|
|
||||||||
Animal: DNA Viruses |
Microbiology and Tumor Biology Center, Karolinska Institute, PO Box 280, S-171 77, Stockholm, Sweden1
Department of Virology, Hannover Medical School, D-30623 Hannover, Germany2
Molecular Virology Group, Department of Medical Microbiology, The University of Liverpool, UK3
Author for correspondence: Laszlo Szekely. Fax +46 8 330498. e-mail lassze{at}ki.se
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
LANA is a nuclear phosphoprotein encoded by orf73 as part of a polycistronic message (Rainbow et al., 1997
). It is expressed in all latently infected cells and is considered to be one of the major viral proteins that contributes to cell transformation. It binds and inhibits the transcriptional transactivating function of p53 and through this may protect cells from p53-induced apoptosis (Friborg et al., 1999
). LANA also binds the retinoblastoma (Rb) protein and activates E2F-dependent transcription. LANA alleviates the growth inhibitory effect of Rb on Saos cells and, together with HRas, transforms primary rodent fibroblasts (Radkov et al., 2000
). LANA associates with co-repressor protein SAP30, part of the mSin3 co-repressor complex that directs histone deacetylases to specific DNA sites (Krithivas et al., 2000
).
LANA can modulate the expression levels of several different synthetic or natural promoters of both viral and cellular origin. LANA up-regulates its own expression along with v-cyclin and v-FLIP and a set of interferon-responsive cellular genes. On the other hand it down-regulates expression from the human immunodeficiency virus long terminal repeat and also NF-
B-dependent reporter genes (Renne et al., 2001
). It also binds to RING3, one of five human homologues of fsh (female sterile homeotic) of Drosophila and is phosphorylated as a consequence of this interaction (Platt et al., 1999
).
In the present study we aimed to characterize the high-resolution intranuclear distribution of RING3 in relation to LANA during different phases of the cell cycle and the effect of LANA on RING3 expression.
| Methods |
|---|
|
|
|---|
Cell culture and transient transfection.
Immunofluorescence microscopy.
Cells grown on coverslips or centrifuged (cytospin) onto glass slides were fixed in methanol:acetone (1:1) at -20 °C for 20 min and then re-hydrated in PBS for 20 min at room temperature. The primary antibodies used in this study were human anti-LANA (antiserum collected from patients suffering from the classical form of Kaposis sarcoma at the Dermatology Unit of Debrecen Medical School, Hungary; a gift from Attila Juhasz) and rabbit polyclonal anti-RING3 antibody (Platt et al., 1999
). Rhodamine-conjugated rabbit anti-human (DAKO) or FITC-conjugated swine anti-rabbit (DAKO) antibodies were used as secondary antibodies. Control transfection of pBabe-EBNA-5 was stained with a mouse monoclonal, JF186 (Finke et al., 1987
). Rhodamine-conjugated horse anti-mouse (Vector) was used as secondary antibody. The sera were diluted in blocking buffer (2% BSA, 0·2% Tween-20, 10% glycerol, 0·05% NaN3 in PBS). Following a 1 h incubation at room temperature with primary antibody, the cells were washed three times in PBS and then incubated for 30 min with the secondary antibody. Double staining between LANA and RING3 was performed in the following order: rabbit anti-RING3, FITC-conjugated swine anti-rabbit serum, normal rabbit serum, human anti-LANA and rhodamine-conjugated rabbit anti-human serum. DNA was stained by Hoechst 33258 or by propidium iodide. Each incubation was followed by three washes in PBS. The coverslips or glass slides were mounted with 70% glycerol containing 2·5% DABCO anti-fading agent (Sigma). Images were collected using a Leitz DM RB microscope, equipped with Leica PL Fluotar 100x and 40x oil immersion objectives. Composite filter cubes were used for the FITC, Texas red/rhodamine and Hoechst 33258 fluorescence, respectively. The pictures were captured with a Hamamatsu dual mode cooled CCD camera (C4880), recorded and analysed on a Pentium PC computer equipped with an AFG VISIONplusAT frame grabber board using Hipic5.1.0 (Hamamatsu), Image-Pro Plus (Media Cybernetics). Digital images were assembled using Adobe Photoshop software. Optical sectioning and three-dimensional reconstitution was carried out using a Zeiss Axiophot microscope, equipped with 16x oil Plan-Neofluar NA 0·5, 63x oil Plan-Apochromat NA 1·4 and 100x oil Plan-Neofluar NA 0·71·3 objectives, illuminated with an Osram HBO 100 W mercury short arc lamp. The following excitation filters, mounted in the computer-controlled filter wheel, were used in this study: single band UV exciter for Hoechst (84360), single band blue exciter for FITC (84490), single band green exciter for TRITC (84555). The emission filter was a multiple band pass filter (84000) mounted on a static stage. All filters were purchased from Chroma Technology. The filter wheel, dual shutter and Z axis motor were controlled through a LEP MAC2000 Communication Interface 73000400 using an RS-232 serial connection (all devices from Ludl Electric Products). Images were captured with a PXL cooled CCD camera (Photometrix) operating at -25 °C, using 12 bit (4096 greyscale level) capture mode. The hardware control and image processing was provided by a Pentium PC computer equipped with a 600 MHz Pentium III processor and 512 Mb RAM. The operation system was LINUX Mandrake 7.0. The imaging programs were written and operated using the ISee 5.1 graphical programming system (Inovision). Our program ST-FITC-Rhodamine-Hoechst-bin1 was a novel hybrid version of TROOPER3 and STEREOTROOPER (Holmvall & Szekely, 1999
) that produces both single and stereo-projected three-colour images from a series of wide-field pictures where the out-of-focus blur was removed by nearest neighbour de-convolution and the resulting images were built up using a maximum intensity projection algorithm. This novel program also automatically compensated for any shining through from FITC, TRITC and Hoechst 33258 colour channels. The program CHROMATIN (Holmvall & Szekely, 1999
) was used on individual optical sections created by the program ST-FITC-Rhodamine-Hoechst t-bin1.
Ratio RTPCR assay.
mRNA was isolated from pCDNA4-LANA-transfected and pCDNA4 MCF7 cell lines after 0 h, 24 h, 36 h and 72 h using Dynabeads (Dynal) according to the manufacturers recommendation. The mRNA samples were eluted in 20 µl water. Ten µl of the mRNA samples was reverse-transcribed with Superscript II (Life Technologies) according to the manufacturers recommendation in a 20 µl volume using oligo(dT)30 primer. The RTPCR reactions were performed on a Rapidcycler (Idahotech) capillary PCR machine in a 10 µl volume. The amplification reactions contained 0·5 µl of cDNA template, 50 mM Tris pH 8·0, 500 µg/ml BSA, 3 mM MgCl2, 200 µM dNTP, 0·3 µM of GAPDH primers (GPDH5
5' ACCACAGTCCATGCCATCAC 3'; GPDH3
5' TCCACCACCCTGTTGCTGTA 3'), 1 µM of RING3 primers (RING35
5' AGTCCTTGCACTCTGCTGGA 3'; RING33
5' GTGCTGCCTTAGGCTCAAGA 3') and 0·4 U Platinum Taq polymerase (Life Technologies). The reactions were cycled 27, 30 and 33 times, after an initial 15 s denaturation at 94 °C, under the following conditions: 94 °C, 0 s; 55 °C, 0 s; 72 °C, 30 s. The PCR products were separated on a 2·5% agarose gel in 1x TAE buffer in the presence of 10 µg/ml ethidium bromide. The bands were visualized in an Intelligent Dark Box II (FujiFilm) and quantified using ImageGauge 3.122 software (FujiFilm).
| Results |
|---|
|
|
|---|
|
|
|
|
As previously reported (Szekely et al., 1999
; Ballestas et al., 1999
), LANA remains associated with the chromosomes during mitosis. In view of the co-localization of LANA with RING3 in interphase cells we investigated the distribution of RING3 in KSHV/HHV-8-infected and -uninfected metaphase cells. As shown in Fig. 4
, RING3 relocates from the euchromatin-containing regions of the interphase nucleus of KSHV/HHV-8-uninfected cells to the cytoplasm during mitosis. In marked contrast, in KSHV/HHV-8-infected cells RING3 remains associated with mitotic chromosomes where it co-localizes almost perfectly with LANA. These findings indicate that the previously demonstrated (Platt et al., 1999
) interaction of LANA with the ET domain of RING3 is strong enough to relocate RING3 almost completely to mitotic chromosomes during anaphase.
|
|
LANA and RING3 form nuclear bodies in transfected cells even in the absence of the viral genome and lead to the dissolution of heterochromatin
LANA anchors HHV-8 DNA to the host chromatin. Introduction of a plasmid with the KSHV/HHV-8 latent origin of replication into LANA-expressing BJAB cells leads to the formation of distinct nuclear bodies (Ballestas et al., 1999
). After transfecting LANA into MCF7 and SW480 cells we observed that a fraction of cells produced a stippled nuclear staining pattern. Double immunofluorescence staining and three-dimensional reconstitution from a series of optical sections showed that in these KSHV/HHV-8-negative cells transfected LANA also co-localized with RING3 in focal aggregates reminiscent of the nuclear bodies that are present in latent virus-harbouring cells (Fig. 6a
). These focal aggregates regularly associated with the perinucleolar heterochromatin in human cells. High magnification images of the perinucleolar regions of the transfected cells showed decreased local DNA staining at the sites of focal LANA aggregates (Fig. 6b
). Interestingly, in cells that showed high levels of LANA expression with homogeneous nuclear distribution, the perinucleolar heterochromatin completely disappeared. Because it is difficult to clearly demarcate the euchromatin/heterochromatin borders in human cells we examined mouse L cells, in which the heterochromatin forms very distinct blob-like structures. Transfection of LANA produced mainly intense homogeneous nuclear staining in the L cells with the almost complete disappearance of heterochromatin (Fig. 7
). Interestingly both mouse and human cells that expressed high levels of exogenous LANA and induced RING3 showed decreased overall staining with the DNA-binding dye bisbenzidine (Hoechst 33258), which binds to the AT-rich minor groove (Fig. 7a
, b
) but not with the interchelating dye propidium iodide (Fig. 7c
, propidium iodide staining in red), indicating that the decrease in staining intensity was not due to DNA degradation. As a control we overexpressed EBNA-5 in MCF7 cells (Pokrovskaja et al., 2001
). EBNA-5 did not induce any visible change in the chromatin distribution or bisbenzidine staining intensity (Fig. 7d
). Control experiments were performed in which Hoechst 33258 was added in various incubation steps to exclude the possibility that the staining order affected the binding of Hoechst to DNA. Independently of staining order, the overall DNA staining was decreased in the LANA-expressing cells.
|
|
| Discussion |
|---|
|
|
|---|
RING3 is a member of the family of bromodomain-containing proteins that include the SWI/SNF-type chromatin remodelling proteins, histone acetylases and CBP/p300 CREB-binding co-activators. NMR studies on the structure of bromodomain suggested that four of them form alpha-helix bundles that may serve as a chromatin-targeting module that can interact specifically with acetylated lysines (Dhalluin et al., 1999
).
RING3 belongs to the BET subgroup of bromodomain proteins, members of which contain two bromodomains and an ET motif, a proteinprotein interactive surface. This group also includes, besides the Drosophila fsh, the yeast BDF proteins that regulate transcription through interaction with general transcription factors.
The human genome encodes at least four additional BET subgroup proteins: BRDT, ORFX, MCAP and HUNK1 (Jones et al., 1997
; Dey et al., 2000
). Interestingly the gene encoding RING3 is the only gene of the MHC class II region of human 6p21.3 that is not obviously associated with the immune system (Beck et al., 1996
).
The function of RING3 is as yet poorly understood. In Drosophila, fsh is implicated in the establishment of the segments in the early embryo (Beck et al., 1992
) by interacting with the trithorax pathway (Mozer & Dawid, 1989
).
The murine RING3 homologue (Fsrg1) may play a regulatory role in folliculogenesis and in the hormone-dependent remodelling of epithelia (Rhee et al., 1998
). RING3 is expressed at high levels in testis and may also play a role in the regulation of spermatogenesis (Taniguchi et al., 1998
). A recent report found that RING3 expression was increased in several organs as a result of parasite infection, suggesting that it could represent an early response gene involved in the innate immune response (Lau et al., 2001
). In the present paper we also show that LANA activates RING3 gene expression.
We also show that in KSHV/HHV-8-uninfected cells RING3 localizes to euchromatin regions in the interphase nucleus. During mitosis, RING3 appears to be released to the cytoplasm, similar to other transcription regulators, e.g. CBP, SP1, TFIIB (Dey et al., 2000
). In this respect RING3 differs from another recently described human member of the fsh family, MCAP, which has recently been reported to be located in heterochromatin regions and to remain associated with condensed chromosomes during mitosis (Dey et al., 2000
). This difference in the sub-cellular localization of RING3 and MCAP may point to different functional roles. Interestingly, MCAP contains a long C-terminal extension, absent in RING3, distal from the ET domain, which characterizes all members of the fsh family.
We found that the bulk of RING3 co-localizes with the bulk of LANA in the nuclear bodies of KSHV/HHV-8-positive BC cells. These LANA-positive nuclear bodies are located on the euchromatin/heterochromatin interface in BC cells or in humanmouse hybrids. This localization is preserved when LANA is produced from an exogenously introduced expression vector. This markedly different localization of RING3 in KSHV/HHV-8-infected versus -uninfected cells strongly suggests that its interaction with LANA, previously demonstrated biochemically (Platt et al., 1999
), is strong enough to quantitatively relocate RING3 to sub-nuclear structures containing KSHV/HHV-8 episomal DNA and LANA.
Importantly, however, high level expression leads to the dissolution of both human and mouse heterochromatin with accompanying bisbenzidine (Hoechst 33258) but not propidium iodide hypochromazia. Bisbenzidine binds to the minor grooves of AT-rich DNA. Culturing mouse cells in the presence of bisbenzidine inhibits the chromatin condensation of the pericentromeric heterochromatin. The staining difference between bisbenzidine and the interchelating dye propidium iodide indicates that DNA is preserved in the transfected cells and bisbenzidine hypochromazia is not a result of selective DNA degradation. Another possible explanation for this phenomenon is that association of LANA or RING3LANA complexes with DNA leads to decreased accessibility of minor grooves. However, the images presented in Figs 5(a)
, 6
, 7
are more likely to indicate that LANARING3-containing heterochromatin regions show signs of heterochromatin dissolution.
We suggest that in virus-infected cells the LANARING3 nuclear bodies create a local microenvironment where the viral DNA is anchored to host heterochromatin but heterochromatization is inhibited in the immediate neighbourhood of the viral DNA LANA and/or RING3.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Beck, S., Hanson, I., Kelly, A., Pappin, D. J. & Trowsdale, J. (1992). A homologue of the Drosophila female sterile homeotic (fsh) gene in the class II region of the human MHC. DNA Sequence 2, 203-210.[Medline]
Beck, S., Belich, M., Gruneberg, U., Jackson, A., Kelly, A., Sanseau, P., Sanderson, F., Trowsdale, J. & Van Ham, M. (1996). Organisation and functions of class II genes and molecules. DNA Sequence 7, 21-23.[Medline]
Boshoff, C. & Weiss, R. A. (1998). Kaposis sarcoma-associated herpesvirus. Advances in Cancer Research 75, 57-86.[Medline]
Cotter, M. A.II & Robertson, E. S. (1999). The latency-associated nuclear antigen tethers the Kaposis sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells. Virology 264, 254-264.[Medline]
Dey, A., Ellenberg, J., Farina, A., Coleman, A. E., Maruyama, T., Sciortino, S., Lippincott-Schwartz, J. & Ozato, K. (2000). A bromodomain protein, MCAP, associates with mitotic chromosomes and affects G2-to-M transition. Molecular and Cellular Biology 20, 6537-6549.
Dhalluin, C., Carlson, J. E., Zeng, L., He, C., Aggarwal, A. K. & Zhou, M. M. (1999). Structure and ligand of a histone acetyltransferase bromodomain. Nature 399, 491-496.[Medline]
Dupin, N., Fisher, C., Kellam, P., Ariad, S., Tulliez, M., Franck, N., van Marck, E., Salmon, D., Gorin, I., Escande, J. P., Weiss, R. A., Alitalo, K. & Boshoff, C. (1999). Distribution of human herpesvirus-8 latently infected cells in Kaposis sarcoma, multicentric Castlemans disease, and primary effusion lymphoma. Proceedings of the National Academy of Sciences, USA 96, 4546-4551.
Finke, J., Rowe, M., Kallin, B., Ernberg, I., Rosen, A., Dillner, J. & Klein, G. (1987). Monoclonal and polyclonal antibodies against EpsteinBarr virus nuclear antigen 5 (EBNA-5) detect multiple protein species in Burkitts lymphoma and lymphoblastoid cell lines. Journal of Virology 61, 3870-3878.
Friborg, J.Jr, Kong, W., Hottiger, M. O. & Nabel, G. J. (1999). p53 inhibition by the LANA protein of KSHV protects against cell death. Nature 402, 889-894.[Medline]
Holmvall, P. & Szekely, L. (1999). Computer programs that allow fast acquisition, visualization and overlap quantitation of fluorescent 3D microscopic objects using nearest neighbor deconvolution algorithm. Applied Immunohistochemistry & Molecular Morphology 7, 226-236.
Jones, M. H., Numata, M. & Shimane, M. (1997). Identification and characterization of BRDT: a testis-specific gene related to the bromodomain genes RING3 and Drosophila fsh. Genomics 45, 529-534.[Medline]
Katano, H., Sato, Y., Kurata, T., Mori, S. & Sata, T. (1999). High expression of HHV-8-encoded ORF73 protein in spindle-shaped cells of Kaposis sarcoma. American Journal of Pathology 155, 47-52.
Kedes, D. H., Lagunoff, M., Renne, R. & Ganem, D. (1997). Identification of the gene encoding the major latency-associated nuclear antigen of the Kaposis sarcoma-associated herpesvirus. Journal of Clinical Investigation 100, 2606-2610.[Medline]
Kellam, P., Boshoff, C., Whitby, D., Matthews, S., Weiss, R. A. & Talbot, S. J. (1997). Identification of a major latent nuclear antigen, LNA-1, in the human herpesvirus 8 genome. Journal of Human Virology 1, 19-29.[Medline]
Krithivas, A., Young, D. B., Liao, G., Greene, D. & Hayward, S. D. (2000). Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepressor complex and negatively regulates EpsteinBarr virus gene expression in dually infected PEL cells. Journal of Virology 74, 9637-9645.
Lau, A. O. T., Sacci, J. B. & Azad, A. F. (2001). Host responses to Plasmodium yoelii hepatic stages: a paradigm in hostparasite interaction. Journal of Immunology 166, 1945-1950.
Mozer, B. A. & Dawid, I. B. (1989). Cloning and molecular characterization of the trithorax locus of Drosophila melanogaster. Proceedings of the National Academy of Sciences, USA 86, 3738-3742.
Platt, G. M., Simpson, G. R., Mittnacht, S. & Schulz, T. F. (1999). Latent nuclear antigen of Kaposis sarcoma-associated herpesvirus interacts with RING3, a homolog of the Drosophila female sterile homeotic (fsh) gene. Journal of Virology 73, 9789-9795.
Pokrovskaja, K., Mattsson, K., Kashuba, E., Klein, G. & Szekely, L. (2001). Proteasome inhibitor induces nucleolar translocation of the EBV-encoded EBNA-5. Journal of General Virology 82, 345-358.
Radkov, S. A., Kellam, P. & Boshoff, C. (2000). The latent nuclear antigen of Kaposi sarcoma-associated herpesvirus targets the retinoblastomaE2F pathway and with the oncogene Hras transforms primary rat cells. Nature Medicine 6, 1121-1127.[Medline]
Rainbow, L., Platt, G. M., Simpson, G. R., Sarid, R., Gao, S. J., Stoiber, H., Herrington, C. S., Moore, P. S. & Schulz, T. F. (1997). The 222- to 234-kilodalton latent nuclear protein (LNA) of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) is encoded by orf73 and is a component of the latency-associated nuclear antigen. Journal of Virology 71, 5915-5921.[Abstract]
Renne, R., Barry, C., Dittmer, D., Compitello, N., Brown, P. O. & Ganem, D. (2001). Modulation of the cellular and viral gene expression by the latency-associated nuclear antigen of Kaposis sarcoma-associated herpesvirus. Journal of Virology 75, 458-468.
Rhee, K., Brunori, M., Besset, V., Trousdale, R. & Wolgemuth, D. J. (1998). Expression and potential role of Fsrg1, a murine bromodomain-containing homologue of the Drosophila gene female sterile homeotic. Journal of Cell Science 111, 3541-3550.[Abstract]
Szekely, L., Chen, F., Teramoto, N., Ehlin-Henriksson, B., Pokrovskaja, K., Szeles, A., Manneborg-Sandlund, A., Löwbeer, M., Lennette, E. T. & Klein, G. (1998). Restricted expression of EpsteinBarr virus (EBV)-encoded, growth transformation-associated antigens in an EBV- and human herpesvirus type 8-carrying body cavity lymphoma line. Journal of General Virology 79, 1445-1452.[Abstract]
Szekely, L., Kiss, C., Mattsson, K., Kashuba, E., Pokrovskaja, K., Juhasz, A., Holmvall, P. & Klein, G. (1999). Human herpesvirus-8-encoded LNA-1 accumulates in heterochromatin-associated nuclear bodies. Journal of General Virology 80, 2889-2900.
Taniguchi, Y., Matsuzaka, Y., Fujimoto, H., Miyado, K., Kohda, A., Okumura, K., Kimura, M. & Inoko, H. (1998). Nucleotide sequence of the ring3 gene in the class II region of the mouse MHC and its abundant expression in testicular germ cells. Genomics 51, 114-123.[Medline]
Received 9 July 2001;
accepted 12 September 2001.
This article has been cited by other articles:
![]() |
M. Ottinger, T. Christalla, K. Nathan, M. M. Brinkmann, A. Viejo-Borbolla, and T. F. Schulz Kaposi's Sarcoma-Associated Herpesvirus LANA-1 Interacts with the Short Variant of BRD4 and Releases Cells from a BRD4- and BRD2/RING3-Induced G1 Cell Cycle Arrest J. Virol., November 1, 2006; 80(21): 10772 - 10786. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. You, V. Srinivasan, G. V. Denis, W. J. Harrington Jr., M. E. Ballestas, K. M. Kaye, and P. M. Howley Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Bromodomain Protein Brd4 on Host Mitotic Chromosomes. J. Virol., September 1, 2006; 80(18): 8909 - 8919. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Lu, L. Day, S.-J. Gao, and P. M. Lieberman Acetylation of the Latency-Associated Nuclear Antigen Regulates Repression of Kaposi's Sarcoma-Associated Herpesvirus Lytic Transcription. J. Virol., June 1, 2006; 80(11): 5273 - 5282. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Viejo-Borbolla, M. Ottinger, E. Bruning, A. Burger, R. Konig, E. Kati, J. A. Sheldon, and T. F. Schulz Brd2/RING3 Interacts with a Chromatin-Binding Domain in the Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 (LANA-1) That Is Required for Multiple Functions of LANA-1 J. Virol., November 1, 2005; 79(21): 13618 - 13629. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. McPhillips, K. Ozato, and A. A. McBride Interaction of Bovine Papillomavirus E2 Protein with Brd4 Stabilizes Its Association with Chromatin J. Virol., July 15, 2005; 79(14): 8920 - 8932. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Baxter, M. G. McPhillips, K. Ozato, and A. A. McBride The Mitotic Chromosome Binding Activity of the Papillomavirus E2 Protein Correlates with Interaction with the Cellular Chromosomal Protein, Brd4 J. Virol., April 15, 2005; 79(8): 4806 - 4818. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. DeWire and B. Damania The Latency-Associated Nuclear Antigen of Rhesus Monkey Rhadinovirus Inhibits Viral Replication through Repression of Orf50/Rta Transcriptional Activation J. Virol., March 1, 2005; 79(5): 3127 - 3138. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Stedman, Z. Deng, F. Lu, and P. M. Lieberman ORC, MCM, and Histone Hyperacetylation at the Kaposi's Sarcoma-Associated Herpesvirus Latent Replication Origin J. Virol., November 15, 2004; 78(22): 12566 - 12575. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ohsaki, K. Ueda, S. Sakakibara, E. Do, K. Yada, and K. Yamanishi Poly(ADP-Ribose) Polymerase 1 Binds to Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Terminal Repeat Sequence and Modulates KSHV Replication in Latency J. Virol., September 15, 2004; 78(18): 9936 - 9946. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Canham and S. J. Talbot A naturally occurring C-terminal truncated isoform of the latent nuclear antigen of Kaposi's sarcoma-associated herpesvirus does not associate with viral episomal DNA J. Gen. Virol., June 1, 2004; 85(6): 1363 - 1369. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Fowler, S. Marques, J. P. Simas, and S. Efstathiou ORF73 of murine herpesvirus-68 is critical for the establishment and maintenance of latency J. Gen. Virol., December 1, 2003; 84(12): 3405 - 3416. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Pan, Y.-J. Zhang, X.-P. Wang, J.-H. Deng, F.-C. Zhou, and S.-J. Gao Identification of a Novel Cellular Transcriptional Repressor Interacting with the Latent Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus J. Virol., September 15, 2003; 77(18): 9758 - 9768. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujimuro and S. D. Hayward The Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Manipulates the Activity of Glycogen Synthase Kinase-3{beta} J. Virol., July 15, 2003; 77(14): 8019 - 8030. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Viejo-Borbolla, E. Kati, J. A. Sheldon, K. Nathan, K. Mattsson, L. Szekely, and T. F. Schulz A Domain in the C-Terminal Region of Latency-Associated Nuclear Antigen 1 of Kaposi's Sarcoma-Associated Herpesvirus Affects Transcriptional Activation and Binding to Nuclear Heterochromatin J. Virol., June 15, 2003; 77(12): 7093 - 7100. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Dourmishev, A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis Microbiol. Mol. Biol. Rev., June 1, 2003; 67(2): 175 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schafer, D. Lengenfelder, C. Grillhosl, C. Wieser, B. Fleckenstein, and A. Ensser The Latency-Associated Nuclear Antigen Homolog of Herpesvirus Saimiri Inhibits Lytic Virus Replication J. Virol., May 15, 2003; 77(10): 5911 - 5925. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Krithivas, M. Fujimuro, M. Weidner, D. B. Young, and S. D. Hayward Protein Interactions Targeting the Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus to Cell Chromosomes J. Virol., October 11, 2002; 76(22): 11596 - 11604. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |