|
|
||||||||
Animal: DNA Viruses |
1
1
Veterinary Medical Research Institute, Hungarian Academy of Sciences, PO Box 18, H-1581 Budapest, Hungary1
Central Veterinary Institute, PO Box 2, H-1581 Budapest, Hungary2
Institute for Zoology, Fish Biology, Fish Diseases, University of München, Germany3
Author for correspondence: Szilvia Farkas. Fax +36 1 467 4076. e-mail szlfarkas{at}freemail.hu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
, 1999
Adenovirus infections have been detected by examination by light and electron microscopy of histopathological sections in different species of Reptilia, including Nile crocodile (Crocodylus niloticus) (Jacobson et al., 1984
), savannah monitor (Varanus exanthematicus) (Jacobson & Kollias, 1986
), Jacksons chameleon (Chamaeleo jacksoni) (Jacobson & Gardiner, 1990
), Rankins dragon lizard (Pogona henrylawsoni) (Frye et al., 1994
), rosy boa (Lichanura trivirgata) (Schumacher et al., 1994
), bearded dragon (Pogona vitticeps) (Jacobson et al., 1996
) and mountain chameleon (Chameleo montium) (Kinsel et al., 1997
). Recently, the presence of adenoviral DNA in liver sections from a boa constrictor (Boa constrictor) and intestinal tract samples from a Mojave rattlesnake (Crotalus scutulatus scutulatus) was confirmed by in situ hybridization (Ramis et al., 2000
; Perkins et al., 2001
). The sequence of the oligonucleotides used as labelled probes was taken from the penton gene of fowl adenovirus type 10 (Sheppard & Trist, 1992
).
In spite of the seemingly growing incidence and interest in the diagnosis of diseases attributed to adenovirus infection in reptiles, there are very few cases in which the virus was successfully isolated. Jacobson et al. (1985)
obtained adenovirus from a boa constrictor (Boa constrictor) and W. Ahne and his co-workers isolated an adenovirus strain from a royal python (Python regius) (Ogawa et al., 1992
) and from a moribund corn snake (Elaphe guttata) showing clinical signs of pneumonia (Juhasz & Ahne, 1992
). The physico-chemical properties and cytopathogenicity of this latter virus were also determined (Juhasz & Ahne, 1992
). The purpose of our study was to obtain genomic sequence data from the corn snake adenovirus (SnAdV-1) in order to characterize its genome and to determine the phylogenetic relationship between SnAdV-1 and other adenoviruses.
| Methods |
|---|
|
|
|---|
Virus purification and cloning.
DNA sequencing.
The clones were purified with the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced by following the PRISM Ready Reaction Dye Deoxy Cycle sequencing protocol (Perkin Elmer) on an ABI 373A automated DNA sequencer (Applied Biosystems) using T3, T7, M13-20 and M13 Reverse primers. The sequences were read with the Applied Biosystems 373A DNA Sequencer Data Analysis Program and were processed by the program LASERGENE (DNASTAR). The genes encoded by the sequences were identified by the BLAST homology search program (Altschul et al., 1990
) and compared with the non-redundant NCBI database or our own database of adenovirus sequences (http://www.vmri.hu/blast.htm).
PCR.
PCR amplification of the missing parts of genome sequence between previously sequenced and identified fragments was attempted with primers designed on the basis of known sequences and checked with the program PRIMER DESIGNER version 2.0 (Scientific and Educational Software). Two primers that gave a successful amplification between two PstI clones were 23 nucleotides (nt) long and had the following sequences: forward, 5 GAGAGTAGTAGCTCCACCTGAAG 3; reverse, 5 ATGATGAGCCGGAGACGGAGCCT 3. The PCR product was cut with PstI enzyme and also cloned into the pBluescript II KS phagemid.
Phylogenetic analyses.
For phylogenetic analyses, the hexon and protease genes were chosen. Multiple alignments of 39 hexon and 33 protease amino acid (aa) sequences were carried out with the MULTALIN computer program (Corpet, 1988
). Since only homologous residues can be used in phylogenetic calculations (Harrach & Benk
, 1998
), the highly variable regions were removed from both genes leaving 781 and 202 aa in the hexon and protease alignments respectively. Phylogenetic trees were constructed with the programs included in the PHYLIP (Phylogeny Inference Package, version 3.572c) program package (Felsenstein, 1989
). For distance matrix analysis, the aligned sequences were processed first with PROTDIST (Dayhoffs PAM 001 scoring matrix) and then with the FITCH program (global rearrangements). For bootstrap analysis, the SEQBOOT program was run before PROTDIST and FITCH. The most probable tree was calculated with the CONSENSE program. The trees were visualized by the TREEVIEW program (Page, 1996
).
| Results and Discussion |
|---|
|
|
|---|
|
, unpublished results). Although the function or exact location of the processed p32K in the virion is not yet known, its hypothetical DNA-binding and/or packaging function is supported by several facts. Firstly, from looking at conserved amino acid patterns, a degree of homology could be detected between the C terminus of p32K proteins and the so-called small acid-soluble proteins (SASPs) of certain bacteria (Péter Él
, unpublished results). SASPs play an important role in spore formation in certain bacteria. Secondly, as discussed below, no homologues of protein V exist in atadenoviruses; thus, the essential role of protein V in stabilizing the viral DNA in the capsid and in trafficking it after uncoating to the nucleus should be fulfilled by another protein. The p32K protein is a likely candidate for such a function, since a bipartite nuclear localization signal typical of certain adenoviral core proteins (Dingwall & Laskey, 1991The sequence of a 5922 bp genome fragment encompassing the complete genes of pVII, pX, pVI, hexon, protease and DBP was fully determined, deposited in GenBank and analysed in detail. The putative hexon and protease genes of SnAdV-1 consisted of 2730 and 606 nt encoding 909 and 201 aa residues respectively. The presence of the gene for structural protein V was excluded based on the results of sequence analysis and homology searches. The protein V gene is normally located between the genes for pVII and pX, but in SnAdV-1 the distance between the stop codon of pVII and the first methionine of pX was only 19 nt. In mastadenoviruses, protein IX is encoded by the r (rightward-transcribed) strand immediately after the E1B region, but no homologous gene could be identified in SnAdV-1 (data not shown). Apparently, the presence of these genes (of proteins V and IX) is exclusively characteristic of members of the genus Mastadenovirus.
In mastadenoviruses, the E3 region is located between the genes for the pVIII and fibre proteins. In our SnAdV-1 sequence, similarly to atadenoviruses (Vrati et al., 1995
), no homologues of any E3 genes could be identified at this location or in any ORF on the r strand. However, on the complementary l strand, the presence of the U exon was confirmed based on its homology with the corresponding region of OAV287 and DAdV-1. The role of the U exon, which was originally described in human adenovirus 40 (HAdV-40) (Davison et al., 1993
), is unknown, but it has been found in almost all adenovirus types examined so far. The sequence of the U exon seems to be well conserved in each genus, but shows large differences between the genera (Davison et al., 2000
).
Phylogenetic analysis
For phylogenetic analyses, the hexon and protease genes were chosen, because the sequences of these genes were available for many adenovirus types from a large number of different hosts. The results of the distance matrix analysis on the amino acid sequences of these two genes are presented in Fig. 2
(a
, b
). Four clearly separated groups could be distinguished on both trees. This result was supported by maximal (100%) bootstrap values in the case of the longer, and therefore more reliable, hexon gene, while the tree for the protease gene was characterized by slightly lower (83100%) bootstrap values. Interestingly, while the two clusters corresponding to the two genera (Mastadenovirus and Aviadenovirus) consist exclusively of adenovirus types isolated from mammals or birds, respectively, the other two clusters comprise viruses from a variety of hosts. It is tempting to hypothesize that this variety resulted from several host switches of the adenoviruses.
|
In contrast the other new genus, Atadenovirus (Benk
& Harrach, 1998
), where SnAdV-1 is clustered, is already represented by numerous isolates. As well as the fully sequenced OAV287 (Vrati et al., 1996
) and DAdV-1 (Hess et al., 1997
), the adenovirus of a New Zealand marsupial animal, the brushtail possum (Trichosurus vulpecula) (Thomson et al., 2002
), also fell into this cluster. Moreover, five of the ten accepted bovine adenovirus (BAdV) types (4 to 8), the particular features of which were recognized more than 30 years ago (Bartha, 1969
), are candidate atadenoviruses (Benk
et al., 2000
). More recently, caprine adenovirus type 1, isolated in the United States (Lehmkuhl & Cutlip, 1999
), and the adenovirus which caused a fatal epizooty among mule deer (Odocoileus hemionus) in California (Woods et al., 1996
; Sorden et al., 2000
), were also confirmed as candidate atadenoviruses (Lehmkuhl et al., 2001
).
On both trees, SnAdV-1 formed the first bifurcation on the branch of atadenoviruses followed by DAdV-1. Similar tree topology was obtained with other (partial) genes (Benk
et al., 2002
), either with nucleotide or amino acid sequences (data not shown).
Intergenic distances and GC content
In the part of the SnAdV-1 genome examined, gene overlaps or short intergenic distances similar to those in the atadenoviruses were observed. For example, between the end of the hexon and the start of the protease gene, a 4 nt overlap is present in SnAdV-1. In the mastadenoviruses and aviadenoviruses examined so far there is a short distance between these two genes, while in OAV287, DAdV-1, BAdV-4 and BAdV-7 the two genes overlap by the same length (Dán et al., 1998
; Harrach et al., 1997
). The C-terminal part of the DBP coded on the l strand was also identified, and the distance between the putative stop codon of the DBP and the protease gene of SnAdV-1 was found to be 14 nt. The proteaseDBP distance is only 5, 7, 11 and 28 nt for BAdV-7, BAdV-4, DAdV-1 and OAV287, respectively, which is relatively short compared to the corresponding sequences in mastadenoviruses and aviadenoviruses.
The GC content of the SnAdV-1 hexon and protease genes was found to be 52% and 50%, respectively. The GC content for the genome sequence determined so far (more than 12 kbp) was 51·8% with an average, seemingly even distribution throughout the genome (approximately 10% variations). In contrast to SnAdV-1, the base composition of the genome of all atadenoviruses sequenced so far is heavily biased towards AT and their GC content ranges between 33·6% (OAV287) and 43·0% (DAdV-1). The reason for this difference is still unknown.
Protease cleavage sites
We have analysed in detail the sequence of the SnAdV-1 protease as well as several precursor proteins (pVII, pX, pVI) which are substrates for the protease. The active site of the adenoviral protease was first determined in HAdV-2 and found to be the H54E71C122 triad, similar to that in papain (Ding et al., 1996
). In all other adenovirus serotypes examined so far, except for HAdV-5, the glutamic acid (E) is replaced by aspartic acid (D). By amino acid alignment, a similar putative active site (H55D72C122) of the protease of SnAdV-1 was identified. Interestingly, the P137 residue, which is highly conserved in mastadenoviruses and thought to be critical for protease encapsidation and activation (Rancourt et al., 1995
), is missing in the studied aviadenoviruses (Chiocca et al., 1996
; Ojkic & Nagy, 2000
), atadenoviruses (Harrach et al., 1997
; Barbezange et al., 2000
) and in THEV (Pitcovski et al., 1998
). However, it is present in frog adenovirus 1 (FrAdV-1) (Davison et al., 2000
) and we have also found it in SnAdV-1. Another important conserved residue, C104, was also identified in the SnAdV-1 protease sequence. In HAdV-2, this residue forms a disulfide bond with C10 of the 11 aa cofactor, pVIc (cleaved by the protease from pVI), thus enhancing enzyme activity (Webster et al., 1993
).
Adenoviral protease activity is absolutely required for the synthesis of infectious virions (Weber, 1995
). Two consensus recognition sequences, (M/L/I)XGGX (type I) and (M/L/I)XGXG (type II), have been identified (Webster et al., 1989
; Anderson, 1990
) in the precursor protein substrates (pTP, pIIIa, pVII, pX, pVI and pVIII) of different human and mammalian adenoviruses. During the study of the unique genome arrangement and novel proteins of OAV287 (the first representative of atadenoviruses to be fully sequenced), a novel protease cleavage site (M/L/I)XAXG (type III) was identified (Vrati et al., 1996
). Furthermore, a potential protease cleavage site on the pVII proteins was identified by peptide sequencing at the motif NTGWG (type IIb), which is present in members of all four genera (Vrati et al., 1996
). The type I cleavage site appears in pVII of mastadenoviruses and siadenoviruses and type II in pVII of aviadenoviruses (Fig. 3
). Type III cleavage sites could be identified in all the sequenced pVII proteins of all virus types that were proposed to belong to the genus Atadenovirus. In pVII of SnAdV-1, the IRATG sequence was demonstrated (Fig. 3
).
|
In pVI of SnAdV-1, a type I (MSGGF) and a type II (MLGDG) motif were found 24 aa downstream and 15 aa upstream from the N and C termini, respectively. Protease cleavage at the second site of the SnAdV-1 pVI would generate an 11 aa peptide (GVCYRSKRYCY), which appears to be the counterpart of the HAdV-2 pVIc cofactor (Webster et al., 1993
). Considering the pVI sequence of all the known adenovirus types, the consensus sequence of the pVIc cofactor seems to be G(V/L)XXXXXXXC(F/Y).
It appears that the type of protease cleavage recognition sequence is conserved within each genus and might be considered as single, shared derived characteristic. However, a broader consensus, valid for all types of adenoviral protease cleavage sites, could be summarized in the formulae (N/M/L/I)X(A/G)XG or (M/L/I)XGGX.
Conclusions
From the analysis of the DNA sequence of the randomly cloned SnAdV-1 genome fragments, several important conclusions can be drawn concerning the genetic affiliation of this virus or, in a broader sense, perhaps even that of reptilian adenoviruses. The arrangement of the part of the genome of SnAdV-1 studied so far resembles the typical genome organization of atadenoviruses; it is characterized by gene overlaps, short intergenic distances and, most importantly, by the presence of a homologue of the gene for p32K. The results of the phylogenetic analyses performed with sequences of two major viral proteins (hexon and protease) clearly indicated that SnAdV-1 belongs to the cluster of atadenoviruses. Finally, the protease cleavage motifs conserved in the pVII, pX and pVI amino acid sequences further support SnAdV-1 as a new member of the genus Atadenovirus. It is, however, astonishing that the base composition of the SnAdV-1 DNA did not show the bias towards AT content, a feature shared by all atadenoviruses studied to date and thought to be characteristic for the genus.
The variety of host origins of the members of the genus Atadenovirus remains an intriguing question. The possible reptilian origin was suggested (and supported by this work) when the phylogenetic tree of adenoviruses was compared with that of the host animals; the branches of the two genera (Mastadenovirus and Aviadenovirus) overlapped the clusters containing mammals and birds whereas the branch containing the atadenoviruses was positioned at a distance corresponding to lower vertebrates (Harrach, 2000
). If we accept that adenoviruses might have co-evolved and co-speciated with their animal hosts, the observed variety of host origin in the two new genera might be explained by interspecies transmission, i.e. host switches of adenoviruses. The phylogenetic trees presented in Fig. 2(a
, b
) do not contradict this theory. We presume that some reptilian adenoviruses changed host three times, to birds (DAdV-1), to marsupials (the brushtail possum) and to ruminants. The seemingly elevated pathogenicity of these viruses, causing egg drop syndrome (McFerran & Smyth, 2000
) or haemorrhagic disease (Woods et al., 1996
) in the new hosts (insufficient time for adaptation and attenuation), also seems to support our speculation. Further evidence, including DNA sequence data from other adenovirus strains from additional species of reptiles, is needed to confirm the reptilian origin of atadenoviruses.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Anderson, C. W. (1990). The proteinase polypeptide of adenovirus serotype 2 virions. Virology 177, 259-272.[Medline]
Barbezange, C., Benk
, M., Dán, Á. & Harrach, B. (2000). DNA sequencing and phylogenetic analysis of the protease gene of ovine adenovirus 3 suggest that adenoviruses of sheep belong to two different genera. Virus Research 66, 79-80.[Medline]
Bartha, A. (1969). Proposal for subgrouping of bovine adenoviruses. Acta Veterinaria Academiae Scientiarum Hungaricae 19, 319-321.[Medline]
Benk
, M. & Harrach, B. (1998). A proposal for establishing a new (third) genus within the Adenoviridae family. Archives of Virology 143, 829-837.[Medline]
Benk
, M., Harrach, B. & Russell, W. C. (2000). Family Adenoviridae. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 227-238. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.
Benk
, M., Él
, P., Ursu, K., Ahne, W., LaPatra, S. E., Thomson, D. & Harrach, B. (2002). First molecular evidence for the existence of distinct fish and snake adenoviruses. Journal of Virology (in press).
Both, G. W. (2002). Atadenovirus. In The Springer Index of Viruses , pp. 2-8. Edited by C. A. Tidona & G. Darai. Berlin:Springer-Verlag.
Boyle, D. B., Pye, A. D., Kocherhans, R., Adair, B. M., Vrati, S. & Both, G. W. (1994). Characterization of Australian ovine adenovirus isolates. Veterinary Microbiology 41, 281-291.[Medline]
Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V. & Cotton, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. Journal of Virology 70, 2939-2949.[Abstract]
Clark, H. F., Michalski, F., Tweedell, K. S., Yohn, D. & Zeigel, R. F. (1973). An adenovirus, FAV-1, isolated from the kidney of a frog (Rana pipiens). Virology 51, 392-400.[Medline]
Corpet, F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16, 10881-10890.
Dán, Á., Ruzsics, Zs., Russell, W. C., Benk
, M. & Harrach, B. (1998). Analysis of the hexon gene sequence of bovine adenovirus type 4 provides further support for a new adenovirus genus (Atadenovirus). Journal of General Virology 79, 1453-1460.[Abstract]
Davison, A. J. & Harrach, B. (2002). Siadenovirus. In The Springer Index of Viruses , pp. 29-33. Edited by C. A. Tidona & G. Darai. New York:Springer-Verlag.
Davison, A. J., Telford, E. A., Watson, M. S., McBride, K. & Mautner, V. (1993). The DNA sequence of adenovirus type 40. Journal of Molecular Biology 234, 1308-1316.[Medline]
Davison, A. J., Wright, K. M. & Harrach, B. (2000). DNA sequence of frog adenovirus. Journal of General Virology 81, 2431-2439.
Ding, J., McGrath, W. J., Sweet, R. M. & Mangel, W. F. (1996). Crystal structure of the human adenovirus proteinase with its 11 amino acid cofactor. EMBO Journal 15, 1778-1783.[Medline]
Dingwall, C. & Laskey, R. A. (1991). Nuclear targeting sequencesa consensus? Trends in Biochemical Sciences 16, 478-481.[Medline]
Essbauer, S. & Ahne, W. (2001). Viruses of lower vertebrates. Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health 48, 403-475.
Felsenstein, J. (1989). PHYLIPPhylogeny inference package. Cladistics 5, 164-166.
Frye, F. L., Munn, R. J., Gardner, M., Barten, S. L. & Hadfy, L. B. (1994). Adenovirus-like hepatitis in a group of related Rankins dragon lizards (Pogona henrylawsoni). Journal of Zoo and Wildlife Medicine 25, 167-171.
Harrach, B. (2000). Reptile adenoviruses in cattle? Acta Veterinaria Hungarica 48, 484-490.
Harrach, B. & Benk
, M. (1998). Phylogenetic analysis of adenovirus sequences; proof of the necessity of establishing a third genus in the Adenoviridae family. In Adenovirus Methods and Protocols 21, pp. 309339. Edited by W. S. M. Wold. Totowa, NJ: Humana Press.
Harrach, B., Meehan, B. M., Benk
, M., Adair, B. M. & Todd, D. (1997). Close phylogenetic relationship between egg drop syndrome virus, bovine adenovirus serotype 7, and ovine adenovirus strain 287. Virology 229, 302-308.[Medline]
Hess, M., Blöcker, H. & Brandt, P. (1997). The complete nucleotide sequence of the egg drop syndrome virus: an intermediate between mastadenoviruses and aviadenoviruses. Virology 238, 145-156.[Medline]
Jacobson, E. R. & Kollias, G. V. (1986). Adenovirus-like infection in a savannah monitor. Journal of Zoo Animal Medicine 17, 149-151.
Jacobson, E. R. & Gardiner, C. H. (1990). Adeno-like virus in esophageal and tracheal mucosa of a Jacksons chameleon (Chamaeleo jacksoni). Veterinary Pathology 27, 210-212.[Medline]
Jacobson, E. R., Gardiner, C. H. & Foggin, C. M. (1984). Adenovirus-like infection in two Nile crocodiles. Journal of the American Veterinary Medical Association 185, 1421-1422.[Medline]
Jacobson, E. R., Gaskin, J. M. & Gardiner, C. H. (1985). Adenovirus-like infection in a boa constrictor. Journal of the American Veterinary Medical Association 187, 1226-1227.[Medline]
Jacobson, E. R., Kopit, W., Kennedy, F. A. & Funk, R. S. (1996). Coinfection of a bearded dragon (Pogona vitticeps) with adenovirus- and dependovirus-like viruses. Veterinary Pathology 33, 343-346.[Abstract]
Juhasz, A. & Ahne, W. (1992). Physico-chemical properties and cytopathogenicity of an adenovirus-like agent isolated from corn snake (Elaphe guttata). Archives of Virology 130, 429-439.
Khatri, A. & Both, G. W. (1998). Identification of transcripts and promoter regions of ovine adenovirus OAV287. Virology 245, 128-141.[Medline]
Kinsel, M. J., Barbiers, R. B., Manharth, A. & Murnane, R. D. (1997). Small intestinal adeno-like virus in a mountain chameleon (Chameleo montium). Journal of Zoo and Wildlife Medicine 28, 498-500.[Medline]
Lehmkuhl, H. D. & Cutlip, R. C. (1999). A new goat adenovirus isolate proposed as the prototype strain for goat adenovirus serotype 1. Archives of Virology 144, 1611-1618.[Medline]
Lehmkuhl, H. D., Hobbs, L. A. & Woods, L. W. (2001). Characterization of a new adenovirus isolated from black-tailed deer in California. Archives of Virology 146, 1687-1196.
McFerran, J. B. & Smyth, J. A. (2000). Avian adenoviruses. Revue Scientifique et Technique Office International des Epizooties 19, 589-601.
Ogawa, M., Ahne, W. & Essbauer, S. (1992). Reptilian viruses: adenovirus-like agent isolated from royal python (Python regius). Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health 39, 732-736.
Ojkic, D. & Nagy, É. (2000). The complete nucleotide sequence of fowl adenovirus type 8. Journal of General Virology 81, 1833-1837.
Page, R. D. M. (1996). TreeView: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12, 357-358.
Perkins, L. E., Campagnoli, R. P., Harmon, B. G., Gregory, C. R., Steffens, W. L., Latimer, K., Clubb, S. & Crane, M. (2001). Detection and confirmation of reptilian adenovirus infection by in situ hybridization. Journal of Veterinary Diagnostic Investigations 13, 365-368.
Pierson, F. W. & Domermuth, C. H. (1997). Haemorrhagic enteritis, marble spleen disease, and related infections. In Diseases of Poultry , pp. 624-633. Edited by B. W. Calnek, H. J. Barnes, C. W. Beard, L. R. McDougald & Y. M. Saif. Ames, IA:Iowa State University Press.
Pitcovski, J., Mualem, M., Rei-Koren, Z., Krispel, S., Shmueli, E., Peretz, Y., Gutter, B., Gallili, G. E., Michael, A. & Goldberg, D. (1998). The complete DNA sequence and genome organization of the avian adenovirus, haemorrhagic enteritis virus. Virology 249, 307-315.[Medline]
Ramis, A., Fernandez-Bellon, H., Majo, N., Martinez-Silvestre, A., Latimer, K., Campagnoli, R., Harmon, B. G., Gregory, C. R., Steffens, W. L., Clubb, S. & Crane, M. (2000). Adenovirus hepatitis in a boa constrictor (Boa constrictor). Journal of Veterinary Diagnostic Investigations 12, 573-576.
Rancourt, C., Keyvani-Amineh, H., Sircar, S., Labrecque, P. & Weber, J. M. (1995). Proline 137 is critical for adenovirus protease encapsidation and activation but not enzyme activity. Virology 209, 167-173.[Medline]
Russell, W. C. & Kemp, G. D. (1995). Role of adenovirus structural components in the regulation of adenovirus infection. Current Topics in Microbiology and Immunology 199, 81-98.
Russell, W. C. & Benk
, M. (1999). Animal adenoviruses. In Encyclopedia of Virology , pp. 14-21. Edited by A. Granoff & R. G. Webster. New York:Academic Press.
Rusvai, M., Harrach, B., Bánrévi, A., Evans, P. S. & Benk
, M. (2000). Identification and sequence analysis of the core protein genes of bovine adenovirus 2. Virus Research 70, 25-30.[Medline]
Schumacher, J., Jacobson, E. R., Burns, R. & Tramontin, R. R. (1994). Adenovirus-like infection in two rosy boas (Lichanura trivirgata). Journal of Zoo and Wildlife Medicine 25, 461-465.
Sheppard, M. & Trist, H. (1992). Characterization of the avian adenovirus penton base. Virology 188, 881-886.[Medline]
Sheppard, M. & Trist, H. (1993). The identification of genes for the major core proteins of fowl adenovirus serotype 10. Archives of Virology 132, 443-449.[Medline]
Sorden, S. D., Woods, L. W. & Lehmkuhl, H. D. (2000). Fatal pulmonary oedema in white-tailed deer (Odocoileus virginianus) associated with adenovirus infection. Journal of Veterinary Diagnostic Investigations 12, 378-380.
Thomson, D., Meers, J. & Harrach, B. (2002). Molecular confirmation of an adenovirus in brushtail possums (Trichosurus vulpecula). Virus Research 83, 189-195.[Medline]
Vrati, S., Boyle, D., Kocherhans, R. & Both, G. W. (1995). Sequence of ovine adenovirus homologues for 100K hexon assembly, 33K, pVIII, and fiber genes: early region E3 is not in the expected location. Virology 209, 400-408.[Medline]
Vrati, S., Brookes, D. E., Strike, P., Khatri, A., Boyle, D. B. & Both, G. W. (1996). Unique genome arrangement of an ovine adenovirus: identification of new proteins and proteinase cleavage sites. Virology 220, 186-199.[Medline]
Weber, J. M. (1995). Adenovirus endopeptidase and its role in virus infection. Current Topics in Microbiology and Immunology 199, 227-235.
Webster, A., Russell, S., Talbot, P., Russell, W. C. & Kemp, G. D. (1989). Characterization of the adenovirus proteinase: substrate specificity. Journal of General Virology 70, 3225-3234.
Webster, A., Hay, R. T. & Kemp, G. (1993). The adenovirus protease is activated by a virus-encoded disulphide-linked peptide. Cell 72, 97-104.[Medline]
Woods, L. W., Swift, P. K., Barr, B. C., Horzinek, R. C., Nordhausen, R. W., Stillian, M. H., Patton, J. F., Oliver, M. N., Jones, K. R. & MacLachlan, N. J. (1996). Systemic adenovirus infection associated with high mortality in mule deer (Odocoileus hemionus) in California. Veterinary Pathology 33, 125-132.[Abstract]
Received 13 May 2002;
accepted 28 June 2002.
This article has been cited by other articles:
![]() |
S. Rivera, J. F.X. Wellehan Jr, R. McManamon, C. J. Innis, M. M. Garner, B. L. Raphael, C. R. Gregory, K. S. Latimer, C. E. Rodriguez, O. Diaz-Figueroa, et al. Systemic adenovirus infection in Sulawesi tortoises (Indotestudo forsteni) caused by a novel siadenovirus J Vet Diagn Invest, July 1, 2009; 21(4): 415 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, X. Su, S. Gong, Q. Zeng, B. Zhu, Z. Wu, T. Peng, C. Zhang, and R. Zhou Comparative genomic analysis of two strains of human adenovirus type 3 isolated from children with acute respiratory infection in southern China J. Gen. Virol., June 1, 2006; 87(6): 1531 - 1541. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schrenzel, J. L. Oaks, D. Rotstein, G. Maalouf, E. Snook, C. Sandfort, and B. Rideout Characterization of a New Species of Adenovirus in Falcons J. Clin. Microbiol., July 1, 2005; 43(7): 3402 - 3413. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. X. Wellehan, A. J. Johnson, B. Harrach, M. Benko, A. P. Pessier, C. M. Johnson, M. M. Garner, A. Childress, and E. R. Jacobson Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses J. Virol., December 1, 2004; 78(23): 13366 - 13369. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Kovacs, A. J. Davison, A. N. Zakhartchouk, and B. Harrach Analysis of the first complete genome sequence of an Old World monkey adenovirus reveals a lineage distinct from the six human adenovirus species J. Gen. Virol., October 1, 2004; 85(10): 2799 - 2807. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Farkas, Z. Zadori, M. Benko, S. Essbauer, B. Harrach, and P. Tijssen A parvovirus isolated from royal python (Python regius) is a member of the genus Dependovirus J. Gen. Virol., March 1, 2004; 85(3): 555 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ursu, B. Harrach, K. Matiz, and M. Benko DNA sequencing and analysis of the right-hand part of the genome of the unique bovine adenovirus type 10 J. Gen. Virol., March 1, 2004; 85(3): 593 - 601. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. W. R. Lee, G. E. Blair, and D. A. Matthews Adenovirus core protein VII contains distinct sequences that mediate targeting to the nucleus and nucleolus, and colocalization with human chromosomes J. Gen. Virol., December 1, 2003; 84(12): 3423 - 3428. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Davison, M. Benko, and B. Harrach Genetic content and evolution of adenoviruses J. Gen. Virol., November 1, 2003; 84(11): 2895 - 2908. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |