|
|
||||||||
Plant |
Instituto Valenciano de Investigaciones Agrarias (IVIA), Cra. Moncada-Náquera Km. 4·5, 46113 Moncada, Valencia, Spain1
Author for correspondence: José Guerri. Fax +34 96 1390240. e-mail jguerri{at}ivia.es
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
Citrus leaf blotch virus (CLBV) has been recently characterized (Galipienso et al., 2000
, 2001
). Its host range is presently restricted to citrus and vector transmission has not been demonstrated (Galipienso et al., 2000
, and unpublished data). CLBV virions are filamentous particles 960 nm in length composed of single-stranded, positive-sense, genomic RNA (gRNA) of 8747 nt and a 41 kDa coat protein (CP). The CLBV gRNA has three open reading frames (ORFs) encoding a polyprotein involved in replication, a potential movement protein and the CP (Fig. 1
, Galipienso et al., 2001
; Vives et al., 2001
). In addition to the gRNA, CLBV-infected tissues contain two subgenomic RNAs which are 3'-coterminal and two which are 5'-coterminal (Vives et al., 2002a
).
|
Total RNA was extracted from healthy or CLBV-infected leaf tissue with TRIzol reagent (Invitrogen) and used as template for reverse transcription and PCR amplification (RTPCR) as previously described (Vives et al., 2002b
), but using equimolar concentrations (1·5 mM) of MgCl2 and deoxynucleotides to minimize the Taq DNA polymerase errors (Eckert & Kunkel, 1990
). Region R was amplified with primers KU-54 (5' ACTTGCAGAAATGATCAGACCG 3', positions 22602281) and KU-55 (5' TGCCTCATAGAAATTTATTAATGCAC 3', positions 27282703), and region C with primers KU-18 (5' TTAAGATTACAGACACGAAGG 3', positions 76867706) and KU-19 (5' CTGTTTTTGAATTTTGCTCG 3', positions 81238104), based on the CLBV sequence (Vives et al., 2001
) (Fig. 1
). All CLBV isolates yielded PCR products of 469 or 438 bp, which corresponded to the size expected for regions R or C, respectively, whereas no amplification was obtained using equivalent tissues from healthy plants (data not shown).
To examine the intra-isolate population structure of CLBV isolates S2s (from a Spanish sweet orange) and J1m (from a Japanese satsuma mandarin), the RTPCR products from regions R and C were SSCP-analysed as previously described (Rubio et al., 1996
, 1999
, 2000
), but using 10% acrylamide gels and 300 V for 2·5 h for electrophoresis. The RTPCR products were then cloned into pGEM-T (Promega) using standard protocols (Sambrook et al., 1989
), and thirty randomly selected clones from each region and isolate were PCR-amplified with the corresponding primers. The SSCP pattern of individual clones was compared with that of the corresponding RTPCR product. For each region, different SSCP profiles were considered genetic variants or haplotypes. Three to five different haplotypes were observed for each isolate and genomic region, one of them being predominant. The predominant haplotype always accounted for more than 80% of the clones analysed, and its SSCP pattern was identical to that observed in the corresponding RTPCR product (Fig. 1a
).
To estimate the genetic diversity within CLBV isolates S2s and J1m and the reliability of SSCP analysis to discriminate between sequence variants, we determined the nucleotide sequence of all clones that had different SSCP patterns and four clones that had the same SSCP pattern for each region and isolate. Nucleotide sequences were determined with an ABI PRISM DNA sequencer 377 (PerkinElmer) and aligned with the CLUSTAL W program (Thompson et al., 1994
). MEGA (Kumar et al., 2001
) was used to estimate nucleotide distances (number of nucleotide differences per site) between pairs of sequences using the Kimura 2-parameter method (Kimura, 1980
). All clones with the same SSCP pattern had identical nucleotide sequences, except one from region R and one from region C that differed by a single nucleotide. Similar results were found in other plant viruses (Rubio et al., 1999
; Hall et al., 2001
) and indicate that SSCP analysis is an accurate tool to identify genetic variants. Genetic diversity (average genetic distance between two genetic variants selected randomly) was estimated from the nucleotide distance between haplotypes and their frequency in the population, using the method of Lynch & Crease (1990)
. The intra-isolate genetic diversity of isolates S2s and J1m for region R was 0·0017 and 0·0006, respectively, whereas diversity for region C was 0·0005 in both isolates. These diversity values could be overestimated due to errors associated with the reverse transcriptase and Taq DNA polymerase activities (Bracho et al., 1998
); however, considering the low values obtained here, the impact of such errors should be minimal. These low intra-isolate diversity values, which are similar to those reported for other plant viruses (Kong et al., 2000
; Schneider & Roossink, 2000
; Rubio et al., 2001a
), indicate that the populations of CLBV isolates S2s and J1m are composed of closely related haplotypes, one of them being clearly predominant.
To examine the heterogeneity of CLBV isolates from a natural population in Eastern Spain, the RTPCR products amplified from the R and C regions of 37 isolates were SSCP-analysed. In all cases one or two intense bands were observed, suggesting that all isolates had a predominant haplotype. Five different SSCP patterns were observed for region R and four for region C, but for both genomic regions more than 80% of the isolates showed the same pattern (Fig. 1b
). To estimate genetic diversity of the population for each genomic region, all PCR products showing different SSCP patterns, and ten showing the same SSCP pattern, were sequenced. All isolates with the same SSCP pattern had identical nucleotide sequences supporting the validity of SSCP analysis to identify genetic variants. The nucleotide distances between isolates with different SSCP patterns ranged from 0·0024 to 0·0273 for region R and from 0·0025 to 0·0154 for region C (see S isolates in Table 1
). The genetic diversity (estimated from haplotype frequencies and nucleotide distance between haplotypes; Fig. 1
and Table 1
) was 0·0041 and 0·0018 for regions R and C, respectively. These diversity values are low compared with those calculated for the Spanish population of CTV (also restricted to citrus hosts), which ranged from 0·0352 to 0·1763, depending on the genomic region analysed (Rubio et al., 2001b
). This suggests that the Spanish CLBV population could derive from a single origin and that virus introduction might have occurred recently. The observed low diversity and the finding that CLBV isolates from different host species (sweet orange and clementine) had the same SSCP pattern, and therefore the same predominant haplotype, suggest that host species do not contribute to differentiation of the virus population, as observed with CTV and other plant viruses (García-Arenal et al., 2001
; and our unpublished results).
|
|
At least four factors might account for the low genetic diversity observed: (i) CLBV might have been recently dispersed in infected budwood; (ii) similar selective pressure by different host species has prevented host-driven population changes like those observed in other plant viruses (Rubio et al., 2000
; García-Arenal et al., 2001
); (iii) strong negative selective pressure for amino acid variation; (iv) the apparent absence of a natural vector, which might have prevented population changes induced by the founder effect often associated with the transmission process (dUrso et al., 2000
).
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bracho, M. A., Moya, A. & Barrio, E. (1998). Contribution of Taq polymerase-induced errors to the estimation of RNA virus diversity. Journal of General Virology 79, 2921-2928.[Abstract]
Dolja, V. V. & Carrington, J. C. (1992). Evolution of positive strand RNA viruses. Seminars in Virology 3, 315-326.
Dolja, V. V., Boyko, V. P., Agranovsky, A. A. & Koonin, E. V. (1991). Phylogeny of capsid proteins of rod-shaped and filamentous RNA plant viruses: two families with distinct patterns of sequence and probably structure conservation. Virology 184, 79-86.[Medline]
Domingo, E. & Holland, J. J. (1994). Mutation rates and rapid evolution of RNA viruses. In The Evolutionary Biology of Viruses , pp. 161-184. Edited by S. S. Morse. New York:Raven Press.
dUrso, F., Ayllón, M. A., Rubio, L., Sambade, A., Hermoso de Mendoza, A., Guerri, J. & Moreno, P. (2000). Contribution of uneven distribution of genomic RNA variants of Citrus tristeza virus (CTV) within the plant to changes in the viral population following aphid transmission. Plant Pathology 49, 288-294.
Eckert, K. A. & Kunkel, T. A. (1990). High fidelity by the Thermus aquaticus DNA polymerase. Nucleic Acids Research 18, 3737-3744.
Fraile, A., Malpica, J. M., Aranda, M. A., Rodríguez-Cerezo, E. & García-Arenal, F. (1996). Genetic diversity in tobacco mild green mosaic tobamovirus infecting the wild plant Nicotiana glauca. Virology 223, 148-155.[Medline]
Galipienso, L., Navarro, L., Ballester-Olmos, J. F., Pina, J. A., Moreno, P. & Guerri, J. (2000). Host range and symptomatology of a graft-transmissible pathogen causing bud union crease of citrus on trifoliate rootstocks. Plant Pathology 49, 308-314.
Galipienso, L., Vives, M. C., Moreno, P., Milne, R. G., Navarro, L. & Guerri, J. (2001). Partial characterisation of Citrus leaf blotch virus, a new virus from Nagami kumquat. Archives of Virology 146, 357-368.[Medline]
García-Arenal, F., Fraile, A. & Malpica, J. M. (2001). Variability and genetic structure of plant virus populations. Annual Review of Phytopathology 39, 157-186.[Medline]
Gibbs, M. (1995). The luteovirus supergroup: rampant recombination and persistent partnerships. In Molecular Basis of Virus Evolution , pp. 351-368. Edited by A. J. Gibbs, C. H. Calisher & F. García-Arenal. Cambridge:Cambridge University Press.
Hall, J. S., French, R., Morris, T. J. & Stenger, D. C. (2001). Structure and temporal dynamics of populations within Wheat streak mosaic virus isolates. Journal of Virology 75, 10231-10243.
Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]
Kong, P., Rubio, L., Polek, M. & Falk, B. W. (2000). Population structure and genetic diversity within California Citrus tristeza virus (CTV) isolates. Virus Genes 21, 139-145.[Medline]
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive strand RNA viruses: Implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Medline]
Kumar, S., Tamura, K., Jakobsen, I. B. & Nei, M. (2001). MEGA 2: Molecular Evolutionary Genetics Analysis software. Arizona, USA: Arizona State University.
Lynch, M. & Crease, T. J. (1990). The analysis of population survey data on DNA sequence variation. Molecular Biology and Evolution 7, 377-394.[Abstract]
Nei, M. & Kumar, S. (2000). Molecular Evolution and Phylogenetics. New York: Oxford University Press.
Rodríguez-Cerezo, E., Moya, A. & García-Arenal, F. (1989). Variability and evolution of the plant RNA virus Pepper mild mottle virus. Journal of Virology 63, 2198-2203.
Roossinck, M. J. (1997). Mechanisms of plant virus evolution. Annual Review of Phytopathology 35, 191-209.[Medline]
Rubio, L., Ayllón, M. A., Guerri, J., Pappu, H., Niblett, C. & Moreno, P. (1996). Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of the coat protein gene. Annals of Applied Biology 129, 479-489.
Rubio, L., Soong, J., Kao, J. & Falk, B. W. (1999). Geographic distribution and molecular variation of isolates of three whitefly-borne closteroviruses of cucurbits: Lettuce infectious yellows virus, Cucurbit yellow stunting disorder virus, and Beet pseudo-yellows virus. Phytopathology 89, 707-711.[Medline]
Rubio, L., Guerri, J. & Moreno, P. (2000). Characterization of Citrus tristeza virus isolates by single-strand conformation polymorphism analysis of DNA complementary to their RNA population. In Proceedings of the 14th Conference of the International Organization of Citrus Virologists , pp. 12-17. Edited by R. H. Yokomi, J. V. da Graça & R. F. Lee. Riverside, CA:IOCV.
Rubio, L., Abou-Jawdah, Y., Lin, H. X. & Falk, B. W. (2001a). Geographically distant isolates of the crinivirus Cucurbit yellow stunting disorder virus show very low genetic diversity in the coat protein gene. Journal of General Virology 82, 929-933.
Rubio, L., Ayllón, M. A., Kong, P., Fernández, A., Polek, M., Guerri, J., Moreno, P. & Falk, B. W. (2001b). Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. Journal of Virology 75, 8054-8062.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schneider, W. L. & Roossink, M. J. (2000). Evolutionary related Sindbis-like plant viruses maintain different levels of population diversity in a common host. Journal of Virology 74, 3130-3134.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). Improving the sensitivity of progressive multiple sequence alignment through sequence weighing position-specific gap penalties and weigh matrix choice. Nucleic Acids Research 22, 4673-4680.
Vives, M. C., Galipienso, L., Navarro, L., Moreno, P. & Guerri, J. (2001). The nucleotide sequence and genomic organization of Citrus leaf blotch virus: a candidate type species for a new virus genus. Virology 287, 225-233.[Medline]
Vives, M. C., Galipienso, L., Navarro, L., Moreno, P. & Guerri, J. (2002a). Characterization of two kinds of subgenomic RNAs produced by Citrus leaf blotch virus. Virology 295, 328-336.[Medline]
Vives, M. C., Galipienso, L., Navarro, L., Moreno, P. & Guerri, J. (2002b). Citrus leaf blotch virus (CLBV): A new citrus virus associated with bud union crease of trifoliate rootstocks. In Proceedings of the 15th Conference of the International Organization of Citrus Virologists. Edited by R. G. Milne, N. Duran & J. V. da Graça. Riverside, CA: IOCV (in press).
Received 18 April 2002;
accepted 29 May 2002.
This article has been cited by other articles:
![]() |
P. D. Voth, L. Mairura, B. E. Lockhart, and G. May Phylogeography of Ustilago maydis virus H1 in the USA and Mexico. J. Gen. Virol., November 1, 2006; 87(Pt 11): 3433 - 3441. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Martin, M. L. Garcia, A. Troisi, L. Rubio, G. Legarreta, O. Grau, D. Alioto, P. Moreno, and J. Guerri Genetic variation of populations of Citrus psorosis virus. J. Gen. Virol., October 1, 2006; 87(Pt 10): 3097 - 3102. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |