J Gen Virol Try Microbiology Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vives, M. C.
Right arrow Articles by Guerri, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vives, M. C.
Right arrow Articles by Guerri, J.
Agricola
Right arrow Articles by Vives, M. C.
Right arrow Articles by Guerri, J.
Journal of General Virology (2002), 83, 2587-2591.
© 2002 Society for General Microbiology


Plant

Low genetic variation between isolates of Citrus leaf blotch virus from different host species and of different geographical origins

María C. Vives1, Luis Rubio1, Luis Galipienso1, Luis Navarro1, Pedro Moreno1 and José Guerri1

Instituto Valenciano de Investigaciones Agrarias (IVIA), Cra. Moncada-Náquera Km. 4·5, 46113 Moncada, Valencia, Spain1

Author for correspondence: José Guerri. Fax +34 96 1390240. e-mail jguerri{at}ivia.es


   Abstract
TOP
Abstract
Main text
References
 
The population structure and genetic diversity of Citrus leaf blotch virus (CLBV) were estimated by single-strand conformation polymorphism and nucleotide sequence analyses of two genomic regions located within the replicase (R) and the coat protein (C) genes. Analysis of 30 cDNA clones of each genomic region from two CLBV isolates showed that both isolates contained a predominant haplotype and others closely related. Analysis of 37 CLBV Spanish field isolates showed low genetic diversity (0·0041 and 0·0018 for genomic regions R and C, respectively). Comparison of 14 CLBV isolates from Spain, Japan, USA, France and Australia showed genetic diversities of 0·0318 (R) and 0·0209 (C), respectively. No correlation was found between genetic distance and geographical origin or host species of the isolates. The ratio between nonsynonymous and synonymous substitutions was the lowest found in a plant virus, indicating a strong negative selective pressure in both genomic regions.


   Main text
TOP
Abstract
Main text
References
 
RNA viruses are believed to have the potential for high genetic diversity as a result of their capacity to build up large populations and the error-prone nature of RNA polymerases (Domingo & Holland, 1994Down ). However, other factors affecting this diversity include genetic recombination, genome re-assortment, genetic drift and natural selection (Dolja & Carrington, 1992Down ; Gibbs, 1995Down ; Koonin & Dolja, 1993Down ; Roossinck, 1997Down ; García-Arenal et al., 2001Down ). Thus, although the error rate of different viral RNA polymerases is similar (Domingo & Holland, 1994Down ), genetic diversity may differ between viruses depending on the host range, means of dispersal, geographical incidence and/or virus–vector relationships. Understanding the influence of these factors on virus variation requires characterization of the virus population structure and estimation of its genetic diversity. These studies also have a practical interest for plant virus control, since strategies based on monogenic host resistance are dependent on the genetic variation of the virus. Studies on genetic variation of plant virus populations are generally rare and mostly restricted to viruses infecting annual crops (García-Arenal et al., 2001Down ), with the only exception being recent studies on Citrus tristeza virus (CTV) (Ayllón et al., 1999Down ; Rubio et al., 2000Down , 2001bDown ; Kong et al., 2000Down ).

Citrus leaf blotch virus (CLBV) has been recently characterized (Galipienso et al., 2000Down , 2001Down ). Its host range is presently restricted to citrus and vector transmission has not been demonstrated (Galipienso et al., 2000Down , and unpublished data). CLBV virions are filamentous particles 960 nm in length composed of single-stranded, positive-sense, genomic RNA (gRNA) of 8747 nt and a 41 kDa coat protein (CP). The CLBV gRNA has three open reading frames (ORFs) encoding a polyprotein involved in replication, a potential movement protein and the CP (Fig. 1Down, Galipienso et al., 2001Down ; Vives et al., 2001Down ). In addition to the gRNA, CLBV-infected tissues contain two subgenomic RNAs which are 3'-coterminal and two which are 5'-coterminal (Vives et al., 2002aDown ).



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 1. SSCP analysis for the genomic RNA regions R (left panels) and C (right panels) of CLBV. An outline of the CLBV genome is given at the top. Black boxes indicate the genomic regions analysed. (a) SSCP analysis of 30 clones of each region from isolates S2s and J1m. Complementary DNA of these genomic regions was obtained by RT–PCR with specific primers. Asterisks indicate the SSCP pattern of the RT–PCR product from which the clones were obtained. (b) SSCP analysis of the RT–PCR products of regions R and C from 37 CLBV isolates collected in Eastern Spain. The different SSCP patterns (haplotypes) detected (S1s, S2s, S35m, S5s and S32s) are indicated at the bottom. The number of clones (a) or field isolates (b) showing the same SSCP pattern is indicated at the top of each gel.

 
In this work, we studied the population structure and the genetic variation within and between CLBV isolates from various countries using single-strand conformation polymorphism (SSCP) and nucleotide sequence analyses. Two genomic regions were selected on the basis of their different degree of conservation in filamentous viruses (Dolja et al., 1991Down ; Vives et al., 2001Down ). Region R, located in ORF1 between the methyltransferase and protease domains, had low nucleotide identity in different filamentous viruses, whereas region C encompassed a conserved C-terminal region of the CP gene. A total of 46 CLBV isolates was analysed. Thirty-seven of them were collected in a field survey spanning a 100 km transect in the main citrus area of Eastern Spain and comprised 32 from sweet orange [C. sinensis (L.) Osb.] (isolates S1s to S32s), two from clementine (C. clementina Hort. ex Tan.) (isolates S33c and S34c) and three from satsuma mandarin [C. unshiu (Macf.) Marc.] (isolates S35m to S37m). Isolates S38k, A1k and F1k were from Nagami kumquat [Fortunella margarita (Lour.) Swing.], S38k was from a variety collection at Alhama, Murcia (Spain), A1k from New South Wales, Australia (kindly provided by P. Barkley) and F1k from Corsica, France. Isolates J1m, J2m, J3m and J4m were from different satsuma cultivars from Japan, and U1s and U2s from Roble sweet orange trees from Florida, USA (kindly provided by S. M. Garnsey). Infected tissue was always sampled from field trees or from bud propagations thereof.

Total RNA was extracted from healthy or CLBV-infected leaf tissue with TRIzol reagent (Invitrogen) and used as template for reverse transcription and PCR amplification (RT–PCR) as previously described (Vives et al., 2002bDown ), but using equimolar concentrations (1·5 mM) of MgCl2 and deoxynucleotides to minimize the Taq DNA polymerase errors (Eckert & Kunkel, 1990Down ). Region R was amplified with primers KU-54 (5' ACTTGCAGAAATGATCAGACCG 3', positions 2260–2281) and KU-55 (5' TGCCTCATAGAAATTTATTAATGCAC 3', positions 2728–2703), and region C with primers KU-18 (5' TTAAGATTACAGACACGAAGG 3', positions 7686–7706) and KU-19 (5' CTGTTTTTGAATTTTGCTCG 3', positions 8123–8104), based on the CLBV sequence (Vives et al., 2001Down ) (Fig. 1Up). All CLBV isolates yielded PCR products of 469 or 438 bp, which corresponded to the size expected for regions R or C, respectively, whereas no amplification was obtained using equivalent tissues from healthy plants (data not shown).

To examine the intra-isolate population structure of CLBV isolates S2s (from a Spanish sweet orange) and J1m (from a Japanese satsuma mandarin), the RT–PCR products from regions R and C were SSCP-analysed as previously described (Rubio et al., 1996Down , 1999Down , 2000Down ), but using 10% acrylamide gels and 300 V for 2·5 h for electrophoresis. The RT–PCR products were then cloned into pGEM-T (Promega) using standard protocols (Sambrook et al., 1989Down ), and thirty randomly selected clones from each region and isolate were PCR-amplified with the corresponding primers. The SSCP pattern of individual clones was compared with that of the corresponding RT–PCR product. For each region, different SSCP profiles were considered genetic variants or haplotypes. Three to five different haplotypes were observed for each isolate and genomic region, one of them being predominant. The predominant haplotype always accounted for more than 80% of the clones analysed, and its SSCP pattern was identical to that observed in the corresponding RT–PCR product (Fig. 1aUp).

To estimate the genetic diversity within CLBV isolates S2s and J1m and the reliability of SSCP analysis to discriminate between sequence variants, we determined the nucleotide sequence of all clones that had different SSCP patterns and four clones that had the same SSCP pattern for each region and isolate. Nucleotide sequences were determined with an ABI PRISM DNA sequencer 377 (Perkin–Elmer) and aligned with the CLUSTAL W program (Thompson et al., 1994Down ). MEGA (Kumar et al., 2001Down ) was used to estimate nucleotide distances (number of nucleotide differences per site) between pairs of sequences using the Kimura 2-parameter method (Kimura, 1980Down ). All clones with the same SSCP pattern had identical nucleotide sequences, except one from region R and one from region C that differed by a single nucleotide. Similar results were found in other plant viruses (Rubio et al., 1999Down ; Hall et al., 2001Down ) and indicate that SSCP analysis is an accurate tool to identify genetic variants. Genetic diversity (average genetic distance between two genetic variants selected randomly) was estimated from the nucleotide distance between haplotypes and their frequency in the population, using the method of Lynch & Crease (1990)Down . The intra-isolate genetic diversity of isolates S2s and J1m for region R was 0·0017 and 0·0006, respectively, whereas diversity for region C was 0·0005 in both isolates. These diversity values could be overestimated due to errors associated with the reverse transcriptase and Taq DNA polymerase activities (Bracho et al., 1998Down ); however, considering the low values obtained here, the impact of such errors should be minimal. These low intra-isolate diversity values, which are similar to those reported for other plant viruses (Kong et al., 2000Down ; Schneider & Roossink, 2000Down ; Rubio et al., 2001aDown ), indicate that the populations of CLBV isolates S2s and J1m are composed of closely related haplotypes, one of them being clearly predominant.

To examine the heterogeneity of CLBV isolates from a natural population in Eastern Spain, the RT–PCR products amplified from the R and C regions of 37 isolates were SSCP-analysed. In all cases one or two intense bands were observed, suggesting that all isolates had a predominant haplotype. Five different SSCP patterns were observed for region R and four for region C, but for both genomic regions more than 80% of the isolates showed the same pattern (Fig. 1bUp). To estimate genetic diversity of the population for each genomic region, all PCR products showing different SSCP patterns, and ten showing the same SSCP pattern, were sequenced. All isolates with the same SSCP pattern had identical nucleotide sequences supporting the validity of SSCP analysis to identify genetic variants. The nucleotide distances between isolates with different SSCP patterns ranged from 0·0024 to 0·0273 for region R and from 0·0025 to 0·0154 for region C (see S isolates in Table 1Down). The genetic diversity (estimated from haplotype frequencies and nucleotide distance between haplotypes; Fig. 1Up and Table 1Down) was 0·0041 and 0·0018 for regions R and C, respectively. These diversity values are low compared with those calculated for the Spanish population of CTV (also restricted to citrus hosts), which ranged from 0·0352 to 0·1763, depending on the genomic region analysed (Rubio et al., 2001bDown ). This suggests that the Spanish CLBV population could derive from a single origin and that virus introduction might have occurred recently. The observed low diversity and the finding that CLBV isolates from different host species (sweet orange and clementine) had the same SSCP pattern, and therefore the same predominant haplotype, suggest that host species do not contribute to differentiation of the virus population, as observed with CTV and other plant viruses (García-Arenal et al., 2001Down ; and our unpublished results).


View this table:
[in this window]
[in a new window]
 
Table 1. Genetic distances between CLBV isolates

 
To assess the genetic variation of CLBV isolates from different geographical origins and citrus hosts, the RT–PCR products of genomic regions R and C from 14 CLBV isolates collected in Spain (S1s, S2s, S5s, S32s, S35m and S38k), Japan (J1m, J2m, J3m and J4m), USA (U1s and U2s), Australia (A1k) and France (F1k) were sequenced and compared (Table 1Up). The nucleotide diversity between isolates was 0·0318±0·0049 and 0·0209±0·0039 for regions R and C, respectively (Table 2Down). No correlation was observed between the genetic distance and the geographical origin or the host species from which the isolates were obtained. Low genetic variation among geographically distant isolates has also been reported for two tobamoviruses (Rodríguez-Cerezo et al., 1989Down ; Fraile et al., 1996Down ), two criniviruses (Rubio et al., 1999Down , 2001aDown ) and the closterovirus CTV (Rubio et al., 2001bDown ).


View this table:
[in this window]
[in a new window]
 
Table 2. Average number of nucleotide substitutions between CLBV isolates (Table 1Up) in genomic regions R and C

 
The selective constraint for amino acid change on each genomic region was estimated by computing the nonsynonymous and synonymous substitutions (Nei & Kumar, 2000Down ). The number of synonymous substitutions per synonymous site (dS) was similar in regions R and C (Table 2Up), whereas the number of nonsynonymous substitutions per nonsynonymous site (dN) was smaller than dS and different for each genomic region (Table 2Up). The ratio dN/dS was 0·0737 and 0·0086 for regions R and C, respectively. To our knowledge these are the lowest dN/dS values so far reported for a plant virus (García-Arenal et al., 2001Down ) and they suggest a strong negative selective pressure for amino acid changes in both genomic regions. Indeed, all isolates had identical amino acid sequence in region C, except for isolate J3m which had a unique substitution of a valine for isoleucine (data not shown). It should be noted that the C region corresponds to a zone of the CP gene which is conserved in filamentous RNA viruses (Dolja et al., 1991Down ).

At least four factors might account for the low genetic diversity observed: (i) CLBV might have been recently dispersed in infected budwood; (ii) similar selective pressure by different host species has prevented host-driven population changes like those observed in other plant viruses (Rubio et al., 2000Down ; García-Arenal et al., 2001Down ); (iii) strong negative selective pressure for amino acid variation; (iv) the apparent absence of a natural vector, which might have prevented population changes induced by the founder effect often associated with the transmission process (d’Urso et al., 2000Down ).


   Acknowledgments
 
The authors thank Maria Boil for her excellent technical assistance. The first and third authors were recipients of doctoral and post-doctoral fellowships, respectively, from the INIA. This work was supported by grants from INIA projects SC93-110 and SC97-103.


   Footnotes
 
The nucleotide sequences obtained in this work have been deposited in the EMBL database under accession numbers AJ488033–AJ488047 and AJ488182–AJ488193.


   References
TOP
Abstract
Main text
References
 
Ayllón, M. A., Rubio, L., Moya, A., Guerri, J. & Moreno, P. (1999). The haplotype distribution of two genes of Citrus tristeza virus is altered after host change or aphid transmission. Virology 255, 32-39.[Medline]

Bracho, M. A., Moya, A. & Barrio, E. (1998). Contribution of Taq polymerase-induced errors to the estimation of RNA virus diversity. Journal of General Virology 79, 2921-2928.[Abstract]

Dolja, V. V. & Carrington, J. C. (1992). Evolution of positive strand RNA viruses. Seminars in Virology 3, 315-326.

Dolja, V. V., Boyko, V. P., Agranovsky, A. A. & Koonin, E. V. (1991). Phylogeny of capsid proteins of rod-shaped and filamentous RNA plant viruses: two families with distinct patterns of sequence and probably structure conservation. Virology 184, 79-86.[Medline]

Domingo, E. & Holland, J. J. (1994). Mutation rates and rapid evolution of RNA viruses. In The Evolutionary Biology of Viruses , pp. 161-184. Edited by S. S. Morse. New York:Raven Press.

d’Urso, F., Ayllón, M. A., Rubio, L., Sambade, A., Hermoso de Mendoza, A., Guerri, J. & Moreno, P. (2000). Contribution of uneven distribution of genomic RNA variants of Citrus tristeza virus (CTV) within the plant to changes in the viral population following aphid transmission. Plant Pathology 49, 288-294.

Eckert, K. A. & Kunkel, T. A. (1990). High fidelity by the Thermus aquaticus DNA polymerase. Nucleic Acids Research 18, 3737-3744.

Fraile, A., Malpica, J. M., Aranda, M. A., Rodríguez-Cerezo, E. & García-Arenal, F. (1996). Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 223, 148-155.[Medline]

Galipienso, L., Navarro, L., Ballester-Olmos, J. F., Pina, J. A., Moreno, P. & Guerri, J. (2000). Host range and symptomatology of a graft-transmissible pathogen causing bud union crease of citrus on trifoliate rootstocks. Plant Pathology 49, 308-314.

Galipienso, L., Vives, M. C., Moreno, P., Milne, R. G., Navarro, L. & Guerri, J. (2001). Partial characterisation of Citrus leaf blotch virus, a new virus from Nagami kumquat. Archives of Virology 146, 357-368.[Medline]

García-Arenal, F., Fraile, A. & Malpica, J. M. (2001). Variability and genetic structure of plant virus populations. Annual Review of Phytopathology 39, 157-186.[Medline]

Gibbs, M. (1995). The luteovirus supergroup: rampant recombination and persistent partnerships. In Molecular Basis of Virus Evolution , pp. 351-368. Edited by A. J. Gibbs, C. H. Calisher & F. García-Arenal. Cambridge:Cambridge University Press.

Hall, J. S., French, R., Morris, T. J. & Stenger, D. C. (2001). Structure and temporal dynamics of populations within Wheat streak mosaic virus isolates. Journal of Virology 75, 10231-10243.[Abstract/Free Full Text]

Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]

Kong, P., Rubio, L., Polek, M. & Falk, B. W. (2000). Population structure and genetic diversity within California Citrus tristeza virus (CTV) isolates. Virus Genes 21, 139-145.[Medline]

Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive strand RNA viruses: Implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Medline]

Kumar, S., Tamura, K., Jakobsen, I. B. & Nei, M. (2001). MEGA 2: Molecular Evolutionary Genetics Analysis software. Arizona, USA: Arizona State University.

Lynch, M. & Crease, T. J. (1990). The analysis of population survey data on DNA sequence variation. Molecular Biology and Evolution 7, 377-394.[Abstract]

Nei, M. & Kumar, S. (2000). Molecular Evolution and Phylogenetics. New York: Oxford University Press.

Rodríguez-Cerezo, E., Moya, A. & García-Arenal, F. (1989). Variability and evolution of the plant RNA virus Pepper mild mottle virus. Journal of Virology 63, 2198-2203.[Abstract/Free Full Text]

Roossinck, M. J. (1997). Mechanisms of plant virus evolution. Annual Review of Phytopathology 35, 191-209.[Medline]

Rubio, L., Ayllón, M. A., Guerri, J., Pappu, H., Niblett, C. & Moreno, P. (1996). Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of the coat protein gene. Annals of Applied Biology 129, 479-489.

Rubio, L., Soong, J., Kao, J. & Falk, B. W. (1999). Geographic distribution and molecular variation of isolates of three whitefly-borne closteroviruses of cucurbits: Lettuce infectious yellows virus, Cucurbit yellow stunting disorder virus, and Beet pseudo-yellows virus. Phytopathology 89, 707-711.[Medline]

Rubio, L., Guerri, J. & Moreno, P. (2000). Characterization of Citrus tristeza virus isolates by single-strand conformation polymorphism analysis of DNA complementary to their RNA population. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists , pp. 12-17. Edited by R. H. Yokomi, J. V. da Graça & R. F. Lee. Riverside, CA:IOCV.

Rubio, L., Abou-Jawdah, Y., Lin, H. X. & Falk, B. W. (2001a). Geographically distant isolates of the crinivirus Cucurbit yellow stunting disorder virus show very low genetic diversity in the coat protein gene. Journal of General Virology 82, 929-933.[Abstract/Free Full Text]

Rubio, L., Ayllón, M. A., Kong, P., Fernández, A., Polek, M., Guerri, J., Moreno, P. & Falk, B. W. (2001b). Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. Journal of Virology 75, 8054-8062.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schneider, W. L. & Roossink, M. J. (2000). Evolutionary related Sindbis-like plant viruses maintain different levels of population diversity in a common host. Journal of Virology 74, 3130-3134.[Abstract/Free Full Text]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). Improving the sensitivity of progressive multiple sequence alignment through sequence weighing position-specific gap penalties and weigh matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Vives, M. C., Galipienso, L., Navarro, L., Moreno, P. & Guerri, J. (2001). The nucleotide sequence and genomic organization of Citrus leaf blotch virus: a candidate type species for a new virus genus. Virology 287, 225-233.[Medline]

Vives, M. C., Galipienso, L., Navarro, L., Moreno, P. & Guerri, J. (2002a). Characterization of two kinds of subgenomic RNAs produced by Citrus leaf blotch virus. Virology 295, 328-336.[Medline]

Vives, M. C., Galipienso, L., Navarro, L., Moreno, P. & Guerri, J. (2002b). Citrus leaf blotch virus (CLBV): A new citrus virus associated with bud union crease of trifoliate rootstocks. In Proceedings of the 15th Conference of the International Organization of Citrus Virologists. Edited by R. G. Milne, N. Duran & J. V. da Graça. Riverside, CA: IOCV (in press).

Received 18 April 2002; accepted 29 May 2002.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
P. D. Voth, L. Mairura, B. E. Lockhart, and G. May
Phylogeography of Ustilago maydis virus H1 in the USA and Mexico.
J. Gen. Virol., November 1, 2006; 87(Pt 11): 3433 - 3441.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
S. Martin, M. L. Garcia, A. Troisi, L. Rubio, G. Legarreta, O. Grau, D. Alioto, P. Moreno, and J. Guerri
Genetic variation of populations of Citrus psorosis virus.
J. Gen. Virol., October 1, 2006; 87(Pt 10): 3097 - 3102.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vives, M. C.
Right arrow Articles by Guerri, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vives, M. C.
Right arrow Articles by Guerri, J.
Agricola
Right arrow Articles by Vives, M. C.
Right arrow Articles by Guerri, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS