|
|
||||||||
Animal: RNA Viruses |
Complement Biology Group, Department of Medical Biochemistry, University of Wales College of Medicine, 3rd floor Tenovus Building, Heath Park, Cardiff CF14 4XX, UK1
Division of Virology, Institute of Biomedical and Life Sciences, University of Glasgow, Church Street, Glasgow G11 5JR, UK2
Author for correspondence: Brad Spiller. Fax +44 2920 744305. e-mail SpillerB{at}cardiff.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The ability of CVB serotypes 1, 3 and 5 to infect pig kidney cells in vitro has already been established (Knowles et al., 1979
) and a recent report indicates that CVB5 is related more closely to the pathogenic swine vesicular disease virus (SVDV) than to the other CVB serotypes (Zhang et al., 1999
). The homology of SVDV to CVB5 suggests strongly that the former is a pig-adapted version of the latter that crossed the species barrier some time between 1945 and 1965 (Zhang et al., 1999
). SVDV retained the ability to infect HeLa cells and infection was blocked by anti-human DAF antibodies (Martino et al., 2000
). These data suggested a role for DAF in the infection of pig cells with SVDV and raised the possibility that the closely related CBV may bind pig DAF.
The ability of viruses to cross species between humans and pigs is of increasing concern due to interest in using pigs as a source of transplant tissue (Weiss, 1999
; Weiss et al., 1999
). Although these concerns have focused predominantly on the transmission of pig retroviruses to humans, the possibility of human virus infection and destruction of transplanted pig organs should not be ignored. It is therefore important to establish the capacity of human viruses to bind and infect pig cells and to identify the receptors involved in cell entry. These receptors may be useful for therapeutic intervention or gene manipulation in the future.
Here, we investigate the ability of CVB serotypes 1, 3 and 5 to bind pig DAF and CAR analogues. Initially, the capacity of CVB to infect three pig cell lines was confirmed. We then assessed the ability of anti-pig DAF and CAR antibodies to block CVB infection. CHO cells, which do not bind CVB without the addition of CVB receptors, were used as target cells following transfection with human and pig DAF or CAR. Since pig DAF has only three short consensus repeats (SCRs), compared with four SCRs in human DAF, we also tested the binding of CVB to pig DAF following the addition of a fourth SCR from human DAF.
| Methods |
|---|
|
|
|---|
Virus strains.
Antibodies.
A mouse mAb recognizing DAF, MBC1, and the anti-pig DAF mAb PD3 were generated in-house. The hybridoma cell line, OX23, secreting mouse anti-human factor H mAb was obtained from the ECACC and was used as the isotype-matched control for the mouse mAbs. Rabbit polyclonal antisera were raised against soluble recombinant pig DAF and human CAR (described below) in-house. Rabbit polyclonal antiserum raised against soluble human herpesvirus 8 (HHV-8) ORF4, also raised in-house, provided a control antibody for the rabbit polyclonal antiserum. Phycoerythrin (PE)-conjugated goat anti-mouse Ig secondary antibody was purchased from DAKO and PE-conjugated goat anti-rabbit Ig secondary antibody was purchased from Sigma. Horseradish peroxidase-conjugated goat anti-rabbit Ig secondary antibody was purchased from Bio-Rad.
Sequence data.
All amino acid sequences used for alignments and primer design were identical to those available at the NIH National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/). Accession numbers for each protein are as follows: AF228059 (pig DAF), M15799 (human DAF), AF109646 (pig CAR), Y11929 (mouse CAR) and BC003684 (human CAR). The boundaries for each SCR in pig DAF were defined by sequence similarity to human DAF.
Cell lines.
A pig kidney cell line, ESK-4, and human cell lines HeLa and RD were obtained from the ECACC and the pig cell lines IB-RS-2 (kidney) and ST (testis) were obtained from the ATCC. All cells were propagated in DMEM containing 10% FCS (Gibco BRL). CHO cells obtained from ECACC were transfected with the empty eukaryotic transfection vector pDR2EF1
or with the vector containing cDNA encoding pig or human DAF or CAR using lipofectamine (Gibco BRL) according to the manufacturers instructions. Stable clones were generated by selection and propagation in the presence of 100 µg/ml hygromycin B. Cell surface expression for CHO-transfected cells was measured by flow cytometry by using a Becton-Dickinson FACScalibur.
Enterovirus capsid detection assay.
Pig and human cell lines were seeded into 24-well plates (Gibco BRL) at a density of 5x105 cells per well and allowed to grow overnight. The following morning, the cell layers were washed twice with serum-free DMEM and infected with virus stocks diluted to m.o.i. of 50, 10, 1 or 0·1. Cells were incubated with virus for 30 min at room temperature and then for 30 min at 37 °C, unbound virus was removed by two washes of serum-free DMEM, cells were overlaid with 1 ml DMEM per well and the infection was allowed to proceed for 24 h at 37 °C in a CO2 incubator. All infections were performed in triplicate and experiments were repeated at least once. At 24 h post-infection, the cell layers were washed twice with PBS and then incubated at -70 °C for 15 min with a acetonemethanol (1:1) fixative. Fixed cell sheets were then washed three times with PBS and three times with PBS with 1% BSA and virus capsid protein was then detected by using an anti-enterovirus mAb (DAKO) at room temperature for 1 h with constant rocking. After three washes with PBS, bound anti-virus antibody was detected with
-galactosidase-conjugated goat anti-mouse Ig (Harlan Sera-lab), following the manufacturers instructions. Cells containing enterovirus capsids were observed as blue cells under the microscope and the number of blue cells compared with unstained cells in 10 microscope fields was counted for each well.
Virus binding studies.
CVB serotypes were metabolically labelled by propagation in RD cells maintained overnight in cysteine-/methionine-free medium containing 0·5 MBq 35S-labelled cysteine/methionine (Amersham Pharmacia). Cell debris was removed by low-speed centrifugation (5 min at 1300 g) and the virus was separated from unincorporated radiolabel by centrifugation through a 30% sucrose cushion in 1 M NaCl, 20 mM Trisacetate (pH 7·5) with 0·1% BSA (125000 g in an SW28 rotor, overnight at 4 °C). Pelleted virus was resuspended in serum-free medium, particulate material was removed by centrifugation (1300 g, 10 min) and the concentration of virus was determined by TCID50 on RD cells. The virus was stored in aliquots at -20 °C until used.
Fifty µl of each radiolabelled virus (diluted 10-fold from stocks with DMEM) was counted to determine the input radioactivity for CVB1 (54000 c.p.m./50 µl), CVB3 (39000 c.p.m./50 µl) and CVB5 (64000 c.p.m./50 µl). TCID50 values for all viruses used were approximately 108 per ml. The binding of each virus was tested for each CHO-transfected cell line by pelleting 107 EDTA-disaggregated cells (1000 g, 5 min) in ice-cold, FCS-free cell medium and then resuspending the cell pellet in 50 µl of radiolabelled virus. After a 2 h incubation on ice, unbound virus was removed by three 1 ml washes in ice-cold, serum-free cell medium and bound virus was quantified by scintillation counting. Each condition was performed in triplicate and repeated at least twice to confirm the results.
Blocking of CVB lysis of pig cells.
Rabbit IgG was purified from antiserum raised against human CAR, pig DAF or HHV-8 ORF4 by using a Protein ASepharose column (Amersham Pharmacia), following the manufacturers instructions, and dialysed into PBS. Pig or HeLa cells (10000 per well) were subcultured into 96-well tissue culture plates (Gibco BRL) and cultured overnight at 37 °C. Antibodies were added to DMEM at a final concentration of 10 µg/ml, sterile-filtered and then used to replace the medium on the cells to be blocked 30 min prior to addition of virus. Cells incubated with medium without added antibody served as the mock control and cells incubated with anti-HHV-8 ORF4 served as an irrelevant antibody control. Fivefold dilutions of each CVB were then overlaid onto the cells and incubated at 37 °C for 3 days. The remaining viable cells were visualized by staining with 0·1% crystal violet, 0·1% formaldehyde in PBS followed by extensive washing in running water. Successful blocking of infection was observed as a viable blue cell layer at 3 days post-infection.
PCR amplification of pig and human CAR cDNA.
RNA extracted from HeLa, IB-RS-2, ESK-4 and ST cell lines was subjected to reverse transcription followed by PCR according to the suppliers instructions. Total cellular RNA was extracted using UltraSpec (Biotecx Laboratories) according to the manufacturers instructions.
Primers used were as follows (5'3'): HCAR F1 (CACTAGTATGGCGCTCCTGCTGT), CAR B802 (TCCATTCTTCTCTGCGCTTTTTACGAC), CAR F88 (GAAAAAGCCAAAGGGGA), CAR B1098 (CTATACTATAGACCC) and OVERLAP R (CCCTTTGGCTTTTTCAATCATCTCTTCA).
CAR primers F88, B802 and B1098 were all designed based on areas of high similarity between human and murine CAR sequences. Primer CAR B802 includes a stop codon at the 3' end for truncated expression of the cDNA product.
A PCR product encoding full-length human CAR cDNA was obtained from reverse-transcribed HeLa mRNA by using primers HCAR F1 and CAR B1098. This was used for expression of human CAR. No product was observed when reverse-transcribed mRNA from pig cell lines was used with these primers. Only primers CAR F88 and CAR B802 gave a PCR product from pig mRNA; the product encoded the pig homologue of human CAR, but was missing the signal sequence and ended 15 nt after the transmembrane region. Since the sequence for pig CAR was not available at the time, a recombinant pig CAR was constructed that had a human CAR signal sequence and was truncated 15 nt after the transmembrane region by the insertion of an in-frame stop codon by overlapping PCR mutagenesis. All products were ligated into pCR 2.1-TOPO by using the TOPO TA cloning system (Invitrogen) and then subcloned into the eukaryotic expression vector pDR2
EF1
(Harris et al., 2000
). Recombinant soluble human CAR coupled to human IgG1 Fc was constructed by PCR with the primers HCAR F1 and HCAR B618 (5' GGCGGCCGCTTTATTTGAAGGAGGG 3'), which truncates the predicted protein just above the putative transmembrane region and adds a NotI restriction site at the 3' end of the cDNA. These primers allow the insertion of the PCR product into the expression vector Signal pIgplus (R&D Systems), which adds (when in-frame and in the absence of premature stop codons) cDNA encoding the hinge and Fc regions of human IgG1 to the 3' end of the cDNA. Fidelity and orientation of all cDNA and PCR products were confirmed by sequencing.
Human and pig DAF expression constructs.
Eukaryotic expression vectors based on pDR2
EF1
and containing human DAF and pig DAF were already available in-house (Harris et al., 2000
; Perez de la Lastra et al., 2000
). Pig DAF contains three only SCRs compared to four SCRs for human DAF; a fusion construct was therefore created to insert the fourth SCR of human DAF between the pig DAF SCR3 and the Ser-/Thr-rich region and transmembrane anchor by overlapping PCR mutagenesis. Primers used for the fusion were (5'3'): PDAF S1 (GGTCTAGAGCGGTGAGGCGCCTAATGG), PDAF END (GGTGGATCCCAGTGTTACACATGCACGTCC), HP1 (CCAGAATGCCAAGAAATTTATTGTCCAGCACC), HP2 (ACAATAAATTCTTGGCATTCTGGCAATGG), HP3 (TGGAGAAATTTCTCTGCATTCAGGTGGTGG) and HP4 (CCTGAATGCAGAGAAATTTCTCCAACTGCT). Primer PDAF S1 adds an XbaI restriction site to the 5' end of the product and primer PDAF END adds a BamHI restriction site to the 3' end. PCR was performed with pig DAF cDNA as a template with primers PDAF S1 and HP2 to generate the 5' end of pig DAF and HP4 and PDAF END to generate the 3' end of pig DAF. Human DAF SCR4 was amplified with primers HP1 and HP3. The 5'-end PCR product was annealed to the human DAF SCR PCR products and extendedamplified with primers S1 and HP3. This product was subsequently annealed with the 3'-end pig DAF PCR product and amplified with the primers S1 and PDAF END. The resultant product was cloned into the expression plasmid pDR2
EF1
. Fidelity and orientation of all PCR products and the final recombinant cDNA were confirmed by sequencing.
| Results |
|---|
|
|
|---|
|
|
|
|
CAR is expressed by pig cell lines and HeLa cells
Total RNA was isolated from the IB-RS-2, ESK-4 and ST cell lines and from human HeLa cells. RTPCR was performed on all samples with several different primer pairs (see Methods). Full-length human CAR (nt 11098) was isolated from HeLa cells and sequenced. The only difference from the published CAR sequence was a G
A change at nt 120, which did not alter the amino acid sequence. This human CAR cDNA was put into two expression vectors, one that expressed the full-length CAR on the surface of transfected CHO cells and a second that produced a truncated soluble human CAR that was used to immunize rabbits (see Methods). The largest PCR product obtained for pig CAR using the human and murine CAR sequence-based primers yielded pig CAR sequence from nt 88 to 802 only for RNA isolated from IB-RS-2, ESK-4 and ST cell lines. The sequence for pig CAR was identical among all cell lines.
Attempts to complete the 5' and 3' cDNA sequence of pig CAR were unsuccessful, so the human cDNA sequence encoding the first 29 aa of CAR, the signal sequence, was engineered onto the pig CAR to allow protein expression. Since this is cleaved co-translationally, it would not affect the mature protein product. Similarly, the missing 3' sequence represented the cytoplasmic tail; a stop codon was therefore inserted at aa 267, which truncates pig CAR but should not affect the ability of CAR to act as a receptor (Wang & Bergelson, 1999
). This modified pig CAR cDNA was inserted into the eukaryotic expression vector pDR2
EF1
and transfected into CHO cells for further investigation. Expression of human and pig CAR on the transfected CHO cells was tested by flow cytometry with a rabbit polyclonal antibody raised against recombinant soluble human CAR (Fig. 3A
). Both pig and human CAR were detected by the anti-human CAR polyclonal antibody and showed uniform expression on the transfected cells. Protein expression was confirmed by Western blot analysis (Fig. 3B
). The pig CAR was found to be 11 kDa smaller than full-length human CAR, as expected due to the truncation of 98 residues of the cytoplasmic tail by the insertion of a stop codon at residue 267. Western blot analysis comparing total cell lysates from human HeLa and U373-MG cell lines, both known to express high levels of CAR (Miller et al., 1998
; Bergelson et al., 1997a
), and the pig kidney IB-RS-2 cell line revealed a single band of approximately 4648 kDa for all three cell lines (Fig. 4
).
|
|
|
|
| Discussion |
|---|
|
|
|---|
Rabbit polyclonal anti-pig DAF antibodies were not able to block CVB infection and radiolabelled CVB did not bind CHO cells expressing pig DAF. This is similar to our findings for CVB binding to mouse DAF (Spiller et al., 2000
). While mouse DAF has the same extracellular structure as human DAF (four SCRs separated from the membrane attachment by a Ser-/Thr-rich region; Spicer et al., 1995
), pig DAF contains homologues for only the first three SCRs followed by a Ser-/Thr-rich region and is approximately 64% identical to human DAF at the amino acid level (Perez de la Lastra et al., 2000
). Sequence comparison indicates that pig DAF is missing the homologue for human DAF SCR4. Despite this major structural difference, our previous characterization of pig DAF demonstrates that it is the homologue of human DAF and not a distinct member of the complement regulatory protein super-family. For example, several key structural features unique to DAF are conserved, including the critical tandem lysine residues (K125127) and adjacent hydrophobic residues at the junction between SCRs 2 and 3, known to be important for complement-regulating function (summarized in Perez de la Lastra et al., 2000
). Pig DAF also expressed decay-accelerating activity to regulate human complement activation, albeit to a lesser extent than human DAF.
Bergelson et al. (1995)
have shown, by binding of radiolabelled CVB3 to human DAF SCR-deletion constructs, that SCR2 played the dominant role in CVB3 binding; however, Shafren et al. (1995)
found that only monoclonal anti-human DAF antibodies recognizing SCR3 could block CVB3 infection, and it has been shown that removal of SCR4 eliminated the binding of other related picornaviruses to human DAF (Powell et al., 1998
). Other evidence has been reported that shows that deletion of human DAF SCR4 does not effect binding of CVB3 (Bergelson et al., 1995
). In order to eliminate the possibility that failure of CVB to bind pig DAF was due to altered spacing resulting from the absence of SCR4, we constructed a recombinant form of pig DAF that had human DAF SCR4 inserted between pig DAF SCR3 and the Ser-/Thr-rich region. Incorporation of human SCR4 did not confer binding of any CVB serotype to pig DAF, confirming that pig DAF was intrinsically incapable of binding CVB and also indicating that CVB do not bind human SCR4 alone.
Since CVB serotypes did not bind pig DAF, we investigated whether CVB could bind pig CAR. By using primers based on the existing human and murine CAR sequences, we isolated cDNA from three separate pig cell lines encoding the pig CAR homologue. This sequence was approximately 90% identical to human CAR at the amino acid level. Based on the structure of human CAR and the other members of the CTX homologue family predicted by Chretien et al. (1998)
, it was evident that this pig CAR cDNA was missing the 5' signal sequence and a large portion of the 3' cytoplasmic tail of the mature predicted protein, so a construct including the human CAR signal sequence and a truncated cytoplasmic tail was generated for expression in CHO cells. The loss of the cytoplasmic tail from pig CAR is unlikely to affect its ability to act as a receptor, as it has been demonstrated previously that exchanging the transmembrane region of human CAR for a glycolipid anchor does not affect receptor function (Wang & Bergelson, 1999
). While this work was in progress, Fechner et al. (1999)
published a partial sequence for pig CAR that matched our sequence exactly.
Transfection of the isolated pig CAR cDNA into CHO cells conferred permissive infection by CVB, as assessed by virus entry and production of CVB capsid proteins, demonstrating that pig CAR was a receptor for CVB. Rabbit polyclonal anti-human CAR antibodies generated against recombinant CAR cross-reacted strongly with pig CAR expressed on CHO cells and identified a single 4648 kDa protein in human and pig cell lines. Following pre-incubation with pig cell lines, this antibody blocked CVB binding, confirming that a functional CAR homologue was present on pig cells.
In summary, we show that pig DAF cannot function as a receptor for CVB serotypes that utilize human DAF as a receptor, but a homologue of CAR is present on pig cells and can mediate CVB binding and infection. While we cannot rule out the presence of additional CVB receptors on pig cells, our infection-blocking studies with CAR-specific antibodies suggest that pig CAR is the dominant receptor.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bergelson, J. M., Mohanty, J. G., Crowell, R. L., St John, N. F., Lublin, D. M. & Finberg, R. W. (1995). Coxsackievirus B3 adapted to growth in RD cells binds to decay-accelerating factor (CD55). Journal of Virology 69, 1903-1906.[Abstract]
Bergelson, J. M., Modlin, J. F., Wieland-Alter, W., Cunningham, J. A., Crowell, R. L. & Finberg, R. W. (1997a). Clinical coxsackievirus B isolates differ from laboratory strains in their interaction with two cell surface receptors. Journal of Infectious Diseases 175, 697-700.[Medline]
Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L. & Finberg, R. W. (1997b). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323.
Bergelson, J. M., Krithivas, A., Celi, L., Droguett, G., Horwitz, M. S., Wickham, T., Crowell, R. L. & Finberg, R. W. (1998). The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses. Journal of Virology 72, 415-419.
Carson, S. D., Chapman, N. N. & Tracy, S. M. (1997). Purification of the putative coxsackievirus B receptor from HeLa cells. Biochemical and Biophysical Research Communications 233, 325-328.[Medline]
Chretien, I., Marcuz, A., Courtet, M., Katevuo, K., Vainio, O., Heath, J. K., White, S. J. & Du Pasquier, L. (1998). CTX, a Xenopus thymocyte receptor, defines a molecular family conserved throughout vertebrates. European Journal of Immunology 28, 4094-4104.[Medline]
Fechner, H., Haack, A., Wang, H., Wang, X., Eizema, K., Pauschinger, M., Schoemaker, R., Veghel, R., Houtsmuller, A., Schultheiss, H. P., Lamers, J. & Poller, W. (1999). Expression of coxsackie adenovirus receptor and
v-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Therapy 6, 1520-1535.[Medline]
Harris, C. L., Spiller, O. B. & Morgan, B. P. (2000). Human and rodent decay-accelerating factors (CD55) are not species restricted in their complement-inhibiting activities. Immunology 100, 462-470.[Medline]
Hsu, K. H., Lonberg-Holm, K., Alstein, B. & Crowell, R. L. (1988). A monoclonal antibody specific for the cellular receptor for the group B coxsackieviruses. Journal of Virology 62, 1647-1652.
Knowles, N. J., Buckley, L. S. & Pereira, H. G. (1979). Classification of porcine enteroviruses by antigenic analysis and cytopathic effects in tissue culture: description of 3 new serotypes. Archives of Virology 62, 201-208.[Medline]
Lonberg-Holm, K., Crowell, R. L. & Philipson, L. (1976). Unrelated animal viruses share receptors. Nature 259, 679-681.[Medline]
Martino, T. A., Petric, M., Weingartl, H., Bergelson, J. M., Opavsky, M. A., Richardson, C. D., Modlin, J. F., Finberg, R. W., Kain, K. C., Willis, N., Gauntt, C. J. & Liu, P. P. (2000). The coxsackie-adenovirus receptor (CAR) is used by reference strains and clinical isolates representing all six serotypes of coxsackievirus group B and by swine vesicular disease virus. Virology 271, 99-108.[Medline]
Miller, C. R., Buchsbaum, D. J., Reynolds, P. N., Douglas, J. T., Gillespie, G. Y., Mayo, M. S., Raben, D. & Curiel, D. T. (1998). Differential susceptibility of primary and established human glioma cells to adenovirus infection: targeting via the epidermal growth factor receptor achieves fiber receptor-independent gene transfer. Cancer Research 58, 5738-5748.
Morens, D. M. & Pallansch, M. A. (1995). Epidemiology (of human enterovirus infections). In Human Enterovirus Infections , pp. 3-23. Edited by H. A. Rotbart. Washington, DC:American Society for Microbiology.
Perez de la Lastra, J. M., Harris, C. L., Hinchliffe, S. J., Holt, D. S., Rushmere, N. K. & Morgan, B. P. (2000). Pigs express multiple forms of decay-accelerating factor (CD55), all of which contain only three short consensus repeats. Journal of Immunology 165, 2563-2573.
Powell, R. M., Schmitt, V., Ward, T., Goodfellow, I., Evans, D. J. & Almond, J. W. (1998). Characterization of echoviruses that bind decay accelerating factor (CD55): evidence that some haemagglutinating strains use more than one cellular receptor. Journal of General Virology 79, 1707-1713.[Abstract]
Roelvink, P. W., Lizonova, A., Lee, J. G., Li, Y., Bergelson, J. M., Finberg, R. W., Brough, D. E., Kovesdi, I. & Wickham, T. J. (1998). The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F. Journal of Virology 72, 7909-7915.
Shafren, D. R., Bates, R. C., Agrez, M. V., Herd, R. L., Burns, G. F. & Barry, R. D. (1995). Coxsackieviruses B1, B3, and B5 use decay accelerating factor as a receptor for cell attachment. Journal of Virology 69, 3873-3877.[Abstract]
Shafren, D. R., Williams, D. T. & Barry, R. D. (1997). A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells. Journal of Virology 71, 9844-9848.[Abstract]
Spicer, A. P., Seldin, M. F. & Gendler, S. J. (1995). Molecular cloning and chromosomal localization of the mouse decay-accelerating factor genes. Duplicated genes encode glycosylphosphatidylinositol-anchored and transmembrane forms. Journal of Immunology 155, 3079-3091.[Abstract]
Spiller, O. B., Goodfellow, I. G., Evans, D. J., Almond, J. W. & Morgan, B. P. (2000). Echoviruses and coxsackie B viruses that use human decay-accelerating factor (DAF) as a receptor do not bind the rodent analogues of DAF. Journal of Infectious Diseases 181, 340-343.[Medline]
Tomko, R. P., Xu, R. & Philipson, L. (1997). HCAR and MCAR: the human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proceedings of the National Academy of Sciences, USA 94, 3352-3356.
Wang, X. & Bergelson, J. M. (1999). Coxsackievirus and adenovirus receptor cytoplasmic and transmembrane domains are not essential for coxsackievirus and adenovirus infection. Journal of Virology 73, 2559-2562.
Weiss, R. A. (1999). Xenografts and retroviruses. Science 285, 1221-1222.
Weiss, R. A., Griffiths, D., Takeuchi, Y., Patience, C. & Venables, P. J. (1999). Retroviruses: ancient and modern. Archives of Virology Supplementum 15, 171-177.[Medline]
Zhang, G., Haydon, D. T., Knowles, N. J. & McCauley, J. W. (1999). Molecular evolution of swine vesicular disease virus. Journal of General Virology 80, 639-651.[Abstract]
Received 11 June 2001;
accepted 11 September 2001.
This article has been cited by other articles:
![]() |
S. Lecollinet, F. Gavard, M. J. E. Havenga, O. B. Spiller, A. Lemckert, J. Goudsmit, M. Eloit, and J. Richardson Improved Gene Delivery to Intestinal Mucosa by Adenoviral Vectors Bearing Subgroup B and D Fibers J. Virol., March 15, 2006; 80(6): 2747 - 2759. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. G. Goodfellow, D. J. Evans, A. M. Blom, D. Kerrigan, J. S. Miners, B. P. Morgan, and O. B. Spiller Inhibition of Coxsackie B Virus Infection by Soluble Forms of Its Receptors: Binding Affinities, Altered Particle Formation, and Competition with Cellular Receptors J. Virol., September 15, 2005; 79(18): 12016 - 12024. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Richardson, P. Brennan, M. Powell, S. Prince, Y.-H. Chen, O. B. Spiller, and M. Rowe Susceptibility of B lymphocytes to adenovirus type 5 infection is dependent upon both coxsackie-adenovirus receptor and {alpha}v{beta}5 integrin expression J. Gen. Virol., June 1, 2005; 86(6): 1669 - 1679. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Jimenez-Clavero, E. Escribano-Romero, V. Ley, and O. B. Spiller More recent swine vesicular disease virus isolates retain binding to coxsackie-adenovirus receptor, but have lost the ability to bind human decay-accelerating factor (CD55) J. Gen. Virol., May 1, 2005; 86(5): 1369 - 1377. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mercier, S. Verhaagh, J. Goudsmit, A. Lemckert, M. Monteil, M. Havenga, and M. Eloit Adenovirus fibre exchange alters cell tropism in vitro but not transgene-specific T CD8+ immune responses in vivo J. Gen. Virol., May 1, 2004; 85(5): 1227 - 1236. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Williams, Y. Chaudhry, I. G. Goodfellow, S. Lea, and D. J. Evans Interactions of decay-accelerating factor (DAF) with haemagglutinating human enteroviruses: utilizing variation in primate DAF to map virus binding sites J. Gen. Virol., March 1, 2004; 85(3): 731 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bhella, I. G. Goodfellow, P. Roversi, D. Pettigrew, Y. Chaudhry, D. J. Evans, and S. M. Lea The Structure of Echovirus Type 12 Bound to a Two-domain Fragment of Its Cellular Attachment Protein Decay-accelerating Factor (CD 55) J. Biol. Chem., February 27, 2004; 279(9): 8325 - 8332. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Verdaguer, M. A. Jimenez-Clavero, I. Fita, and V. Ley Structure of Swine Vesicular Disease Virus: Mapping of Changes Occurring during Adaptation of Human Coxsackie B5 Virus To Infect Swine J. Virol., September 15, 2003; 77(18): 9780 - 9789. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, F. Lin, P. R. Chipman, C. M. Bator, T. S. Baker, M. Shoham, R. J. Kuhn, M. E. Medof, and M. G. Rossmann Structure of decay-accelerating factor bound to echovirus 7: A virus-receptor complex PNAS, August 6, 2002; 99(16): 10325 - 10329. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |