|
|
||||||||
Animal: RNA Viruses |
Institute of Toxicology, Chung Shan Medical University, 110 Sec. 1, Chien-Kuo N. Road, Taichung 40203, Taiwan, Republic of China1
Author for correspondence: Gwo-Tarng Sheu. Fax +886 4 24720407. e-mail gtsheu{at}csmu.edu.tw
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-amanitin. Therefore, pol II, or a pol II-like enzyme, is mediating HDV replication.
The essential role of S-HDAg in HDV replication has been well established by several different experimental approaches (Lai, 1995
). In a cDNA transfection experiment, the disruption of the S-HDAg-encoding sequence by a 2 nt deletion resulted in the loss of RNA replication. However, S-HDAg supplied in trans could restore replication (Kuo et al., 1989
). Similar findings were obtained by transfection of the ribonucleocapsid protein (RNP) complex (using HDV RNA plus a recombinant form of HDAg derived from Escherichia coli), in which blocking the open reading frame (ORF) of S-HDAg in the viral genome disabled RNA replication (Dingle et al., 1998
). Cotransfection of a plasmid encoding a modified form of S-HDAg with a histidine tag (His-tag) could not restore the replication of HDV cDNA encoding defective S-HDAg (Dingle et al., 1998
). These data indicate that intact S-HDAg is required for HDV replication. However, transfection using RNP made from recombinant S-HDAg modified with His-tag at either terminus, together with the genomic RNA encoding intact S-HDAg, could lead to RNA replication (Dingle et al., 1998
). One interpretation of these findings is that the modified S-HDAg could carry out only a certain aspect of the HDV replication cycle, such as the transfer of the RNP complex to the nucleus, but that initiation of RNA replication may require newly synthesized S-HDAg that is properly post-translationally modified. These observations suggest that the structural requirement of HDV RNA for replication at the initiation stage may differ from that for the maintenance stage in the HDV life cycle.
The HDV virion contains both L-HDAg and S-HDAg, together with genomic RNA in an RNP complex (Bergmann & Gerin, 1986
; Bonino et al., 1986
). Once entering the nucleus of cells, HDV RNP is thought to initiate replication by a rolling-circle process, which leads to the synthesis of antigenomic RNA and S-HDAg-encoding mRNA (Lai, 1995
). Synthesis of genomic RNA from the newly synthesized antigenomic RNA is, presumably, delayed until a sufficient amount of S-HDAg is synthesized from the newly transcribed mRNA in order to reverse the inhibitory effects of L-HDAg (Modahl & Lai, 2000
). During RNA replication, an RNA-editing process occurs, resulting in the production of a mRNA encoding L-HDAg (Casey & Gerin, 1995
), which will shut off further RNA replication and initiate virus assembly.
The RNA-editing process takes place on the antigenomic RNA (Casey & Gerin, 1995
), producing an RNA that has an ORF encoding L-HDAg. This RNA is then used as the template for the synthesis of its genomic counterpart. The edited genomic RNA encoding L-HDAg is used as the template to produce L-HDAg mRNA.
Accordingly, during the HDV life cycle, there are several genomic-length RNA species produced: (1) genomic RNA encoding S-HDAg; (2) genomic RNA encoding L-HDAg; (3) antigenomic RNA encoding S-HDAg; and (4) antigenomic RNA encoding L-HDAg. Since HDAg can bind both genomic and antigenomic RNAs equally well (Lin et al., 1990
; Hwang et al., 1992
), all four of these RNA species are expected to be associated with S-HDAg and L-HDAg proteins to form RNP complexes. If all four of these RNA species exist in the infected cell, what are their functions and destiny during the virus life cycle? Although both genomic and antigenomic RNAs are present in the nucleus of the infected cell, only the genomic-sense RNAs (RNA species 1 and 2) are found in the virus particle (Chang et al., 1991
; Ryu et al., 1993
). The mechanism for the preferential selection of the genomic HDV RNA species for packaging into virus particles is still unknown. We postulate that an additional step of selection for genomic and antigenomic RNA might occur at the initiation stage of replication as well. Therefore, in this study, we set out to examine the ability of the various HDV RNA species to replicate in the presence of recombinant S-HDAg or mRNA encoding either L-HDAg or S-HDAg to understand the requirements for initiation of HDV replication at the early stage of virus infection.
We demonstrate that the nucleocapsid that comprises the L-HDAg-encoding genomic RNA species, which is generated by RNA editing, is unable to initiate replication even in the presence of S-HDAg. L-HDAg does not support HDV RNA replication nor does it inhibit the initiation of RNA replication. These findings explain why HDV particles, which contain S-HDAg and L-HDAg and a genomic RNA encoding S-HDAg, are able to initiate HDV RNA replication.
| Methods |
|---|
|
|
|---|
Preparation of recombinant S-HDAg.
Site-directed mutagenesis of HDV cDNA.
The 1·9 kb plasmid of HDV cDNA encoding the S-HDAg ORF (S-Ag/1.9) was mutated to encode the L-HDAg ORF (L-Ag/1.9) by site-directed mutagenesis. The termination codon (TAG) in the S-HDAg-encoding sequence was changed to TGG. Three primers were used for introducing this mutation. First-round PCR used an upstream primer (5' CACTGGGGTCGACAACTCTG) with a SalI site (italics) and a TGG mutation primer (5' AGCCAGGGATTCCCATGGGATA) to amplify a 144 bp mega-primer. This mega-primer was then used for second-round PCR using a downstream primer (5' GTCAACCTCTTAAGTTCCTCT) containing an AflII site (italics). The SalIAflII fragment was subcloned into the 1·9 kb HDV cDNA to replace the same fragment that encodes S-HDAg. The L-HDAg-encoding clone (L-Ag/1.9) was verified by DNA sequencing using Sequenase 2.0 (US Biochemical).
In vitro transcription of HDV RNA.
Genomic HDV RNA (1·9 kb) was transcribed from plasmids S-Ag/1.9 and L-Ag/1.9 using T7 MEGAscript (Ambion) after linearization by EcoRV digestion. Antigenomic HDV RNA was transcribed from S-Ag/1.9 and L-Ag/1.9 using SP6 MEGAscript (Ambion) after linearization by SnaBI digestion. The mRNAs of S-HDAg and L-HDAg were prepared from the expression plasmids (Sheu & Lai, 2000), which had been linearized with BamHI, and synthesized with T7 mMESSAGE mMACHINE (Ambion).
Cell culture.
COS-7 cells were cultured at 37 °C in 35 mm diameter dishes in Dulbeccos modified Eagles medium (DMEM) supplemented with 5% foetal bovine serum (FBS), 100 IU penicillin/ml and 100 µg streptomycin/ml. TS
3 cells, which contain an integrated cDNA with an S-HDAg-encoding ORF (Hwang et al., 1995
), were grown at 33 °C and 5% CO2 in DMEM supplemented with 10% FBS, 800 µg/ml G418 and PenicillinStreptomycin.
Transfection.
Purified recombinant S-HDAg (1 µl, 0·4 µg) or mRNA encoding either L-HDAg or S-HDAg (1 µl, 1 µg) and HDV 1·9 kb RNA (3 µl, 3 µg) were mixed in a final volume of 25 µl with 10 mM HEPES buffer (pH 7·4) at room temperature for 10 min. DOTAP (15 µl, Boehringer Mannheim) and 10 mM HEPES buffer (pH 7·4, 35 µl) were preincubated at room temperature for 15 min and added to the RNAprotein mixture for transfection. Cells grown to subconfluency in 35 mm dishes were transfected with 1 ml fresh medium and 75 µl DOTAPRNP or RNA complex. In some experiments, in lieu of the RNP complex, L-Ag/1.9 or S-Ag/1.9 (3 µg) plasmid DNA was transfected under the same conditions as described above.
Northern blot analysis.
Cellular RNA was extracted from transfected cells using TRIzol reagent (Gibco BRL) and 12 µg RNA was electrophoresed through a 1·2% agarose gel containing formaldehyde. RNA was blotted onto a nitrocellulose membrane (Hybond-C extra, Amersham) and probed with in vitro-transcribed HDV genomic RNA labelled with [32P]UTP to detect antigenomic RNA synthesis. To synthesize the genomic-sense RNA probe, the S29 plasmid (Modahl & Lai, 1998
) was linearized with EcoRV and transcribed with T7 RNA polymerase. The membrane was prehybridized at 55 °C for 2 h in prehybridization buffer (0·90 M NaCl, 50 mM NaH2PO4, 5 mM EDTA, 0·5% SDS, 10x Denhardts solution, 50% formamide, 400 µg/ml salmon sperm DNA and 100 µg/ml yeast tRNA) and hybridized overnight with hybridization buffer (0·63 M NaCl, 35 mM NaH2PO4, 3 mM EDTA, 0·5% SDS, 10x Denhardts solution, 50 % formamide and 100 µg/ml yeast tRNA) containing 2x106 c.p.m./ml 32P-labelled HDV genomic-sense RNA probe. To wash the membrane, washing buffer (1xSSC and 0·5% SDS) was used for the low-stringency wash at 55 °C until the wash contained nearly background levels of radioactivity. The high-stringency wash was then performed with buffer (0·2% SSC and 0·5% SDS) at 80 °C for 30 min, followed by autoradiography.
Western blot analysis.
Transfected cells were incubated with 150 µl RIPA buffer (1% NP-40, 1% sodium deoxycholate, 0·1% SDS, 150 mM NaCl and 50 mM TrisHCl, pH 8·0) in the presence of protease inhibitor cocktail (Boehringer Mannheim) at 4 °C for 10 min. The cell lysate was pipetted several times and 30 µl SDS-loading buffer was added. After the protein mixture was boiled for 10 min, 100 µl of sample was separated on a 10% polyacrylamide gel containing 0·1% SDS. Proteins on the polyacrylamide gel were transferred with a semi-dry transfer cell (Bio-Rad) at 2·5 mA/cm2 for 20 min. HDAgs were detected using the ECL Western Blot Detection system (Amersham) with a combination of three anti-HDAg monoclonal antibodies (mAbs) (Hwang & Lai, 1993
).
| Results |
|---|
|
|
|---|
|
|
|
We employed the RNA transfection method using the mRNA of L-HDAg to supply L-HDAg in trans in the cells. The capped mRNA of L-HDAg was synthesized in vitro and cotransfected with genomic-sense HDV RNA encoding S-HDAg or L-HDAg. RNA replication was monitored by Northern blot analysis of the antigenomic RNA or immunoblot analysis of HDAg. The result showed that L-HDAg synthesized from the transfected L-HDAg mRNA (Fig. 3b
, lane 1) could be detected at 5 days post-transfection. However, no S-HDAg was detected, indicating that no RNA replication had occurred. Similarly, Northern blot analysis showed that HDV RNA replication did not occur when L-HDAg was cotransfected with either RNA encoding S-HDAg (Fig. 3a
, lane 5) or RNA encoding L-HDAg (Fig. 3a
, lane 6). However, when recombinant S-HDAg (Fig. 3a
, lane 7) or its mRNA (Fig. 3a
, lane 8) were used together with the mRNA encoding L-HDAg for transfection, RNA replication could be restored for the genomic RNA encoding S-HDAg, even when an equal amount of L-HDAg was present. These results confirmed the previous finding (Modahl & Lai, 2000
) that L-HDAg did not significantly inhibit the synthesis of antigenomic RNA. Combined, these results suggest that the genomic RNA encoding L-HDAg is inherently defective for replication and that failure to replicate was not due to the production of L-HDAg.
A control experiment using the cDNA transfection method for both S-Ag/1.9 and L-Ag/1.9 showed that cDNA encoding L-HDAg could not replicate (Fig. 3b
, lane 4), whereas its counterpart cDNA encoding S-HDAg was able to replicate, as indicated by the production of both HDAg proteins (Fig. 3b
, lane 2).
Antigenomic HDV RNA encoding L-HDAg cannot be used as a template for replication
The results above showed that the genomic RNA containing the L-HDAg ORF could not replicate; thus, it will be a dead-end product of HDV replication. We examined further the possibility that the antigenomic RNA encoding L-HDAg may be used as a template for replication, i.e. that RNA editing occurs on the antigenomic RNAs (Casey & Gerin, 1995
); HDAg can complex with both the genomic and antigenomic RNA (Lin et al., 1990
). We used recombinant S-HDAg to cotransfect with these RNA species. The results showed that neither the antigenomic RNA (Fig. 4
, lane 2) nor the genomic RNA encoding L-HDAg (Fig. 4
, lane 1) could initiate replication by the RNP transfection method. As a control, HDV RNA replication was detected from genomic, but not antigenomic, RNA encoding S-HDAg (Fig. 4
, lane 4), which is in agreement with previous findings (Sheu & Lai, 2000
).
|
3 cell line
3 cells, which constitutively express S-HDAg from an integrated HDAg cDNA (Hwang et al., 1995
3 cells also could not replicate (Fig. 5
|
| Discussion |
|---|
|
|
|---|
Previous results indicated that only genomic, but not antigenomic, HDV RNA encoding S-HDAg could initiate RNA replication from the RNP complex containing the recombinant S-HDAg (Sheu & Lai, 2000
). These data are consistent with the notion that HDV antigenomic RNA is involved only in the maintenance of HDV replication but not for initiation of HDV replication at the early stage of virus infection. However, using the cDNA-free RNA transfection method with capped mRNA, both genomic and antigenomic RNAs are able to initiate replication (Modahl & Lai, 1998
). A possible explanation for the difference observed between RNP transfection and mRNA cotransfection is the presence of de novo-synthesized S-HDAg from the transfected mRNA, whereas, in the transfected RNP complex, the genomic, but not the antigenomic, template can produce S-HDAg mRNA. Thus, the RNP transfection method seems to be the method of choice for examining the early events of HDV replication, as it reflects more closely the natural requirements of HDV replication. Although the antigenomic RNA template could not be replicated in our RNP transfection assay, Dingle et al. (1998)
showed that this RNA species could be replicated with recombinant S-HDAg purified from E. coli after cotransfection. One possible explanation is that in our RNP system, the efficiency of replication is below the detectable range. Nevertheless, under our assay conditions, antigenomic HDV RNA has a much lower ability for replication when compared to the genomic RNA in vitro.
The HDV virion contains RNAs encoding S-HDAg and L-HDAg (Xia et al., 1990
). If both of these RNA species can replicate, it would be expected that L-HDAg would accumulate rapidly early in infection and inhibit RNA replication. In this study, we used both the capped mRNA of S-HDAg and purified recombinant S-HDAg to cotransfect with in vitro-synthesized genomic RNA containing the L-HDAg ORF (Fig. 3a
); replication did not occur in either case. Failure of the L-HDAg-encoding HDV RNA to replicate could have been due to insufficient amounts of S-HDAg in the cell or the production of L-HDAg, which, in turn, inhibits HDV RNA replication. However, this was found not to be the case, as this RNA failed to replicate in the S-HDAg-expressing cell line TS
3, which produces an abundant amount of S-HDAg (Fig. 5
). Also, in agreement with our previous data (Modahl & Lai, 2000
), we showed that L-HDAg does not inhibit replication of genomic HDV RNA as long as S-HDAg is present. Thus, the most likely possibility is that the single nucleotide substitution, which disrupted an amber termination codon, is detrimental to RNA replication. It is possible that this mutation may cause conformational changes to the HDV RNA. Previously, studies have shown that single nucleotide mutations in HDV RNA can cause significant effects on replication or transcription of various HDV RNA species (Wang et al., 1997
). The mechanism of replication inhibition with the genomic RNA encoding L-HDAg is not demonstrated clearly in the present study. It is possible that inhibition caused by L-HDAg in trans or by other cellular factors after the initiation of replication could be involved in vivo, thus terminating any further replication.
The inhibitory effect of replication by L-HDAg reported previously was based on the cDNA transfection method (Chao et al., 1990
; Glenn & White, 1991
). A recent report by Modahl & Lai (2000)
and the current findings suggest that the cDNA transfection approach may not reflect the real biology of HDV infection. We showed that the essential factors to initiate replication are nucleocapsid-associated S-HDAg and genomic RNA containing an S-HDAg ORF. Apparently, L-HDAg has little effect on the synthesis of antigenomic RNA from the incoming genomic RNA, as long as S-HDAg is present. Although recombinant S-HDAg purified from E. coli could also initiate replication from genomic RNA, it could not do the same with antigenomic RNA under our assay conditions. Our results suggest that E. coli-derived S-HDAg may be sufficient for initiating the synthesis of HDAg mRNA. However, newly synthesized HDAg (perhaps with correct post-translational modification) may be required for HDV RNA genome replication. This interpretation could explain why recombinant S-HDAg failed to support antigenomic RNA replication (Sheu & Lai, 2000
); antigenomic RNA cannot encode mRNA directly, whereas S-HDAg-encoding mRNA can support its replication (Modahl & Lai, 1998
).
Our data also support further the model proposed by Polson et al. (1996)
that, after RNA editing, the edited antigenomic RNA with the L-HDAg ORF is replicated into the genomic RNA encoding L-HDAg. This RNA is then transcribed into L-HDAg mRNA without replicating into new antigenomic RNA containing L-HDAg. Additional evidences also support this observation: previous data from Ryu et al. (1993)
have reported that the copy number of genomic RNA is 10-fold higher than that of antigenomic RNA in infected cells. Furthermore, Luo et al. (1990)
have shown that up to 41% of genomic HDV RNA was edited to produce the L-HDAg ORF in HDV-infected chimpanzees. Interestingly, they also showed that only 3 of 100 cDNA clones were found to contain the UGG codon from the antigenomic RNA of the HDV-transfected cells. The ratio of these four HDV RNA species, genomic S-HDAg:genomic L-HDAg:antigenomic S-HDAg:antigenomic L-HDAg, is estimated to be 59:41:9·7:0·3, respectively. Therefore, antigenomic RNA containing the L-HDAg ORF has the lowest copy number of all four RNA species. These data indicated that antigenomic RNA containing the L-HDAg ORF may be produced solely from the editing process rather than from the replicated genomic RNA containing the L-HDAg ORF.
In conclusion, we have shown the critical requirements for HDV to initiate replication and the effect of S-HDAg associated with nucleocapsid. Among the four different combinations of HDV nucleocapsid, only one form, probably that comprising genomic RNA encoding S-HDAg and complexed with S-HDAg, can initiate HDV replication. Thus, this regulation may account for the successful replication of HDV RNA after the virus enters the cells.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bonino, F., Heermann, K. H., Rizzetto, M. & Gerlich, W. H. (1986). Hepatitis delta virus: protein composition of delta antigen and its hepatitis B virus-derived envelope. Journal of Virology 58, 945-950.
Casey, J. L. & Gerin, J. L. (1995). Hepatitis D virus RNA editing: specific modification of adenosine in the antigenomic RNA. Journal of Virology 69, 7593-7600.[Abstract]
Chang, F. L., Chen, P. J., Tu, S. J., Wang, C. J. & Chen, D. S. (1991). The large form of hepatitis delta antigen is crucial for assembly of hepatitis delta virus. Proceedings of the National Academy of Sciences, USA 88, 8490-8494.
Chao, M. H. S. & Taylor, J. (1990). Role of two forms of hepatitis delta virus antigens: evidence for a mechanism of self-limiting genome replication. Journal of Virology 64, 2357-2361.
Chou, H. C., Hsieh, T. Y., Sheu, G. T. & Lai, M. M. (1998). Hepatitis delta antigen mediates the nuclear import of hepatitis delta virus RNA. Journal of Virology 72, 3684-3690.
Dingle, K., Bichko, V., Zuccola, H., Hogle, J. & Taylor, J. (1998). Initiation of hepatitis delta virus genome replication. Journal of Virology 72, 4783-4788.
Glenn, J. S. & White, J. M. (1991). Trans-dominant inhibition of human hepatitis delta virus genome replication. Journal of Virology 65, 2357-2361.
Gowans, E. J., Baroudy, B. M., Negro, F., Ponzetto, A., Purcell, R. H. & Gerin, J. L. (1988). Evidence for replication of hepatitis delta virus RNA in hepatocyte nuclei after in vivo infection. Virology 167, 274-278.[Medline]
Hwang, S. B. & Lai, M. M. (1993). A unique conformation at the carboxyl terminus of the small hepatitis delta antigen revealed by a specific monoclonal antibody. Virology 193, 924-931.[Medline]
Hwang, S. B., Lee, C. Z. & Lai, M. M. (1992). Hepatitis delta antigen expressed by recombinant baculoviruses: comparison of biochemical properties and post-translational modifications between the large and small forms. Virology 190, 413-422.[Medline]
Hwang, S. B., Jeng, K. S. & Lai, M. M. C. (1995). Studies of functional roles of hepatitis delta antigen in delta virus RNA replication. In The Unique Hepatitis Delta Virus , pp. 95-109. Edited by G. Dinter-Gottlieb. Berlin:Springer-Verlag.
Kuo, M. Y., Chao, M. & Taylor, J. (1989). Initiation of replication of the human hepatitis delta virus genome from cloned DNA: role of delta antigen. Journal of Virology 63, 1945-1950.
Lai, M. M. (1995). The molecular biology of hepatitis delta virus. Annual Review of Biochemistry 64, 259-286.[Medline]
Lin, J. H., Chang, M. F., Baker, S. C., Govindarajan, S. & Lai, M. M. C. (1990). Characterization of hepatitis delta antigen: specific binding to hepatitis delta virus RNA. Journal of Virology 64, 4051-4058.
Lo, K., Sheu, G. T. & Lai, M. M. (1998). Inhibition of cellular RNA polymerase II transcription by delta antigen of hepatitis delta virus. Virology 247, 178-188.[Medline]
Luo, G. X., Chao, M., Hsieh, S. Y., Sureau, C., Nishikura, K. & Taylor, J. (1990). A specific base transition occurs on replicating hepatitis delta virus RNA. Journal of Virology 64, 1021-1027.
Modahl, L. E. & Lai, M. M. (1998). Transcription of hepatitis delta antigen mRNA continues throughout hepatitis delta virus (HDV) replication: a new model of HDV RNA transcription and replication. Journal of Virology 72, 5449-5456.
Modahl, L. E. & Lai, M. M. (2000). The large delta antigen of hepatitis delta virus potently inhibits genomic but not antigenomic RNA synthesis: a mechanism enabling initiation of viral replication. Journal of Virology 74, 7375-7380.
Modahl, L. E., Macnaughton, T. B., Zhu, N., Johnson, D. L. & Lai, M. M. (2000). RNA-dependent replication and transcription of hepatitis delta virus RNA involve distinct cellular RNA polymerases. Molecular and Cellular Biology 20, 6030-6039.
Moraleda, G. & Taylor, J. (2001). Host RNA polymerase requirements for transcription of the human hepatitis delta virus genome. Journal of Virology 75, 10161-10169.
Polson, A. G., Bass, B. L. & Casey, J. L. (1996). RNA editing of hepatitis delta virus antigenome by dsRNA-adenosine deaminase. Nature 380, 454-456.[Medline]
Rizzetto, M., Hoyer, B., Canese, M. G., Shih, J. W. K., Purcell, R. H. & Gerin, J. L. (1980). Delta agent: association of
antigen with hepatitis B surface antigen and RNA in serum of
-infected chimpanzees. Proceedings of the National Academy of Sciences, USA 77, 6124-6128.
Ryu, W. S., Netter, H. J., Bayer, M. & Taylor, J. (1993). Ribonucleoprotein complexes of hepatitis delta virus. Journal of Virology 67, 3281-3287.
Sheu, G. T. & Lai, M. M. (2000). Recombinant hepatitis delta antigen from E. coli promotes hepatitis delta virus RNA replication only from the genomic strand but not the antigenomic strand. Virology 278, 578-586.[Medline]
Wang, H. W., Wu, H. L., Chen, D. S. & Chen, P. J. (1997). Identification of the functional regions required for hepatitis D virus replication and transcription by linker-scanning mutagenesis of viral genome. Virology 239, 119-131.[Medline]
Xia, Y. P., Chang, M. F., Wei, D., Govindarajan, S. & Lai, M. M. (1990). Heterogeneity of hepatitis delta antigen. Virology 178, 331-336.[Medline]
Received 19 April 2002;
accepted 4 June 2002.
This article has been cited by other articles:
![]() |
F.-T. Liao, Y.-J. Lee, J.-L. Ko, C.-C. Tsai, C.-J. Tseng, and G.-T. Sheu Hepatitis delta virus epigenetically enhances clusterin expression via histone acetylation in human hepatocellular carcinoma cells J. Gen. Virol., May 1, 2009; 90(5): 1124 - 1134. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. O. Gudima, J. Chang, and J. M. Taylor Features Affecting the Ability of Hepatitis Delta Virus RNAs To Initiate RNA-Directed RNA Synthesis J. Virol., June 1, 2004; 78(11): 5737 - 5744. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. B. Macnaughton, Y.-I. Li, A. L. Doughty, and M. M. C. Lai Hepatitis Delta Virus RNA Encoding the Large Delta Antigen Cannot Sustain Replication due to Rapid Accumulation of Mutations Associated with RNA Editing J. Virol., November 15, 2003; 77(22): 12048 - 12056. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |