J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krauss, O.
Right arrow Articles by Smith, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krauss, O.
Right arrow Articles by Smith, G. L.
Agricola
Right arrow Articles by Krauss, O.
Right arrow Articles by Smith, G. L.
Journal of General Virology (2002), 83, 2347-2359.
© 2002 Society for General Microbiology


Animal: DNA Viruses

An investigation of incorporation of cellular antigens into vaccinia virus particles

Oliver Kraussa,1, Ruth Hollinshead1, Michael Hollinshead1 and Geoffrey L. Smith1

Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK1

Author for correspondence: Geoffrey L. Smith. Present address: Department of Virology, Room 333, The Wright–Fleming Institute, Faculty of Medicine, Imperial College of Science, Technology and Medicine, St Mary’s Campus, Norfolk Place, London W2 1PG, UK. Fax +44 207 594 3973. e-mail glsmith{at}ic.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Vaccinia virus (VV) infection produces several types of virus particle called intracellular mature virus (IMV), intracellular enveloped virus (IEV), cell-associated enveloped virus (CEV) and extracellular enveloped virus (EEV). Some cellular antigens are associated with EEV and these vary with the cell type used to grow the virus. To investigate if specific cell antigens are associated with VV particles, and to address the origin of membranes used to envelope IMV and IEV/CEV/EEV, we have studied whether cell antigens and foreign antigens expressed by recombinant VVs are incorporated into VV particles. Membrane proteins that are incorporated into the endoplasmic reticulum (ER), intermediate compartment (IC), cis/medial-Golgi, trans-Golgi network (TGN) or plasma membrane were not detected in purified IMV particles. In contrast, proteins present in the TGN or membrane compartments further downstream in the exocytic pathway co-purify with EEV particles when analysed by immunoblotting. Immunoelectron microscopy found only low levels of these proteins in IEV, CEV/EEV. The incorporation of foreign antigens into VV particles was not affected by loss of individual IEV or EEV-specific proteins or by redirection of B5R to the ER. These data suggest that (i) host cell antigens are excluded from the lipid envelope surrounding the IMV particle and (ii) membranes of the ER, IC and cis/medial-Golgi are not used to wrap IMV particles to form IEV. Lastly, the VV haemagglutinin was absent from one-third of IEV and CEV/EEV particles, whereas other EEV antigens were present in all these virions.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Vaccinia virus (VV) is the most intensively studied poxvirus (Moss, 2001Down ). It is a member of the Orthopoxvirus genus and is the vaccine used to eradicate smallpox (Fenner et al., 1988Down ). Each cell infected with VV produces four different virus particles called intracellular mature virus (IMV), intracellular enveloped virus (IEV), cell-associated enveloped virus (CEV) and extracellular enveloped virus (EEV). These complex virions have different roles in the virus life-cycle and contain more than 100 polypeptides (Essani & Dales, 1979Down ).

VV morphogenesis commences in cytoplasmic virus factories from which cellular organelles are largely excluded. The first structures seen within these factories are crescent-shaped and are composed of lipid and virus-encoded protein. The nature and origin of the crescents has been disputed: early studies reported that they contained a single lipid bilayer and were synthesized de novo (Dales & Siminovitch, 1961Down ; Dales & Mosbach, 1968Down ). Subsequently, it was reported that the crescents contained a double lipid bilayer that was derived from and was continuous with membranes of the intermediate compartment (IC) between the endoplasmic reticulum (ER) and the trans-Golgi network (TGN) (Sodeik et al., 1993Down ; Griffiths et al., 2001Down ; Risco et al., 2002Down ). Another study reported that the crescent lacked continuity with cell membranes and contained a single membrane (Hollinshead et al., 1999Down ). Once formed, the crescent grows into an oval structure called immature virus (IV) that lacks infectivity. IVs mature into IMV particles by condensation associated with proteolytic cleavage of several core proteins. IMV is the first infectious form of virus and represents the majority of infectious progeny.

Many IMV particles remain in the cell until lysis; however, some are transported from the virus factory by microtubules (Sanderson et al., 2000Down ) to sites where these particles are wrapped by two intracellular membranes to form intracellular envelope virus (IEV) (Ichihashi et al., 1971Down ). Using antibodies specific for TGN markers, one group reported that the wrapping membranes were derived from the TGN (Schmelz et al., 1994Down ). Other studies using uptake of fluid phase markers provided evidence that the wrapping membranes were derived from the early endosomes (Tooze et al., 1993Down ; van Eijl et al., 2002Down ).

After their formation, IEV particles are transported to the cell surface on microtubules (Geada et al., 2001Down ; Hollinshead et al., 2001Down ; Rietdorf et al., 2001Down ; Ward & Moss, 2001Down ) and once at the plasma membrane the outer IEV membrane fuses with the plasma membrane to produce a CEV particle on the cell surface. CEV induce the polymerization of actin tails from beneath the virion (van Eijl et al., 2000Down ; Hollinshead et al., 2001Down ) to drive the CEV particle away from the cell either into adjacent cells or into the extracellular environment. When a CEV particle is released from the cell it is called EEV. CEV and EEV particles are morphologically indistinguishable and have one more lipid membrane than IMV and one less than IEV. With VV strain Western Reserve (WR) the majority of enveloped particles remain at the cell surface as CEV (Blasco & Moss, 1992Down ), whereas with VV strain IHD-J greater amounts of EEV are released (Payne, 1980Down ).

The outer membranes of CEV and EEV contain several virus-encoded and cellular proteins that are absent from IMV (Payne, 1978Down , 1979Down ). The virus-encoded antigens are A56R, the virus haemagglutinin (HA) (Payne & Norrby, 1976Down ; Shida, 1986Down ), F13L (Hirt et al., 1986Down ), B5R (Engelstad et al., 1992Down ; Isaacs et al., 1992Down ), A34R (Duncan & Smith, 1992Down ) and A33R (Roper et al., 1996Down ). These virus proteins are also all present in IEV together with two other proteins that are present only in IEV. These are A36R (van Eijl et al., 2000Down ) and F12L (Zhang et al., 2000Down ; van Eijl et al., 2002Down ).

The functions of these VV proteins have been studied using virus mutants with individual genes mutated, repressed or deleted (for an overview of their properties see Smith & Vanderplasschen, 1998Down ; Law et al., 2002Down ). The B5R (Engelstad & Smith, 1993Down ; Wolffe et al., 1993Down ) and F13L (Blasco & Moss, 1991Down ) proteins are needed for the efficient wrapping of IMV to form IEV, the F12L protein is needed for the microtubule-dependent transport of IEV particles to the cell surface (van Eijl et al., 2002Down ), A36R is needed for the formation of actin tails (Sanderson et al., 1998Down ; Wolffe et al., 1998Down ; Frischknecht et al., 1999Down ) beneath CEV particles (van Eijl et al., 2000Down ), and A33R (Roper et al., 1998Down ) and A34R (Duncan & Smith, 1992Down ; Blasco et al., 1993Down ; McIntosh & Smith, 1996Down ) affect the release of EEV, and, in the case of A34R, the specific infectivity of the released EEV (McIntosh & Smith, 1996Down ). Each of these proteins is needed for actin tail formation without which the plaque size is reduced. The only EEV protein that does not affect EEV formation or plaque size is A56R (Sanderson et al., 1998Down ), although loss of the protein causes a syncytial plaque phenotype (Ichihashi & Dales, 1971Down ). All of these proteins promote VV virulence in one model or other. The A36R protein has been shown to interact with the A33R and A34R proteins, whereas B5R forms a complex with A34R but not A33R or A36R (Röttger et al., 1999Down ).

Some cellular proteins co-purify with EEV preparations and these vary with the cell line used to grow the virus (Payne, 1978Down ). In addition, EEV, but not IMV, is associated with several specific host proteins including complement control proteins (Vanderplasschen et al., 1998Down ). The strain of virus used can also affect the proteins associated with EEV; for instance, the presence of cellular actin was reduced if the VV IHD-J rather than WR strain was used (van Eijl et al., 2000Down ) but none of the virus-encoded EEV-specific proteins has been shown to interact directly with host proteins. The presence of host proteins can affect the biological properties of virus particles. With VV it was demonstrated that the presence of CD55 rendered EEV particles resistant to complement (Vanderplasschen et al., 1998Down ) and with human immunodeficiency virus host proteins in the virus particle can affect virus neutralization by antibody (Arthur et al., 1992Down ) or enhance virus infectivity (Fortin et al., 1997Down ).

In this report we have investigated the incorporation of host cell proteins into IMV and EEV particles made by wild-type and seven mutant VVs by immunoblotting and immunoelectron microscopy. Using markers from a variety of intracellular membrane compartments we show that no cell proteins were incorporated into IMV particles, even if these proteins were targeted to the membrane compartment reported to form the IMV envelope and even if these proteins were overexpressed from recombinant VVs. However, cellular or foreign viral proteins did co-purify with EEV particles if these were located in the TGN or downstream compartments of the exocytic pathway. The implications of these finding are discussed.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
HeLa, TK-143 and CV-1 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) in 10% (v/v) foetal bovine serum (FBS). The WR mutants {Delta}A33R (Roper et al., 1998Down ), {Delta}A34R (McIntosh & Smith, 1996Down ), {Delta}A36R (Parkinson & Smith, 1994Down ), {Delta}A56R (Sanderson et al., 1998Down ), {Delta}B5R (Engelstad & Smith, 1993Down ), B5R-K2X2 and B5R-K2X4 (Mathew et al., 1999Down ) were described previously. The recombinant VVs expressing mouse hepatitis virus (MHV) M protein and infectious bronchitis virus (IBV) M protein (Klumperman et al., 1994Down ) and influenza virus HA (Smith et al., 1987Down ) were described before.

{blacksquare} Construction of recombinant VVs.
Recombinant VVs expressing the Bunyamwera virus G1 and G2 proteins were constructed by cloning the genes for each protein into plasmid pSC11 (Chakrabarti et al., 1985Down ). Each gene was amplified by PCR using plasmids pTF7-5G2 or pT7T3G1 as template (Lappin et al., 1994Down ). For amplification of the G1 gene oligonucleotides 5' GATCCAGAGGGTCCCGGGGTACATAAA (forward primer) and 5' ACAAAACAGCCCGGGTTTTTGACACAA (reverse primer) were used. The G2 gene was amplified using oligonucleotide 5' AGTAGTGTACCCGGGATACATCACAAA (forward primer) and oligonucleotide 5' GTTAGCAGCCCCGGGTTAAAAACCCTGACA (reverse primer). The resulting PCR products for G1 and G2 were cut with SmaI (underlined in each oligonucleotide) and cloned into pSC11 forming plasmids pSC11G1 and pSC11G2. These were sequenced to confirm the fidelity of the PCR products. These plasmids were transfected into VV WR-infected cells from which thymidine kinase-negative recombinant viruses were isolated by plaque assay on TK-143 cells as described previously (Chakrabarti et al., 1985Down ).

{blacksquare} Virus purification.
EEV and IMV were purified from HeLa cells 48 h post-infection (p.i.) with 0·1 p.f.u. per cell. For EEV, the cell supernatant was clarified by centrifugation (1000 g, 20 min, 4 °C) and the virus in the supernatant was pelleted by ultracentrifugation (35000 g, 90 min, 4 °C). Pelleted virus was resuspended in 10 mM Tris–HCl, pH 9, and kept on ice until the next step of the purification. IMV was purified from Dounce-homogenized, infected cell extracts from which nuclei and cell debris were removed by centrifugation (1000 g, 10 min, 4 °C). Further steps of purification were identical for EEV and IMV. Both materials were sonicated and then sedimented (35000 g, 80 min, 4 °C) through a sucrose cushion (36%, w/v, in 10 mM Tris–HCl, pH 9). The IMV and EEV pellets obtained were purified further by sucrose velocity sedimentation as described (Doms et al., 1990Down ). Virus bands were collected, and the virus was recovered by centrifugation.

{blacksquare} Antibodies.
Antibodies used against VV proteins were mouse monoclonal antibody (mAb) AB1.1 against the D8L protein ({alpha}-D8L) (Parkinson & Smith, 1994Down ), rat mAb 15B6 against the F13L protein ({alpha}-F13L) (Hiller & Weber, 1985Down ), rat mAb 19C2 against B5R (Schmelz et al., 1994Down ), mouse mAb 1H831 against A56R (Shida, 1986Down ) and rabbit polyclonal antibodies against A33R ({alpha}-A33R) and A34R ({alpha}-A34R) (Röttger et al., 1999Down ). Mouse mAbs against human proteins J4-48 ({alpha}-CD46), BRIC 110 ({alpha}-CD55), MEM-43 ({alpha}-CD59), and JS64 ({alpha}-CD81) were all obtained from Serotec, P4C10 ({alpha}-CD29), 58K-9 ({alpha}-Golgi 58 kDa), and BM-63 ({alpha}-{beta}2-microglobulin) were obtained from Sigma, HTR-H68.4 ({alpha}-CD71) was a gift from S. White (White et al., 1992Down ), and mAb HCA2 was against the major histocompatibility complex (MHC) class I antigen ({alpha}-MHC-I) (Stam et al., 1990Down ). Murine mAb G1/296 ({alpha}-p63) (Schweizer et al., 1993Down ), G1/93 ({alpha}-p53) (Schweizer et al., 1990Down ) and G1/133 ({alpha}-giantin) (Linstedt & Hauri, 1993Down ) were a gift from H.-P. Hauri. Rabbit polyclonal antibody N11 against human {beta}-1,4-galactosyltransferase ({alpha}-GalTrans) (Watzele et al., 1991Down ) was a gift from E. Berger and rabbit antiserum to EEA-1 ({alpha}-EEA-1) (Mu et al., 1995Down ) was a gift from H. Stenmark. The rabbit antiserum against the MHV M protein was a gift from P. Rottier (Klumperman et al., 1994Down ) and the mAb against the IBV M protein was a gift from D. Cavanagh (Mockett et al., 1984Down ). Bunyamwera virus proteins G1 and G2 were detected using a polyclonal rabbit serum raised against the virus (Watret et al., 1985Down ) and the influenza virus HA was detected with a polyclonal antiserum against influenza virus A/Cam/1/46 (Smith et al., 1987Down ).

{blacksquare} Immunoblotting.
Extracts from cells or purified VV particles were prepared as described (Parkinson & Smith, 1994Down ), and the Bunyamwera G2 protein samples were prepared as described (Nakitare & Elliott, 1993Down ). After SDS–PAGE, proteins were transferred to nitrocellulose membranes and identified with specific antibodies and a chemiluminescent detection system (Amersham) (Parkinson & Smith, 1994Down ). The primary antibodies were used at the following dilution or concentration: mAb AB1.1 (1:2000), {alpha}-F13L (1:1000), mAb J4-48 (0·5 µg/ml), mAb BRIC 110 (5 µg/ml), mAb MEM-43 (0·5 µg/ml), mAb JS64 (5 µg/ml), mAb HTR-H68.4 (10 µg/ml), mAb HCA2 (10 µg/ml), mAb P4C10 (1:1000), mAb 58K-9 (1:2000), mAb BM-63 (1:1000), mAb G1/296 (1:1000), mAb G1/93 (1:1000), mAb G1/133 (1:1000), rabbit polyclonal N11 (1:1000), rabbit antiserum to EEA-1 (1:1000), rabbit antiserum against the MHV M (1:1000), mAb against the IBV M protein (1:100), polyclonal rabbit serum against Bunyamwera virus (1:1000) and the polyclonal antiserum against influenza virus A/Cam/1/46 (1:1000). Bound Ig was detected by incubation with goat anti-rabbit, anti-rat or anti-mouse horseradish peroxidase conjugate (1:2000) (Sigma). Membranes were re-probed with a second or third antibody after they were stripped by incubation in 100 mM 2-mercaptoethanol, 2% SDS, 62·5 mM Tris–HCl pH 6·7 (50 °C, 30 min with gentle agitation) and then washed in PBS containing 0·1% Tween 20.

{blacksquare} Pre-embedding immunogold labelling and preparation of cells for electron microscopy.
Cells were fixed in 250 mM HEPES buffer pH 7·4 containing 4% paraformaldehyde (w/v) for 10 min on ice and 50 min at 20 °C. After washing with PBS and then PBS containing 10% heat-inactivated FBS (PBSF), cells were incubated successively with primary Ab (at 100–500-fold higher concentration than that used for immunoblotting), rabbit anti-mouse IgG (20 µg/ml in PBSF) or anti-rabbit Ig (Cappel) and finally with protein A–gold particles as described (Slot & Geuze, 1985Down ). All incubations were for 1 h at room temperature and were separated by extensive washing with PBS. Finally, the samples were fixed for 30 min in 200 mM cacodylate containing 0·5% glutaraldehyde and prepared for electron microscopy as described (Vanderplasschen et al., 1997Down ).

{blacksquare} Cryo-electron microscopy.
EEV preparations and virus-infected cells were processed for cryo-electron microscopy as described previously (van Eijl et al., 2002Down ).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The presence of cellular proteins in EEV preparations is not dependent on specific EEV proteins
In a previous study it was demonstrated that several host proteins were associated with EEV samples that had been purified by density gradient centrifugation and the presence of some of these (the complement control proteins CD46, CD55 and CD59) on the EEV envelope was confirmed by immunoelectron microscopy (Vanderplasschen et al., 1998Down ). The presence of CD55 rendered EEV resistant to destruction by complement, whereas IMV preparations lacked these host complement proteins and were sensitive to complement.

To extend these observations we have investigated whether other host proteins are present in EEV or IMV and whether the incorporation of these proteins is influenced by specific EEV or IEV proteins. EEV and IMV were purified after infection of HeLa cells with either VV strain WR or derivative mutants lacking the A33R, A34R, A36R, A56R or B5R proteins and were analysed by immunoblotting (Fig. 1Down). Two control mAbs were used in this and all subsequent immunoblots. First, to show that equal amounts of IMV and EEV had been loaded, the amount of the VV D8L protein was analysed with {alpha}-D8L and found to be equivalent. Second, the presence of the F13L protein was analysed with {alpha}-F13L. This protein is specific for EEV and its absence from IMV confirmed the purity of all IMV preparations. Next, the incorporation of CD46, CD55 and CD59, MHC-I, CD71 and CD81 was investigated. All were detected with uninfected cell lysates, wild-type EEV and EEV prepared from each mutant, but were absent from all IMV preparations. Evidently, the A33R, A34R, A36R, A56R and B5R proteins are not necessary for the presence of these cell antigens in EEV preparations.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1. Immunoblot analysis of VV IMV and EEV preparations. IMV and EEV were purified from HeLa cells infected with VV strain WR or with the indicated mutant VVs. Virus protein (3 µg) and extracts from 2x104 uninfected HeLa cells were resolved by SDS–PAGE and probed with the indicated Abs as described in Methods.

 
The incorporation of other cell proteins that are markers for specific cellular membrane compartments was investigated next. Markers selected were from the ER (p63), IC (p53), the Golgi complex (giantin and 58 kDa protein), TGN (GalTrans), early endosomes (EEA-1) and two cell surface markers (CD29 and {beta}2-microglobulin). The levels of p53, giantin, p58 and EEA-1 were below detectable levels under the conditions used, whereas the p63, GalTrans, CD29 and {beta}2-microglobulin were detected in cell extracts. Of these latter antigens, all except p63 were detected in EEV but not in IMV (Fig. 2Down). Again, the use of {alpha}-D8L and {alpha}-F13L mAbs served to confirm equal loading of virus samples and the purity of the IMV preparation.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2. Immunoblot analysis of VV IMV and EEV preparations. Samples were prepared and processed as in Fig. 1Up using the indicated Abs.

 
Recombinant VVs that express marker proteins for cell compartments
To overcome the difficulty of low amounts of cellular proteins that are specific for some intracellular membrane compartments, we used recombinant VVs that express specific marker proteins. VVs expressing the IBV M protein and the MHV M protein have been described and these coronavirus M proteins were reported to locate to the IC and TGN, respectively (Klumperman et al., 1994Down ). The glycoproteins G1 and G2 from Bunyamwera virus were also utilized. When expressed together these proteins co-localize to the Golgi, whereas if expressed separately they are located in the Golgi (G2) or the ER (G1) (Lappin et al., 1994Down ). Recombinant VVs expressing these proteins were constructed as described in Methods and shown to express the Bunyamwera proteins of the predicted sizes that were detected with specific antiserum (Fig. 3Down). Lastly, a recombinant VV expressing the influenza virus HA (Smith et al., 1987Down ) was used as a cell surface marker. All viruses were engineered to express the foreign gene from the same promoter (p7.5K) to ensure equivalent temporal and quantitative levels of gene expression.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3. Immunoblot analysis of IMV and EEV preparations from recombinant VVs (rVV). IMV (I) and EEV (E) were purified from cells infected with the indicated rVV expressing the Bunyamwera virus G1 or G2, the MHV M, IBV M or influenza virus HA. Protein samples were prepared and analysed as in Fig. 1Up using the indicated Abs. The membrane compartment into which the foreign protein expressed by the rVV is directed is indicated above each panel. {alpha}-Foreign antigen indicates that an antibody was used that is specific for the foreign protein expressed by each rVV.

 
Extracts from cells infected with each virus were shown by immunoblotting to express the relevant virus protein (Fig. 3Up). The control antibodies ({alpha}-D8L and {alpha}-F13L) showed again that the levels of IMV and EEV loaded were equivalent and that the IMV preparations were not contaminated with EEV or cell antigens. In each case, the foreign antigen was not associated with IMV preparations. The IC or ER-IC were proposed as the source of virus lipid used for the formation of the IMV envelope (Sodeik et al., 1993Down ; Risco et al., 2002Down ). If this is true, data presented here indicate that non-VV proteins are excluded from these membranes during VV morphogenesis. In contrast to IMV, EEV preparations contained several cell antigens: the MHV M protein and the influenza virus HA, which are located in the TGN and plasma membrane, respectively, were associated with EEV, whereas proteins located in the IC and cis/medial-Golgi were not present in EEV samples. These data are consistent with those shown in Fig. 2Up.

Incorporation of cellular proteins using a VV mutant K2X2-B5R in which the B5R protein is redirected to the ER
The VV B5R protein is a 42 kDa glycoprotein with a type I membrane topology that is present in the IEV, CEV and EEV envelope. It contains four domains related to the short consensus repeat (SCR) typical of complement control proteins and is required for the wrapping of IMV to form IEV. The transmembrane domain and cytoplasmic tail of B5R are sufficient to direct the B5R protein fused to the HIV gp120 protein (Katz et al., 1997Down ) or the enhanced green fluorescent protein (Ward & Moss, 2000Down ; Hollinshead et al., 2001Down ; Rodger & Smith, 2002Down ) to the membranes used to wrap IMV particles to form IEV. Although the cytoplasmic tail is non-essential (Lorenzo et al., 1999Down ), it affects the rate of B5R transport to the cell surface (Mathew et al., 2001Down ). The B5R protein was re-directed to the ER by addition of the ER retrieval signal K2X2 to the C terminus (Mathew et al., 1999Down ), but despite the relocation of B5R, IEV particles were formed that contained the usual virus proteins.

The K2X2-B5R virus was used to assess whether there were differences in the incorporation of cellular proteins when the B5R protein was re-directed to the ER. IMV and EEV were purified and analysed as before (Fig. 4Down). Despite the relocation of the B5R protein to the ER, the incorporation of cellular proteins into EEV was indistinguishable from wild-type virus, and none of the proteins tested were present in IMV.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4. Immunoblot analysis of VV IMV and EEV preparations. IMV and EEV were purified from HeLa cells infected with VV strain WR or with mutant VVs B5R-K2X2 or B5R-K2X4. Samples were prepared and analysed as described in Fig. 1Up using the indicated Abs.

 
Immunoelectron microscopy
The presence of proteins in EEV preparations that had been purified by sucrose density gradient centrifugation does not prove that the protein is part of the EEV envelope. This was illustrated with the VV A36R and F12L proteins. Originally, A36R was found associated with EEV (Parkinson & Smith, 1994Down ), but subsequent immunoelectron microscopy showed this protein was on IEV but not CEV and EEV (van Eijl et al., 2000Down ). Similarly, the F12L protein is present in EEV preparations but immunoelectron microscopy showed that it is on IEV but not CEV/EEV particles (Zhang et al., 2000Down ; van Eijl et al., 2002Down ). Therefore, the presence of virus and cellular proteins in EEV and CEV was investigated by immunoelectron microscopy.

The VV HA is absent from one-third of IEV and EEV particles
Two different VVs that yielded greater amounts of EEV than strain WR were used. These were the IHD-J strain and a mutant of VV strain WR called vSCR1-3, which has SCR domain 4 of B5R deleted (Mathew et al., 1998Down ). Cryo-sections of these preparations were stained with antibodies against A33R, A34R, A36R, A56R, B5R and F13L. Staining of each virus preparation gave indistinguishable data. Fig. 5Down shows that the proteins encoded by VV genes A33R, A34R, A56R, F13L and B5R are present in the EEV envelope, whereas A36R is not. For the A56R protein, it was noted that whereas some EEV particles stained well with the {alpha}-A56R mAb and showed many gold particles per virion, others did not (Fig. 5dDown). Therefore, this was investigated quantitatively. By cryo-immunoelectron microscopy 33·2% of EEV particles (n=196) were negative for gold particles. Similarly, analysis of pre-embedded sections of VV strain WR-infected HeLa cells showed that 34·6% (n=107) of CEV particles were negative for HA. In contrast, F13L and B5R proteins were present on all EEV particles. This result raises the question of whether the A56R protein is a true EEV protein, and in this regard it is notable that this protein is present predominantly on the surface of cells infected with VV or Semliki Forest virus expressing A56R (Lorenzo et al., 2000Down ), rather than in the intracellular wrapping membranes.



View larger version (123K):
[in this window]
[in a new window]
 
Fig. 5. Immunoelectron microscopy. EEV was purified from the supernatant of VV strain IHD-J- or vSCR1-3-infected cells and processed for cryo-immunoelectron microscopy as described in Methods. EEV samples were stained with antibodies for the A33R, A34R, A36R, A56R, B5R and F13L proteins followed by appropriate secondary antibodies and protein A conjugated to 9 nm gold particles. Scale bars, 200 nm.

 
Incorporation of CD29, CD46, CD59 and CD71
The incorporation of cell proteins into EEV particles was investigated in a similar way. IHD-J and vSCR1-3 EEV cryo-preparations were stained with {alpha}-CD29, {alpha}-CD71, {alpha}-CD46 and {alpha}-CD59 (Fig. 6Down). For CD46 and CD59 staining of some EEV particles was detected and this often had a capped appearance (Fig. 6cDown, eDown) as reported previously (Vanderplasschen et al., 1998Down ). However, for CD29 and CD71 fewer gold particles were seen on EEV and many virions were negative (Fig. 6aDown, gDown). This was investigated further by cutting thin sections of pre-embedded, labelled HeLa cells that had been infected with VV strain WR for 12 h (Fig. 6bDown, dDown, fDown, hDown). A virion not stained by gold particles indicates only that the technique did not detect the antigen in that thin section, rather than throughout the virion. This analysis gave similar data with only low levels of staining for {alpha}-CD29 and {alpha}-CD71; however, in this case the level of staining of EEV could be compared with the plasma membrane. This comparison showed that for CD29 the number of gold particles per µm of membrane was 2·8 for EEV membrane and 9·4 for plasma membrane. Table 1Down summarizes an extensive electron microscopy study for CD29, CD46, CD59 and CD71 and the proportion of CEV particles associated with gold particles compared to the proportion following incubation with immunogold conjugate alone without primary antibody. A statistical analysis indicated that the staining of CD29, CD46 and CD59 was significantly above control (P<0·05, Student’s t-test) for CEV, and staining for CD46 and CD71 was significantly greater than control for IEV. Overall, the low level of staining indicates these host proteins were present at only low levels in IEV and CEV/EEV particles.



View larger version (103K):
[in this window]
[in a new window]
 
Fig. 6. Immunoelectron microscopy. (a, c, e and g) Cryo-immunoelectron microscopy. EEV was purified from the supernatant of VV strain IHD-J- or vSCR1-3-infected cells and processed for cryo-immunoelectron microscopy as described in Methods. EEV samples were stained with antibodies for CD29, CD46, CD59 and CD71 followed by appropriate secondary antibodies and protein A conjugated to 9 nm gold particles. (b, d, f and h) Pre-embedding labelling. HeLa cells were infected with VV strain WR at 10 p.f.u. per cell and were stained with the antibodies followed by secondary antibodies and protein A conjugated to 9 nm gold particles as in (a, c, e, g). Subsequently, the samples were processed for electron microscopy as described in Methods. Scale bars: (a, c, e, g), 200 nm; (b, d, f, h), 100 nm.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Labelling of IEV and CEV particles with specific antibodies

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The incorporation of foreign proteins into the IMV and EEV forms of VV has been investigated. Antigens analysed were from specific membrane compartments. These were either cellular or were of viral origin and were expressed by recombinant VVs. No foreign proteins were found incorporated into IMV particles, even though some of these proteins were from membrane compartments allegedly utilized during formation of the IMV envelope, and even if the proteins were overexpressed from VV. This indicates that during the morphogenesis of IMV, there is likely to be a mechanism to exclude foreign proteins from membrane compartments used to form the IMV envelope.

For EEV, the situation was more complex. Immunoblotting showed that proteins were associated with EEV if they derived from membrane compartments that were from the TGN or further downstream in the exocytic pathway. In contrast, proteins were not associated with EEV if they were derived from ER, IC or cis/medial-Golgi. Although proteins associated with EEV were detected easily by immunoblotting, immunoelectron microscopy found only low levels of proteins associated specifically with the EEV membrane, and in some cases the density of these proteins per unit length of membrane was lower than that present on the plasma membrane. Possible interpretations are (i) that the cellular proteins are predominantly associated with membrane fragments that co-purify with the EEV particles on sucrose density gradients, (ii) that the levels in EEV are low because by the time the majority of virus particles is being released from the infected cell, the synthesis of host protein has been inhibited for several hours and the levels of these proteins have been reduced, (iii) the combination of low levels of protein and the antibodies (Abs) used was insufficient to detect these proteins efficiently by immunogold electron microscopy, or (iv) cell antigens are excluded from EEV because of the density of virus proteins in these membranes.

It is hard to distinguish between these possibilities, but it is known that the presence of proteins not considered strict EEV antigens varies with the strain of virus used. For example, using the IHD-J strain of VV, little of the IEV-specific A36R protein or cell actin was found associated with the EEV preparations, whereas with VV strain WR greater amounts of these proteins were detected in EEV (van Eijl et al., 2000Down ). This observation might be explained by the differing amounts of EEV and CEV made by these VV strains. With the WR strain, more CEV remains bound to the cell surface and as these CEV particles are driven away from the cell by polymerization of actin tails, the CEV particle might eventually be torn away from the tip of an extended microvillus while still associated with fragments of cell membrane. In contrast, the IHD-J strain releases more EEV due to a mutation in the C-type lectin domain of A34R (Blasco et al., 1993Down ). It is possible that the enhanced release of EEV by IHD-J is associated with lower levels of contaminating fragments of cellular membranes. In accord with this idea, electron microscopy of EEV preparations from WR and IHD-J showed greater levels of membrane contamination with WR (data not shown).

As well as being influenced by the strain of virus, the pattern of cell proteins that are associated with an EEV preparation is influenced by the cell type (Payne, 1978Down ). This observation might also be explained by the ease of release of EEV because cell lines differ in the amount of released EEV (Payne, 1978Down ).

The failure to detect the proteins from the ER, IC and cis/medial-Golgi with EEV preparations indicates that either these membranes are not used to form either IMV or wrap IMV to form IEV, or that there are mechanisms to exclude non-viral proteins from the lipid envelope during morphogenesis.

The possibility that VV proteins present in the IEV or EEV envelope affected the incorporation of cellular proteins into VV particles was addressed using a collection of VV mutants lacking individual proteins. Specific interactions between different IEV proteins have been noted (Röttger et al., 1999Down ), but data addressing interactions of VV and cellular proteins were not available. It was found that loss of the A33R, A34R, A35R, A56R and B5R proteins did not affect the association of cellular proteins with EEV. Therefore, if these VV proteins have interactions with host proteins, the recruitment of cellular proteins is not dependent upon any single virus protein. Finally, a virus mutant with the B5R protein redirected to the ER by the attachment of the ER retrieval sequence to its C terminus was studied. In this case too the incorporation of cellular proteins with EEV was not altered. Notably, IMV particles were still wrapped by membranes to form IEV and the membrane used seemed not to be altered because protein markers of the ER were not included.

The functional significance of cell antigens in EEV remains to be determined. The only property investigated so far is the resistance to complement (Vanderplasschen et al., 1998Down ), whereas with other viruses, such as HIV, cellular proteins have been shown to affect virus neutralization by Ab and the virus infectivity (Arthur et al., 1992Down ; Fortin et al., 1997Down ).

The incorporation of both GalTrans and CD71 (transferrin receptor) into EEV might seem surprising because these proteins label either the TGN or early endosomes, respectively. However, this observation is consistent with reports that show, on the one hand, that TGN membranes are used to wrap IMV particles (Schmelz et al., 1994Down ) and, on the other hand, that the wrapping membranes contain fluid phase markers (Tooze et al., 1993Down ; van Eijl et al., 2002Down ). It is well established that a pathway from either the early or late endosomes to the TGN exists (Duncan & Kornfeld, 1988Down ; Goda & Pfeffer, 1988Down ; Neefjes et al., 1988Down ) and it was shown that this pathway is upregulated in VV-infected cells (Tooze et al., 1993Down ; Schmelz et al., 1994Down ). This would explain the incorporation of both cell surface markers into the EEV membrane. It is possible that either the TGN or early endosomes may be used as the wrapping membrane for IEV.

Finally, the presence of VV proteins in EEV was investigated. We confirm that the A36R protein is not a component of EEV; previously, this was indicated by confocal microscopy of EEV and immunoelectron microscopy of CEV (van Eijl et al., 2000Down , 2002Down ). In addition, it is shown that the A56R protein was absent in one-third of EEV particles, raising the possibility that A56R is not a true EEV protein. A possible explanation for the presence of A56R in some but not all EEV particles is that the protein does not accumulate in the intracellular wrapping membranes (Schmelz et al., 1994Down ; Lorenzo et al., 2000Down ) and so its incorporation into IEV and thereby CEV/EEV is dependent upon sufficient A56R protein trafficking through these intracellular membranes at the time wrapping takes place.


   Acknowledgments
 
This work was supported by grant TMR ERB FMRXCT980225 from the European Community. We thank R. Elliott for the plasmids for Bunyamwera virus G1 and G2 genes and the Bunyamwera polyclonal antiserum, H.-P. Hauri for antibodies to p53, p63 and giantin, H. Stenmark for the anti-EEA-1 antiserum, E. Berger for the antibody to GalTrans, P. Rottier for the recombinant VV vvMHV and vvIBV, D. Cavanagh for the antiserum to IBV and Mansun Law for critical reading of the manuscript. G.L.S. is a Wellcome Trust Principal Research Fellow.


   Footnotes
 
a Present address: Dorfstrasse 28, 64720 Michelstadt, Germany. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Arthur, L. O., Bess, J. W.Jr, Sowder, R. C.II, Benveniste, R. E., Mann, D. L., Chermann, J. C. & Henderson, L. E. (1992). Cellular proteins bound to immunodeficiency viruses: implications for pathogenesis and vaccines. Science 258, 1935-1938.[Abstract/Free Full Text]

Blasco, R. & Moss, B. (1991). Extracellular vaccinia virus formation and cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37,000-Dalton outer envelope protein. Journal of Virology 65, 5910-5920.[Abstract/Free Full Text]

Blasco, R. & Moss, B. (1992). Role of cell-associated enveloped vaccinia virus in cell-to-cell spread. Journal of Virology 66, 4170-4179.[Abstract/Free Full Text]

Blasco, R., Sisler, J. R. & Moss, B. (1993). Dissociation of progeny vaccinia virus from the cell membrane is regulated by a viral envelope glycoprotein: effect of a point mutation in the lectin homology domain of the A34R gene. Journal of Virology 67, 3319-3325.[Abstract/Free Full Text]

Chakrabarti, S., Brechling, K. & Moss, B. (1985). Vaccinia virus expression vector: coexpression of {beta}-galactosidase provides visual screening of recombinant virus plaques. Molecular and Cellular Biology 5, 3403-3409.[Abstract/Free Full Text]

Dales, S. & Siminovitch, L. (1961). The development of vaccinia virus in Earles L strain cells as examined by electron microscopy. Journal of Biophysical and Biochemical Cytology 10, 475-503.

Dales, S. & Mosbach, E. H. (1968). Vaccinia as a model for membrane biogenesis. Virology 35, 564-583.[Medline]

Doms, R. W., Blumenthal, R. & Moss, B. (1990). Fusion of intra- and extracellular forms of vaccinia virus with the cell membrane. Journal of Virology 64, 4884-4892.[Abstract/Free Full Text]

Duncan, J. R. & Kornfeld, S. (1988). Intracellular movement of two mannose 6-phosphate receptors: return to the Golgi apparatus. Journal of Cell Biology 106, 617-628.[Abstract/Free Full Text]

Duncan, S. A. & Smith, G. L. (1992). Identification and characterization of an extracellular envelope glycoprotein affecting vaccinia virus egress. Journal of Virology 66, 1610-1621.[Abstract/Free Full Text]

Engelstad, M. & Smith, G. L. (1993). The vaccinia virus 42-kDa envelope protein is required for the envelopment and egress of extracellular virus and for virus virulence. Virology 194, 627-637.[Medline]

Engelstad, M., Howard, S. T. & Smith, G. L. (1992). A constitutively expressed vaccinia gene encodes a 42-kDa glycoprotein related to complement control factors that forms part of the extracellular virus envelope. Virology 188, 801-810.[Medline]

Essani, K. & Dales, S. (1979). Biogenesis of vaccinia: evidence for more than 100 polypeptides in the virion. Virology 95, 385-394.[Medline]

Fenner, F., Anderson, D. A., Arita, I., Jezek, Z. & Ladnyi, I. D. (1988). Smallpox and Its Eradication. Geneva: World Health Organization.

Fortin, J. F., Cantin, R., Lamontagne, G. & Tremblay, M. (1997). Host-derived ICAM-1 glycoproteins incorporated on human immunodeficiency virus type 1 are biologically active and enhance viral infectivity. Journal of Virology 71, 3588-3596.[Abstract]

Frischknecht, F., Moreau, V., Röttger, S., Gonfloni, S., Rechmann, I., Superti-Furga, G. & Way, M. (1999). Actin-based motility of vaccinia virus mimics receptor tyrosine kinase signalling. Nature 401, 926-929.[Medline]

Geada, M. M., Galindo, I., Lorenzo, M. M., Perdiguero, B. & Blasco, R. (2001). Movements of vaccinia virus intracellular enveloped virions with GFP tagged to the F13L envelope protein. Journal of General Virology 82, 2747-2760.[Abstract/Free Full Text]

Goda, Y. & Pfeffer, S. R. (1988). Selective recycling of the mannose 6-phosphate/IGF-II receptor to the trans Golgi network in vitro. Cell 55, 309-320.[Medline]

Griffiths, G., Roos, N., Schleich, S. & Locker, J. K. (2001). Structure and assembly of intracellular mature vaccinia virus: thin-section analyses. Journal of Virology 75, 11056-11070.[Abstract/Free Full Text]

Hiller, G. & Weber, K. (1985). Golgi-derived membranes that contain an acylated viral polypeptide are used for vaccinia virus envelopment. Journal of Virology 55, 651-659.[Abstract/Free Full Text]

Hirt, P., Hiller, G. & Wittek, R. (1986). Localization and fine structure of a vaccinia virus gene encoding an envelope antigen. Journal of Virology 58, 757-764.[Abstract/Free Full Text]

Hollinshead, M., Vanderplasschen, A., Smith, G. L. & Vaux, D. J. (1999). Vaccinia virus intracellular mature virions contain only one lipid membrane. Journal of Virology 73, 1503-1517.[Abstract/Free Full Text]

Hollinshead, M., Rodger, G., van Eijl, H., Law, M., Hollinshead, R., Vaux, D. T. & Smith, G. L. (2001). Vaccinia virus utilizes microtubules for movement to the cell surface. Journal of Cell Biology 154, 389-402.[Abstract/Free Full Text]

Ichihashi, Y. & Dales, S. (1971). Biogenesis of poxviruses: interrelationship between hemagglutinin production and polykaryocytosis. Virology 46, 533-543.[Medline]

Ichihashi, Y., Matsumoto, S. & Dales, S. (1971). Biogenesis of poxviruses: role of A-type inclusions and host cell membranes in virus dissemination. Virology 46, 507-532.[Medline]

Isaacs, S. N., Wolffe, E. J., Payne, L. G. & Moss, B. (1992). Characterization of a vaccinia virus-encoded 42-kilodalton class I membrane glycoprotein component of the extracellular virus envelope. Journal of Virology 66, 7217-7224.[Abstract/Free Full Text]

Katz, E., Wolffe, E. J. & Moss, B. (1997). The cytoplasmic and transmembrane domains of the vaccinia virus B5R protein target a chimeric human immunodeficiency virus type 1 glycoprotein to the outer envelope of nascent vaccinia virions. Journal of Virology 71, 3178-3187.[Abstract]

Klumperman, J., Locker, J. K., Meijer, A., Horzinek, M. C., Geuze, H. J. & Rottier, P. J. (1994). Coronavirus M proteins accumulate in the Golgi complex beyond the site of virion budding. Journal of Virology 68, 6523-6534.[Abstract/Free Full Text]

Lappin, D. F., Nakitare, G. W., Palfreyman, J. W. & Elliott, R. M. (1994). Localization of Bunyamwera bunyavirus G1 glycoprotein to the Golgi requires association with G2 but not with NSm. Journal of General Virology 75, 3441-3451.[Abstract/Free Full Text]

Law, M., Hollinshead, R. & Smith, G. L. (2002). Antibody-sensitive and antibody-resistant cell-to-cell spread by vaccinia virus: role of the A33R protein in antibody-resistant spread. Journal of General Virology 83, 209-222.[Abstract/Free Full Text]

Linstedt, A. D. & Hauri, H. P. (1993). Giantin, a novel conserved Golgi membrane protein containing a cytoplasmic domain of at least 350 kDa. Molecular Biology of the Cell 4, 679-693.[Abstract]

Lorenzo, M. M., Herrera, E., Blasco, R. & Isaacs, S. N. (1999). Functional analysis of vaccinia virus B5R protein: role of the cytoplasmic tail. Virology 252, 450-457.

Lorenzo, M. M., Galindo, I., Griffiths, G. & Blasco, R. (2000). Intracellular localization of vaccinia virus extracellular enveloped virus envelope proteins individually expressed using a Semliki Forest virus replicon. Journal of Virology 74, 10535-10550.[Abstract/Free Full Text]

McIntosh, A. A. & Smith, G. L. (1996). Vaccinia virus glycoprotein A34R is required for infectivity of extracellular enveloped virus. Journal of Virology 70, 272-281.[Abstract]

Mathew, E., Sanderson, C. M., Hollinshead, M. & Smith, G. L. (1998). The extracellular domain of vaccinia virus protein B5R affects plaque phenotype, extracellular enveloped virus release, and intracellular actin tail formation. Journal of Virology 72, 2429-2438.[Abstract/Free Full Text]

Mathew, E., Sanderson, C. M., Hollinshead, R., Hollinshead, M., Grimley, R. & Smith, G. L. (1999). The effects of targeting the vaccinia virus B5R protein to the endoplasmic reticulum on virus morphogenesis and dissemination. Virology 265, 131-146.[Medline]

Mathew, E. C., Sanderson, C. M., Hollinshead, R. & Smith, G. L. (2001). A mutational analysis of the vaccinia virus B5R protein. Journal of General Virology 82, 1199-1213.[Abstract/Free Full Text]

Mockett, A. P., Cavanagh, D. & Brown, T. D. (1984). Monoclonal antibodies to the S1 spike and membrane proteins of avian infectious bronchitis coronavirus strain Massachusetts M41. Journal of General Virology 65, 2281-2286.[Abstract/Free Full Text]

Moss, B. (2001). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2849-2883. Edited by D. M. Knipe & P. M. Howley. Philadelphia:Lippincott Williams & Wilkins.

Mu, F. T., Callaghan, J. M., Steele-Mortimer, O., Stenmark, H., Parton, R. G., Campbell, P. L., McCluskey, J., Yeo, J. P., Tock, E. P. & Toh, B. H. (1995). EEA1, an early endosome-associated protein. EEA1 is a conserved alpha-helical peripheral membrane protein flanked by cysteine ‘fingers’ and contains a calmodulin-binding IQ motif. Journal of Biological Chemistry 270, 13503-13511.[Abstract/Free Full Text]

Nakitare, G. W. & Elliott, R. M. (1993). Expression of the Bunyamwera virus M genome segment and intracellular localization of NSm. Virology 195, 511-520.[Medline]

Neefjes, J. J., Verkerk, J. M., Broxterman, H. J., van der Marel, G. A., van Boom, J. H. & Ploegh, H. L. (1988). Recycling glycoproteins do not return to the cis-Golgi. Journal of Cell Biology 107, 79-87.[Abstract/Free Full Text]

Parkinson, J. E. & Smith, G. L. (1994). Vaccinia virus gene A36R encodes a Mr 43–50 K protein on the surface of extracellular enveloped virus. Virology 204, 376-390.[Medline]

Payne, L. G. (1978). Polypeptide composition of extracellular enveloped vaccinia virus. Journal of Virology 27, 28-37.[Abstract/Free Full Text]

Payne, L. G. (1979). Identification of the vaccinia hemagglutinin polypeptide from a cell system yielding large amounts of extracellular enveloped virus. Journal of Virology 31, 147-155.[Abstract/Free Full Text]

Payne, L. G. (1980). Significance of extracellular enveloped virus in the in vitro and in vivo dissemination of vaccinia virus. Journal of General Virology 50, 89-100.[Abstract/Free Full Text]

Payne, L. G. & Norrby, E. (1976). Presence of haemagglutinin in the envelope of extracellular vaccinia virus particles. Journal of General Virology 32, 63-72.[Abstract/Free Full Text]

Rietdorf, J., Ploubidou, A., Reckmann, I., Holmstrom, A., Frischknecht, F., Zettl, M., Zimmermann, T. & Way, M. (2001). Kinesin-dependent movement on microtubules precedes actin-based motility of vaccinia virus. Nature Cell Biology 3, 992-1000.[Medline]

Risco, C., Rodriguez, J. R., Lopez-Iglesias, C., Carrascosa, J. L., Esteban, M. & Rodriguez, D. (2002). Endoplasmic reticulum–Golgi intermediate compartment membranes and vimentin filaments participate in vaccinia virus assembly. Journal of Virology 76, 1839-1855.[Abstract/Free Full Text]

Rodger, G. & Smith, G. L. (2002). Replacing the SCR domains of vaccinia virus protein B5R with EGFP causes a reduction in plaque size and actin tail formation but enveloped virions are still transported to the cell surface. Journal of General Virology 83, 323-332.[Abstract/Free Full Text]

Roper, R. L., Payne, L. G. & Moss, B. (1996). Extracellular vaccinia virus envelope glycoprotein encoded by the A33R gene. Journal of Virology 70, 3753-3762.[Abstract]

Roper, R. L., Wolffe, E. J., Weisberg, A. & Moss, B. (1998). The envelope protein encoded by the A33R gene is required for formation of actin-containing microvilli and efficient cell-to-cell spread of vaccinia virus. Journal of Virology 72, 4192-4204.[Abstract/Free Full Text]

Röttger, S., Frischknecht, F., Reckmann, I., Smith, G. L. & Way, M. (1999). Interactions between vaccinia virus IEV membrane proteins and their roles in IEV assembly and actin tail formation. Journal of Virology 73, 2863-2875.[Abstract/Free Full Text]

Sanderson, C. M., Frischknecht, F., Way, M., Hollinshead, M. & Smith, G. L. (1998). Roles of vaccinia virus EEV-specific proteins in intracellular actin tail formation and low pH-induced cell–cell fusion. Journal of General Virology 79, 1415-1425.[Abstract]

Sanderson, C. M., Hollinshead, M. & Smith, G. L. (2000). The vaccinia virus A27L protein is needed for the microtubule-dependent transport of intracellular mature virus particles. Journal of General Virology 81, 47-58.[Abstract/Free Full Text]

Schmelz, M., Sodeik, B., Ericsson, M., Wolffe, E. J., Shida, H., Hiller, G. & Griffiths, G. (1994). Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans Golgi network. Journal of Virology 68, 130-147.[Abstract/Free Full Text]

Schweizer, A., Fransen, J. A., Matter, K., Kreis, T. E., Ginsel, L. & Hauri, H. P. (1990). Identification of an intermediate compartment involved in protein transport from endoplasmic reticulum to Golgi apparatus. European Journal of Cell Biology 53, 185-196.[Medline]

Schweizer, A., Ericsson, M., Bachi, T., Griffiths, G. & Hauri, H. P. (1993). Characterization of a novel 63 kDa membrane protein. Implications for the organization of the ER-to-Golgi pathway. Journal of Cell Science 104, 671-683.[Abstract]

Shida, H. (1986). Nucleotide sequence of the vaccinia virus hemagglutinin gene. Virology 150, 451-462.[Medline]

Slot, J. W. & Geuze, H. J. (1985). A new method of preparing gold probes for multiple-labeling cytochemistry. European Journal of Cell Biology 38, 87-93.[Medline]

Smith, G. L. & Vanderplasschen, A. (1998). Extracellular enveloped vaccinia virus: entry, egress and evasion. In Coronaviruses and Arteriviruses , pp. 395-414. Edited by L. Enjuanes, S. G. Siddell & W. Spaan. London:Plenum Press.

Smith, G. L., Levin, J. Z., Palese, P. & Moss, B. (1987). Synthesis and cellular location of the ten influenza polypeptides individually expressed by recombinant vaccinia viruses. Virology 160, 336-345.[Medline]

Sodeik, B., Doms, R. W., Ericsson, M., Hiller, G., Machamer, C. E., van’t Hof, W., van Meer, G., Moss, B. & Griffiths, G. (1993). Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks. Journal of Cell Biology 121, 521-541.[Abstract/Free Full Text]

Stam, N. J., Vroom, T. M., Peters, P. J., Pastoors, E. B. & Ploegh, H. L. (1990). HLA-A- and HLA-B-specific monoclonal antibodies reactive with free heavy chains in western blots, in formalin-fixed, paraffin-embedded tissue sections and in cryo-immuno-electron microscopy. International Immunology 2, 113-125.[Abstract/Free Full Text]

Tooze, J., Hollinshead, M., Reis, B., Radsak, K. & Kern, H. (1993). Progeny vaccinia and human cytomegalovirus particles utilize early endosomal cisternae for their envelopes. European Journal of Cell Biology 60, 163-178.[Medline]

Vanderplasschen, A., Hollinshead, M. & Smith, G. L. (1997). Antibodies against vaccinia virus do not neutralize extracellular enveloped virus but prevent virus release from infected cells and comet formation. Journal of General Virology 78, 2041-2048.[Abstract]

Vanderplasschen, A., Mathew, E., Hollinshead, M., Sim, R. B. & Smith, G. L. (1998). Extracellular enveloped vaccinia virus is resistant to complement because of incorporation of host complement control proteins into its envelope. Proceedings of the National Academy of Sciences, USA 95, 7544-7549.[Abstract/Free Full Text]

van Eijl, H., Hollinshead, M. & Smith, G. L. (2000). The vaccinia virus A36R protein is a type Ib membrane protein present on intracellular but not extracellular enveloped particles. Virology 271, 26-36.[Medline]

van Eijl, H., Hollinshead, M., Rodger, G., Zhang, W.-H. & Smith, G. L. (2002). The vaccinia virus F12L is associated with intracellular enveloped virus particles and is required for their egress to the cell surface. Journal of General Virology 83, 195-207.[Abstract/Free Full Text]

Ward, B. M. & Moss, B. (2000). Golgi network targeting and plasma membrane internalization signals in vaccinia virus B5R envelope protein. Journal of Virology 74, 3771-3780.[Abstract/Free Full Text]

Ward, B. M. & Moss, B. (2001). Visualization of intracellular movement of vaccinia virus virions containing a green fluorescent protein-B5R membrane protein chimera. Journal of Virology 75, 4802-4813.[Abstract/Free Full Text]

Watret, G. E., Pringle, C. R. & Elliott, R. M. (1985). Synthesis of bunyavirus-specific proteins in a continuous cell line (XTC-2) derived from Xenopus laevis. Journal of General Virology 66, 473-482.[Abstract/Free Full Text]

Watzele, G., Bachofner, R. & Berger, E. G. (1991). Immunocytochemical localization of the Golgi apparatus using protein-specific antibodies to galactosyltransferase. European Journal of Cell Biology 56, 451-458.[Medline]

White, S., Miller, K., Hopkins, C. & Trowbridge, I. S. (1992). Monoclonal antibodies against defined epitopes of the human transferrin receptor cytoplasmic tail. Biochimica et Biophysica Acta 1136, 28-34.[Medline]

Wolffe, E. J., Isaacs, S. N. & Moss, B. (1993). Deletion of the vaccinia virus B5R gene encoding a 42-kiloDalton membrane glycoprotein inhibits extracellular virus envelope formation and dissemination. Journal of Virology 67, 4732-4741.[Abstract/Free Full Text]

Wolffe, E. J., Weisberg, A. S. & Moss, B. (1998). Role for the vaccinia virus A36R outer envelope protein in the formation of virus-tipped actin-containing microvilli and cell-to-cell virus spread. Virology 244, 20-26.[Medline]

Zhang, W.-H., Wilcock, D. & Smith, G. L. (2000). The vaccinia virus F12L protein is required for actin tail formation, normal plaque size and virulence. Journal of Virology 74, 11654-11662.[Abstract/Free Full Text]

Received 5 April 2002; accepted 20 May 2002.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
J. L. Tan, N. Ueda, A. A. Mercer, and S. B. Fleming
Investigation of orf virus structure and morphogenesis using recombinants expressing FLAG-tagged envelope structural proteins: evidence for wrapped virus particles and egress from infected cells
J. Gen. Virol., March 1, 2009; 90(3): 614 - 625.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
A. D. Garcia, C. A. Meseda, A. E. Mayer, A. Kumar, M. Merchlinsky, and J. P. Weir
Characterization and Use of Mammalian-Expressed Vaccinia Virus Extracellular Membrane Proteins for Quantification of the Humoral Immune Response to Smallpox Vaccines
Clin. Vaccine Immunol., August 1, 2007; 14(8): 1032 - 1044.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Alzhanova and D. E. Hruby
A trans-Golgi Network Resident Protein, golgin-97, Accumulates in Viral Factories and Incorporates into Virions during Poxvirus Infection
J. Virol., December 1, 2006; 80(23): 11520 - 11527.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Perdiguero and R. Blasco
Interaction between Vaccinia Virus Extracellular Virus Envelope A33 and B5 Glycoproteins.
J. Virol., September 1, 2006; 80(17): 8763 - 8777.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Najarro, C. Gubser, M. Hollinshead, J. Fox, J. Pease, and G. L. Smith
Yaba-like disease virus chemokine receptor 7L, a CCR8 orthologue.
J. Gen. Virol., April 1, 2006; 87(Pt 4): 809 - 816.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
K. Kolegraff, P. Bostik, and A. A. Ansari
Characterization and role of lentivirus-associated host proteins.
Experimental Biology and Medicine, March 1, 2006; 231(3): 252 - 263.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Cantin, S. Methot, and M. J. Tremblay
Plunder and Stowaways: Incorporation of Cellular Proteins by Enveloped Viruses
J. Virol., June 1, 2005; 79(11): 6577 - 6587.
[Full Text] [PDF]


Home page
J. Virol.Home page
M. Husain and B. Moss
Evidence against an Essential Role of COPII-Mediated Cargo Transport to the Endoplasmic Reticulum-Golgi Intermediate Compartment in the Formation of the Primary Membrane of Vaccinia Virus
J. Virol., November 1, 2003; 77(21): 11754 - 11766.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
G. C. Carter, G. Rodger, B. J. Murphy, M. Law, O. Krauss, M. Hollinshead, and G. L. Smith
Vaccinia virus cores are transported on microtubules
J. Gen. Virol., September 1, 2003; 84(9): 2443 - 2458.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
G. L. Smith, A. Vanderplasschen, and M. Law
The formation and function of extracellular enveloped vaccinia virus
J. Gen. Virol., December 1, 2002; 83(12): 2915 - 2931.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krauss, O.
Right arrow Articles by Smith, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krauss, O.
Right arrow Articles by Smith, G. L.
Agricola
Right arrow Articles by Krauss, O.
Right arrow Articles by Smith, G. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS