind to sections of peripheral lymph node tissue from an SIV-infected macaque with clinical AIDS. No detectable hybridization was obtained using the normal strand probe (Fig. 1a
), whereas specific hybridization to large numbers of cells was obtained with the complementary strand probe (Fig. 1b
). Thus, the protocol used was able to detect cells expressing SIV RNA and not double-stranded DNA within tissues. The same probes were also used with peripheral lymph node specimens from naïve, uninfected macaques, and no staining of cells was detected (data not shown).
|
|
|
Immunolabelling for SIV in lymphoid tissue
To complement ISH, immunolabelling techniques were developed using anti-SIV envelope (KK13; Kent et al., 1991
) and Nef (KK75; Arnold et al., 1999
) MAbs. Attempts to use MAbs KK59 and KK61 (Kent et al., 1991
) to detect specifically SIV Gag protein were unsuccessful, as high levels of binding were observed with these antibodies on sections of lymph node processed from uninfected macaques (data not shown). No binding of MAbs KK13 and KK75 was observed on sections of lymph node from uninfected macaques.
Parallel sections of mesenteric lymph node from each macaque were processed for ISH and immunolabelling with anti-envelope and anti-Nef MAbs. The results are presented in Table 3
and representative sections are shown in Fig. 3
. No cells from material collected 4 days p.i. were labelled by either technique. At 7 days p.i., similar numbers of cells were labelled by all three methods. As expected from previous studies, SIV-positive cells were distributed in the paracortex (Fig. 3a
, d
, g
). At day 14 p.i., immunolabelling with anti-Nef MAbs and ISH visualized similar numbers of positive cells and, as expected, they were found within germinal centres as well as in the paracortex (Fig. 3b
, e
). A very different distribution of labelling was obtained with the anti-envelope MAb (Fig. 3h
). More cells both within and between follicles were labelled with this antibody. In addition, a diffuse staining within the germinal centre of follicles was apparent (Fig. 3h
). At day 28 p.i., ISH did not identify any SIV-positive cells (Fig. 3f
), whereas immunolabelling with anti-Nef MAb detected small numbers of SIV-positive cells (Fig. 3c
). Larger numbers of cells were identified as being SIV-positive by using the anti-envelope MAb. Nevertheless, the diffuse staining of the germinal centre was no longer apparent at this time (Fig. 3i
).
|
|
| Discussion |
|---|
|
|
|---|
The seemingly discrepant results of virus co-culture, DNA PCR and ISH/immunolabelling reflect the related, but distinct, aspects of virus infection and replication that each technique identifies. It has been reported previously that analysis by virus co-culture and DNA PCR can yield unexpectedly distinct results, especially in the study of attenuated isolates of SIV (Almond et al., 1995
). The data obtained here at 4 weeks p.i. indicate clearly that cells that are not actively transcribing high levels of SIV RNA possess SIV DNA and can yield a productive infection if cultured with appropriate indicator cells.
A concern during the development and early application of the non-isotopic ISH assay was its sensitivity in comparison with assays that use radiolabelled probes. Certainly, our preliminary studies demonstrated that mixing all three probes (complementary to gag, nef and env genes) maximized sensitivity (unpublished observations). In addition, consecutive sections to those presented here were evaluated using 35S-labelled SIV probes of high specific activity. No additional sections were identified as containing SIV-positive cells, nor was the frequency or distribution of positive cells observed to differ (T. A. Reinhart, personal communication). Furthermore, a close correspondence of the number and location of SIV-positive cells was obtained using ISH or immunolabelling with the anti-Nef MAb KK75 and the anti-envelope MAb KK13 at 1 week p.i. This would indicate that, at this time, immunohistochemistry and ISH were equally sensitive for detecting infected cells.
The development of immunolabelling protocols that are of equivalent sensitivity to ISH for the detection of cells that are actively replicating SIV adds a powerful new tool for the study of virus replication in tissues. Furthermore, the availability of two complementary MAbs against distinct SIV proteins has already proven valuable. MAb KK75 recognizes a linear peptide sequence in the SIV Nef protein (Arnold et al., 1999
). The Nef protein is present at high levels only in virus-infected cells. In contrast, MAb KK13 recognizes a conformation-dependent determinant in the SIV envelope protein, which is expressed not only in virus-infected cells but also on virions. The differential expression of these two SIV proteins is clear from the results obtained. In all sections stained with MAb KK75 at 1, 2 and 4 weeks after virus challenge, staining was localized over individual cells. In contrast, immunohistochemical staining with the anti-envelope MAb KK13 gave different patterns of staining depending upon the time after infection at which tissues were recovered. At 7 days p.i., the pattern with KK13 was very similar to that of KK75, indicating that a predominant location of envelope protein was on individual infected cells. However, a diffuse staining of germinal centres was observed at 14 days p.i. and a larger number of positively stained cells was detected at 28 days p.i. This would suggest that the major source of envelope protein detected at these later times is on virions that have been trapped on cells. A similar pattern of diffuse staining over germinal centres has been obtained when radiolabelled probes were used for ISH on lymphoid tissues recovered from macaques challenged with pathogenic isolates of SIV (Chakrabarti et al., 1994a
, b
; Baskin et al., 1995
). In these previous reports, the pattern was ascribed to the detection of virions in the germinal centres. The distinct pattern of staining demonstrated in this study obtained by immunohistochemistry with MAbs against Nef, the viral regulatory protein, and envelope, the viral structural protein, provides confirmation of the previous tentative conclusions. If this diffuse staining is due to trapping of virions in the germinal centre, the loss of this diffuse staining by 4 weeks p.i. would suggest that neither macaque N21 nor N22 was likely to progress rapidly to disease (Chakrabarti et al., 1994a
).
In comparison with previous studies of the early pathology of SIV infection, the failure to detect any virus-positive cells by ISH at 4 weeks p.i. was unusual. However, previous comparative studies of SIVmacJ5 infection in rhesus and cynomolgus macaques have indicated that the primary viraemia in the blood is of lesser magnitude and shorter duration in the latter species. In addition, the cloned virus SIVmacJ5 is frequently less vigorous in vivo compared with uncloned SIVmac251 (11/88 pool; E. J. Stott and N. Almond, unpublished observations). Even in previous studies by others, a marked fall in the number of SIV-positive cells detected by ISH was observed between days 16 and 35 post-inoculation in rhesus macaques infected with the pathogenic clone SIVmac239 (Reimann et al., 1994
). However, by using ISH, we have detected recently hybridized cells in peripheral lymph nodes of J5-infected macaques at 16 weeks p.i. without patent progression onto clinical disease (N. Almond and D. Ferguson, unpublished).
Our observation that gut-associated lymphoid tissue, in particular mesenteric lymph nodes and Peyers particle, was an early major site of virus replication following intravenous inoculation of virus contrasts with the observations of Stahl-Hennig et al. (1999)
, who characterized the primary viraemia of a closely related isolate of SIVmac251 after oral inoculation. Atraumatic administration of virus in the mouth was reported to result in very early replication of virus in the immediately local, and presumably activated, tonsillar lymphoid tissue before dissemination to distant gut-associated and peripheral lymphoid tissue (Stahl-Hennig et al., 1999
). The distinct pattern of virus dissemination and replication perhaps reflects the lack of activated lymphoid tissue encountered by virus inoculated intravenously prior to the gut-associated lymphoid tissue, whereas the tonsils and related lymphoid tissue are designed to sample and deal with antigen and pathogens entering via the oral route.
The characterization of the early pathology of infection with SIVmacJ5 may be valuable in the development of an effective AIDS vaccine. The demonstration that, even after intravenous inoculation, gut-associated lymphoid tissue is a major site of initial virus replication needs to be borne in mind in the development of an effective vaccine strategy. In spite of the generation of strong serological and T cell responses to the virus in the periphery, recombinant subunit vaccines seldom confer the levels of protection obtained with live-attenuated virus vaccines. This may reflect an inability of subunit vaccines to generate effective responses in gut-associated lymphoid tissue. This study of the early pathology of SIV may account for the enhanced protection of subunit vaccines when they are targetted towards deep mesenteric lymph nodes (Lehner et al., 1996
).
The development and application of a range of techniques to describe the distribution of a pathogenic isolate of SIV in the tissues of infected macaques will enable us to address further key questions. Of greatest importance is the identification of the first cells that are susceptible to infection with the inoculated virus and are moreover capable of disseminating the virus to further cells. The development of immunohistochemical reagents to detect SIV-infected cells will simplify the techniques of double labelling with antiviral antibodies and antibodies to cellular markers. Another intriguing question that may also be addressed with these techniques is the characterization of the changes in the early pathology of SIV infection in vivo that result from the disruption of selected regulatory genes. For example, the SIV clone C8 is attenuated through minor disruption of the nef gene. A comparison of the early pathology of C8 compared with J5 may provide insight into the function of the nef gene and its effect on the interaction between virus and host in vivo. This comparison may also help us to understand how nef-disrupted viruses confer potent vaccine protection against challenge with a broad range of pathogenic viruses (Almond et al., 1995
; Almond & Stott, 1999
). These studies of virus pathogenesis may therefore be of direct benefit in the development of a safe and effective AIDS vaccine.
| Acknowledgments |
|---|
| Footnotes |
|---|
c Present address: Henry M. Jackson Foundation, 1600 East Gude Drive, Rockville, MD 20850, USA. ![]()
| References |
|---|
|
|
|---|
Almond, N. & Stott, J. (1999). Live attenuated SIV a model of a vaccine for AIDS. Immunology Letters 66, 167-170.[Medline]
Almond, N., Kent, K., Cranage, M., Rud, E., Clarke, B. & Stott, E. J. (1995). Protection by attenuated simian immunodeficiency virus in macaques against challenge with virus-infected cells. Lancet 345, 1342-1344.[Medline]
An, S. F., Franklin, D. & Fleming, K. A. (1992). Generation of digoxigenin-labelled double-stranded and single-stranded probes using the polymerase chain reaction. Molecular and Cellular Probes 6, 193-200.[Medline]
Arnold, C., Jenkins, A., Almond, N., Stott, E. J. & Kent, K. A. (1999). Monoclonal antibodies recognize at least five epitopes on the SIV Nef protein and identify an in vitro-induced mutation. AIDS Research and Human Retroviruses 15, 1087-1097.[Medline]
Baskin, G. B., Martin, L. N., Murphey-Corb, M., Hu, F.-S., Kuebler, D. & Davison, B. (1995). Distribution of SIV in lymph nodes of serially sacrificed rhesus monkeys. AIDS Research and Human Retroviruses 11, 273-285.[Medline]
Cao, Y., Qin, L., Zhang, L., Safrit, J. & Ho, D. D. (1995). Virologic and immunologic characterization of long-term survivors of human immunodeficiency virus type 1 infection. New England Journal of Medicine 332, 201-208.
Chakrabarti, L., Cumont, M.-C., Montagnier, L. & Hurtrel, B. (1994a). Variable course of primary simian immunodeficiency virus infection in lymph nodes: relation to disease progression. Journal of Virology 68, 6634-6643.
Chakrabarti, L., Isola, P., Cumont, M.-C., Claessens-Maire, M.-A., Hurtrel, M., Montagnier, L. & Hurtrel, B. (1994b). Early stages of simian immunodeficiency virus infection in lymph nodes. Evidence for high viral load and successive populations of target cells. American Journal of Pathology 144, 1226-1237.[Abstract]
Cranage, M. P., Whatmore, A. M., Sharpe, S. A., Cook, N., Polyanskaya, N., Leech, S., Smith, J. D., Rud, E. W., Dennis, M. J. & Hall, G. A. (1997). Macaques infected with live attenuated SIVmac are protected against superinfection via the rectal mucosa. Virology 229, 143-154.[Medline]
Kent, K. A., Gritz, L., Stallard, G., Cranage, M. P., Collignon, C., Thiriart, C., Corcoran, T., Silvera, P. & Stott, E. J. (1991). Production and characterisation of monoclonal antibodies to simian immunodeficiency virus envelope glycoproteins. AIDS 5, 829-836.[Medline]
Kent, K. A., Kitchin, P., Mills, K. H., Page, M., Taffs, F., Corcoran, T., Silvera, P., Flanagan, B., Powell, C., Rose, J., Ling, C., Aubertin, A.-M. & Stott, E. J. (1994). Passive immunization of cynomolgus macaques with immune sera or a pool of neutralizing monoclonal antibodies failed to protect against challenge with SIVmac251. AIDS Research and Human Retroviruses 10, 189-194.[Medline]
Lehner, T., Wang, Y.-F., Cranage, M., Bergmeier, L. A., Mitchell, E., Tao, L., Hall, G., Dennis, M., Cook, N., Brookes, R., Klavinskis, L., Jones, I., Doyle, C. & Ward, R. (1996). Protective mucosal immunity elicited by targeted iliac lymph node immunization with a subunit SIV envelope and core vaccine in macaques. Nature Medicine 2, 767-775.[Medline]
Mellors, J. W., Rinaldo, C. R.Jr, Gupta, P., White, R. M., Todd, J. A. & Kingsley, L. A. (1996). Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science 272, 1167-1170.[Abstract]
Reimann, K. A., Tenner-Racz, K., Racz, P., Montefiori, D. C., Yasutomi, Y., Lin, W., Ransil, B. J. & Letvin, N. L. (1994). Immunopathogenic events in acute infection of rhesus monkeys with simian immunodeficiency virus of macaques. Journal of Virology 68, 2362-2370.
Reinhart, T. A., Rogan, M. J., Huddleston, D., Rausch, D. M., Eiden, L. E. & Haase, A. T. (1997). Simian immunodeficiency virus burden in tissues and cellular compartments during clinical latency and AIDS. Journal of Infectious Diseases 176, 1198-1208.[Medline]
Rose, J., Silvera, P., Flanagan, B., Kitchin, P. & Almond, N. (1995). The development of PCR based assays for the detection and differentiation of simian immunodeficiency virus in vivo. Journal of Virological Methods 51, 229-239.[Medline]
Rud, E. W., Cranage, M., Yon, J., Quirk, J., Ogilvie, L., Cook, N., Webster, S., Dennis, M. & Clarke, B. E. (1994). Molecular and biological characterization of simian immunodeficiency virus macaque strain 32H proviral clones containing nef size variants. Journal of General Virology 75, 529-543.
Schacker, T., Little, S., Connick, E., Gebhard-Mitchell, K., Zhang, Z.-Q., Krieger, J., Pryor, J., Havlir, D., Wong, J. K., Richman, D., Corey, L. & Haase, A. T. (2000). Rapid accumulation of human immunodeficiency virus (HIV) in lymphatic tissue reservoirs during acute and early HIV infection: implications for timing of antiretroviral therapy. Journal of Infectious Diseases 181, 354-357.[Medline]
Simmonds, P., Zhang, L. Q., McOmish, F., Balfe, P., Ludlam, C. A. & Leigh-Brown, A. J. (1991). Discontinuous sequence change of human immunodeficiency virus (HIV) type 1 env sequences in plasma viral and lymphocyte-associated proviral populations in vivo: implications for models of HIV pathogenesis. Journal of Virology 65, 6266-6276.
Slade, A., Jones, S., Jenkins, A., Bootman, J., Heath, A., Kitchin, P. & Almond, N. (1995). Similar patterns of simian immunodeficiency virus env sequences are found in the blood and lymphoid tissues of chronically infected macaques. AIDS Research and Human Retroviruses 11, 1509-1511.[Medline]
Smit-McBride, Z., Mattapallil, J. J., McChesney, M., Ferrick, D. & Dandekar, S. (1998). Gastrointestinal T lymphocytes retain high potential for cytokine responses but have severe CD4+ T-cell depletion at all stages of simian immunodeficiency virus infection compared to peripheral lymphocytes. Journal of Virology 72, 6646-6656.
Stahl-Hennig, C., Steinman, R. M., Tenner-Racz, K., Pope, M., Stolte, N., Matz-Rensing, K., Grobschupff, G., Raschdorff, B., Hunsmann, G. & Racz, P. (1999). Rapid infection of oral mucosal-associated lymphoid tissue with simian immunodeficiency virus. Science 285, 1261-1265.
Stott, J. & Almond, N. (1995). Assessing animal models of AIDS. Nature Medicine 1, 295-297.[Medline]
Veazey, R. S., DeMaria, M., Chalifoux, L. V., Shvetz, D. E., Pauley, D. R., Knight, H. L., Rosenzweig, M., Johnson, R. P., Desrosiers, R. C. & Lackner, A. A. (1998). Gastrointestinal tract as a major site of CD4+ T cell depletion and viral replication in SIV infection. Science 280, 427-431.
Received 8 January 2001;
accepted 22 May 2001.
This article has been cited by other articles:
![]() |
N. Berry, R. Stebbings, D. Ferguson, C. Ham, J. Alden, S. Brown, A. Jenkins, J. Lines, L. Duffy, L. Davis, et al. Resistance to superinfection by a vigorously replicating, uncloned stock of simian immunodeficiency virus (SIVmac251) stimulates replication of a live attenuated virus vaccine (SIVmacC8) J. Gen. Virol., September 1, 2008; 89(9): 2240 - 2251. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Sloan, J. P. Capitanio, R. P. Tarara, S. P. Mendoza, W. A. Mason, and S. W. Cole Social Stress Enhances Sympathetic Innervation of Primate Lymph Nodes: Mechanisms and Implications for Viral Pathogenesis J. Neurosci., August 15, 2007; 27(33): 8857 - 8865. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K. Sloan, R. P. Tarara, J. P. Capitanio, and S. W. Cole Enhanced Replication of Simian Immunodeficiency Virus Adjacent to Catecholaminergic Varicosities in Primate Lymph Nodes J. Virol., May 1, 2006; 80(9): 4326 - 4335. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Miyake, K. Ibuki, Y. Enose, H. Suzuki, R. Horiuchi, M. Motohara, N. Saito, T. Nakasone, M. Honda, T. Watanabe, et al. Rapid dissemination of a pathogenic simian/human immunodeficiency virus to systemic organs and active replication in lymphoid tissues following intrarectal infection. J. Gen. Virol., May 1, 2006; 87(Pt 5): 1311 - 1320. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Renoux, S. Wain-Hobson, B. Hurtrel, and R. Cheynier Antigenic Stimulation Specifically Reactivates the Replication of Archived Simian Immunodeficiency Virus Genomes in Chronically Infected Macaques J. Virol., September 1, 2005; 79(17): 11231 - 11238. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |