J Gen Virol Try IJSEM Online
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishihara, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishihara, T.
Agricola
Right arrow Articles by Nishihara, T.
Journal of General Virology (2002), 83, 2601-2606.
© 2002 Society for General Microbiology


Phage

Various morphological aspects of Escherichia coli lysis by two distinct RNA bacteriophages

Tohru Nishihara1

Department of Biochemistry, Kawasaki Medical School, Kurashiki, Japan1

Author for correspondence: Tohru Nishihara. Present address: The West Field Institute, Showa 2-chome, 4-23-1101, Kurashiki City, Okayama 710-0057, Japan. Fax +81 86 421 3409. e-mail tnishihara{at}mf.0038.net


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Transmission electron micrographs of Escherichia coli cells induced by cloned lysis genes from RNA bacteriophages GA (group A-II) and SP (group B-IV) revealed various morphological aspects of intermediates of lysing cells. Cells induced by the SP lysis gene became stretched and also tapered in shape and fragmentation of parts of the cells had also occurred. Cells induced by the GA lysis gene showed many ballooning structures on the cell surfaces and others leaked material through the cell wall. Some balloon-like structures also appeared on the surfaces of cells induced by the cloned lysis gene of RNA phage SP and material also appeared to be leaking through the cell wall in the photographs. The lysing cells observed by transmission electron microscopy showed various morphological aspects of intermediates of the lysing process.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Since the discovery of the small lysis proteins, many studies have been carried out on cell lysis by RNA phages (for reviews see van Duin, 1988Down ; Young, 1992Down ; Young et al., 2000Down ; see also Adhin et al., 1989Down ; Adhin & van Duin, 1989Down ; Groeneveld et al., 1996Down ). The single-stranded RNA bacteriophages lyse their host, Escherichia coli cells, at the end of the infective cycle without using lysozyme. Instead, the phages encode a low-molecular-mass hydrophobic protein that is sufficient to trigger lysis of the host in group A-I,II phages (Kastelein et al., 1982Down ; Coleman et al., 1983Down ) but, in the group B-III phages, it has been shown that the maturation (A2) protein of Q{beta} phage induces E. coli cell lysis by itself (Karnik & Billeter, 1983Down ; Winter & Gold, 1983Down ).

As to the lysis mechanism of the single-stranded small DNA and RNA phages, it has been reported that the A2 (maturation/lysis) protein of RNA phage Q{beta} blocks cell-wall biosynthesis by inhibiting the MurA step and, also, the lysis protein E of phage {phi}X174 (small DNA phage) inhibits cell-wall synthesis by inhibiting the MraY step. Inhibition of the MurA and MraY steps or activity results in the inhibition of cell-wall biosynthesis and results in induction of host-cell lysis (Bernhardt et al., 2000Down , 2001aDown , bDown ; Young et al., 2000Down ).

RNA phages that infect E. coli are classified into groups A and B. RNA phages of group A are divided into subgroups I and II, and those of group B are divided into subgroups III and IV (Furuse et al., 1979Down ; Miyake et al., 1969Down ; Watanabe et al., 1967aDown , bDown ). Among the four groups of RNA coliphages, representatives of groups A-I (f2, MS2, R17, fr) and B-III (Q{beta}) have been studied most intensively (for reviews see van Duin, 1988Down ; Young, 1992Down ). The gene organization of the two phage groups (A-I,II and B-III,IV) is quite similar (Figs 1aDown and 2aDown). The main genes encoding the maturation protein, the coat protein and the replicase {beta}-subunit have similar lengths and are arranged in the same order, but their minor genes are slightly different. In spite of the similarities of gene organization and gene order, the structure and function of the lysis genes are quite different in groups A and B.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1. (a) Map of the genome of RNA phage GA and the plasmid pGAcl-8 carrying the lysis gene. Unshaded areas indicate translated regions. Nucleotide numbers at initiation and termination sites are from Inokuchi et al. (1986). The plasmid and DNA fragments used for the expression of the lysis gene are shown. (b) Growth curves of the constructs described in (a). Strains of E. coli K12 {Delta}H1 {Delta}trp containing the plasmids pGAcl-8 ({circ}), with the insert shown in (a), and pPLc245 ({bullet}) were grown at 28 °C to an OD600 of 0·2. They were then shifted to 42 °C to induce the pL promoter. The turbidity of the culture was measured every 15 min and plotted as a function of time.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2. (a) Map of the genome of RNA phage SP. Unshaded areas indicate translated regions. Nucleotide numbers at initiation and termination sites are from Inokuchi et al. (1988)Down . (b) Plasmids and DNA fragments used for the expression of the A2 gene and the deletion mutants. The upper bar represents the parent insert, and the restriction sites used to construct deletion mutants of the A2 gene are shown. (c) Growth curves of the constructs described in (b). Strains of E. coli K12 {Delta}H1 {Delta}trp containing the plasmids pSPA2-10 ({circ}), pMI-4 ({bullet}), pPv-17 ({blacksquare}) and pHE-3 ({triangleup}) with inserts shown in (b) were grown at 28 °C to an OD600 of 0·2. They were then shifted to 42  °C to induce the pL promoter.

 
The maturation proteins of Q{beta} phage (group B-III) and SP phage (group B-IV) can also be used interchangeably and the maturation protein of SP phage has lysis function (Priano et al., 1995Down ). In this context, the function of the lysis gene of GA phage (group A-II) has remained an assumption until now.

Transmission electron microscopy has shown that local destruction occurs in cells lysed by the cloned lysis gene of MS2 phage and cytoplasmic materials are liberated (Witte et al., 1989). However, direct visualization of lysis of cells by RNA phages or cloned lysis genes by use of the transmission electron microscope has not been carried out intensively. In this communication, I show the results of examination with the transmission electron microscope of lysis of E. coli cells induced by the cloned lysis genes of GA phage (group A-II) and SP phage (group B-IV).


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Bacterial strain, plasmid vector and bacteriophages.
E. coli strain K12 {Delta}H1 {Delta}trp [lacZam, {Delta}bio-uvrB, {Delta}(trpE–A)2, rpsL ({lambda}Nam7, Nam53, cI857, {Delta}H1)] was used in all experiments (Bernard et al., 1979Down ). Plasmid vector pPLc245 was used for cloning and expression (Remaut et al., 1983Down ). RNA phages GA (group A-II) (Inokuchi et al., 1986Down ) and SP (group B-IV) (Inokuchi et al., 1988Down ) were used for isolation of RNAs for RT–PCR.

{blacksquare} Growth conditions.
In all experiments, cells were grown at 28 °C in LB medium (Sambrook et al., 1989Down ) supplemented with streptomycin (25 µg/ml) and ampicillin (50 µg/ml). Cell growth and lysis was monitored by following the OD600. To induce expression of genes under the control of {lambda}pL, the temperature was shifted to 42 °C to allow thermal inactivation of the cI857 repressor molecule.

{blacksquare} Modifications of the vectors.
The expression vector pPLc245 was used for cloning and expression, with slight modifications. For cloning the SP phage, the vector was treated with restriction enzyme NdeI and, after end-filling with T4 DNA polymerase and dNTPs, the resulting blunt ends were combined with T4 DNA ligase and the resulting construct was designated pPLc245-2. For cloning the GA phage, vector pPLc245 was used with slight modifications of the polylinker region with that from pNEB193 (New England Biolabs). A polylinker fragment containing sites for the restriction enzymes AscI and PacI was isolated from pNEB193 with restriction enzymes EcoRI and HindIII and inserted into pPLc245, which had been digested with the same enzyme. The resulting vector was designated pPLc245 (AP).

{blacksquare} Cloning of the SP lysis (A2) gene from SP RNA.
RT–PCR amplification of SP RNA was done according to the protocols provided with the Promega Access RT–PCR system. The forward primer, containing an EcoRI site and positions 41–64 of SP RNA, was 5' GCTGCGAGCTCGTGAATTCACAGAGGAGAATCTATGCCAACCC 3', and the reverse primer, containing a SalI site and positions 1389–1411 of SP RNA, was 5' GCATCGTCGACAGGCCTAAGTTCAACGCTTAACGCGTTGG 3'. The fragment obtained from the RT–PCR was purified with a QIAquick PCR purification kit (Qiagen), digested with EcoRI and SalI and inserted into the EcoRI and SalI sites of the vector pPLc245-2 to give plasmid pSPA2-10 (Fig. 2bUp).

{blacksquare} Construction of deletion mutants of pSPA2-10.
Plasmid pSPA2-10 was digested with restriction enzyme MluI and the resulting large fragment was self-ligated to give pMl-4. pSPA2-10 was also digested with PvuII in the same way to give pPv-17. pSPA2-10 was digested with HpaI and EcoRV and the resulting fragment was self-ligated to give plasmid pHE-3 (Fig. 2bUp).

{blacksquare} Cloning of the GA lysis (L) gene from GA RNA.
RT–PCR amplification of GA RNA was done in the same way as SP RNA amplification. The forward primer, containing an AscI site and positions 1257–1281 of GA RNA, was 5' GTAGGCGCGCCGCTTCACTTAGCGAATGCATTAGCC 3'. The reverse primer, containing a PacI site and positions 2015–2039 of GA RNA, was 5' CGCTTAATTAACTCGATATGAGAGTAGTCGTATCCG 3'. The fragments obtained from the RT–PCR were digested with restriction enzymes AscI and PacI. The resulting fragments were inserted between the AscI and PacI sites of the vector pPLc245 (AP) to give plasmid pGAcl-8 (Fig. 1aUp). Cloned fragments were sequenced to verify their integrity by the dideoxy chain-termination method (Sanger et al., 1977Down ).

{blacksquare} Electron microscopy.
Transmission electron micrographs were taken as follows. Samples were collected by centrifugation after about 15 min of the onset of the lysis of E. coli cells harbouring plasmids and they were washed with phosphate buffer (PB) and fixed overnight at 4 °C by addition of glutaraldehyde to a concentration of 1·5% (w/v). After washing with PB, samples were suspended in PB and embedded in 4% agarose. After post-fixation in 1% (w/v) osmium tetroxide for 60 min at room temperature, the cells were washed with PB and dehydrated with alcohol. Cells were then infiltrated and embedded in Spurr’s low-viscosity resin (Spurr, 1969Down ) and polymerized, cut with a diamond knife on a Reichert-Nissei Ultracut microtome, mounted on copper grids coated with Formvar films and stained with uranyl acetate and lead citrate. Ultrathin sections were examined with a JEM-2000EXII electron microscope (JEOL).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In order to construct expression plasmids for the GA and SP lysis genes, I have hypothesized that the predicted small lysis genes function for lysis in cells infected with GA phage (group A-II) and also that the maturation protein genes (A2) in cells infected with SP phage (group B-IV) work in the same way as in cells infected with the MS2 phage (group A-I) and Q{beta} phage (group B-III).

Construction of an expression plasmid containing the GA lysis genes and their lytic activities
In order to construct an expression plasmid for the GA lysis genes, fragments of the coat protein and lysis protein genes of GA RNA were used for RT–PCR as described in Methods. The coat protein gene was included to give active lysis ability, as in the case of MS2 phage (Kastelein et al., 1982Down ). The results obtained are shown in Fig. 1Up. Upon induction, E. coli cells harbouring plasmid pGAcl-8 started to lyse after 25 min of induction, as expected for phages of group A (Fig. 1bUp).

Construction of an expression plasmid containing the SP lysis gene, its deletion mutants and their lytic activities
In order to construct an expression plasmid for the SP lysis gene, the A2 gene of SP RNA was used for RT–PCR as described in Methods. The results obtained are shown in Fig. 2Up. E. coli cells harbouring plasmid pSPA2-10 lysed upon induction, as expected for phages of group B (Q{beta} phage) (Fig. 2cUp). This is consistent with the result described by Priano et al. (1995)Down . Deletion mutants of pSPA2-10 were constructed in order to assess whether the integrity of the A2 gene was required (Fig. 2bUp). As shown in Fig. 2(c)Up, E. coli cells harbouring deletion-mutant plasmids had no lytic activity. These results are in agreement with the results obtained by others for the Q{beta} A2 gene (group B-III) (Karnik & Billeter, 1983Down ; Winter & Gold, 1983Down ). These results imply that phages of groups B-III and B-IV have similar characteristics with regard to their lysis (maturation protein) genes.

Electron micrographs of lysing cells induced by the GA phage lysis gene
The transmission electron micrographs shown in Fig. 3Down show E. coli cells induced by the lysis gene of RNA phage GA (group A-II). Two typical features were seen in the lysing cells in the photographs: ballooning structures on the surfaces of cells (Fig. 3cDown–hDown) and leaking of material through the cell wall (Fig. 3aDown, bDown). No holes were seen on the surfaces of the lysing cells, but small holes must exist on the cell surface that cannot be seen in the photographs. Many ballooning structures can be observed in the photographs, and the structures could be the outer membrane of the cells, but there was no evidence for this (Fig. 3cDown–hDown). Control cells that had no lysis gene showed no such structures (data not shown). The ballooning structures (Fig. 3cDown, hDown) seemed to be still intact, but the structures shown in Fig. 3(c)Down (upper right) and (d) were ruptured and cell material was released; the ballooning structure was also broken into pieces (Fig. 3gDown). The connected regions between the ballooning structures and the ‘source’ cells had some interesting characteristics. The regions spanned quite wide areas and smeared and flocculated material appeared in most cases. Some smeared flows were also seen in the photographs.



View larger version (167K):
[in this window]
[in a new window]
 
Fig. 3. Transmission electron micrographs of lysed E. coli cells harbouring plasmid pGAcl-8, harvested at about 40 min after induction. Bars, 200 nm.

 
Electron micrographs of lysing cells induced by the SP phage lysis gene
The transmission electron micrographs shown in Fig. 4Down show E. coli cells induced by the lysis gene of RNA phage SP (group B-IV). The two most apparent features are explained below. The first was that the cells became stretched and also tapered in shape, and fragmentation of parts of the cells had also occurred (Fig. 4eDown, fDown). The second feature was leaking of material through the cell wall (Fig. 4aDown–cDown). Some rough cells that were still connected to neighbouring cells were observed in preparations of cells induced by the SP lysis gene (Fig. 4bDown, dDown). These structures could be the same ballooning structures described in cells induced by the GA lysis gene.



View larger version (180K):
[in this window]
[in a new window]
 
Fig. 4. Transmission electron micrographs of lysed E. coli cells harbouring plasmid pSPA2-10, harvested at about 60 min after induction. Bars, 500 nm.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
In studies of the cell-lysis mechanism of small single-stranded phages, it has been reported that the A2 (maturation/lysis) protein of RNA phage Q{beta} blocks cell-wall biosynthesis by inhibiting the MurA step of peptidoglycan biosynthesis and also that the lysis protein E of phage {phi}X174 (small DNA phage) inhibits the synthesis of cell walls by inhibiting the MraY step. Inhibition of the MurA and MraY steps or activity results in the inhibition of cell-wall biosynthesis and in the induction of host-cell lysis (Bernhardt et al., 2000Down , 2001aDown , bDown ); so, action of the lysis proteins of small single-stranded RNA and DNA phages can be explained basically by the same mechanism. Even if the lysis mechanism is basically the same, the target proteins or steps differ between lysis proteins, as in the case of MurA and MraY (Bernhardt et al., 2000Down , 2001aDown , bDown ).

If the inhibition steps of biosynthesis or the mode of action are different, the mode of destruction of the lysing cell could differ as a result. However, morphological aspects of the intermediates of lysing cells as viewed by the transmission electron microscope have not been reported in much detail to date. Witte et al. (1989)Down showed, in the transmission electron micrographs, that local destruction occurred in lysing cells as a result of the cloned lysis gene of MS2 phage (group A-I). Cloning the lysis gene of GA phage (group A-II) was expected to have a very similar effect on E. coli cells. However, the appearance of E. coli cells lysed by the GA lysis gene (Fig. 3Up) was different from those lysed by the MS2 phage, which showed harsh rupture of the host cell (Witte et al., 1989Down ). I think that cells induced by the GA lysis gene might be shown to undergo harsh rupture of the host cells, as with the MS2 phage, if more sections of the electron micrographs were examined.

Many ballooning structures were observed in cells induced by the GA (group A-II) lysis gene (Fig. 3Up), but not so many typical ballooning structures were detected in cells induced by the SP (group B-IV) lysis gene (Fig. 4Up). However, lysed cells harbouring the A2 (maturation/lysis) gene of RNA phage Q{beta} (group B-III) showed a single ballooning structure in the photograph, which was a very rare case isolated only 5 min after the onset of lysis (data not shown). So, in group B, ballooning structures could exist at particular stages in intermediates of lysing cells.

It is hard to distinguish the differences between ballooning and leaking structures. However, ballooning structures have distinct boundaries between the structures and the outside. Leaking structures have vague lines between the leaking materials and the outside (Fig. 3aUp, left; Fig. 3bUp, upper right). The ballooning structures therefore have a wall-like structure outside the internal material. Ballooning structures appeared to be associated with a cell pole or the end of the rod cells in many cases (Fig. 3cUp–fUp), but some structures appeared on the sides of cells (Fig. 3hUp).

Leaking appears to occur in three different ways: direct leaking from the cell wall (Fig. 3aUp, bUp), bursting of the ballooning structure (Fig. 3cUp, upper right) and a combination of these two processes (Fig. 3eUp, fUp). I think that tapering of the cells (Fig. 4eUp, fUp) is not an artefact of thin-sectioning of the cells, because these structures were not found in photographs of cells induced by the GA lysis gene or in non-lysed cells.

Ballooning structures of the outer membrane of E. coli cells have been reported previously in heat-treated cells and in cells induced by the {lambda}S protein gene and the chimeric gene E–L of {phi}X174 and MS2 phages (De Petris, 1967Down ; Rietsch & Bläsi, 1993Down ; Witte et al., 1989Down ). However, the production of ballooning structures from the outer membrane of E. coli cells resulting from RNA phages and cloned RNA phages has not been reported before. The ballooning mechanism was described previously for the E–L chimera gene (Witte et al., 1989Down ).

As a whole, the characteristic features of the lysis of E. coli cells by RNA phages GA (group A-II) and SP (group B-IV) were the presence of stretched cells (Fig. 4Up; SP phage) and the presence of many ballooning structures with GA phage (Fig. 3Up) but not many balloon-like structures with SP phage (Fig. 4Up). I think that the target stages and modes of action of the two lysis proteins would impact on morphological aspects of the intermediates of lysing cells and, as a result, the appearance of lysis would be different.


   Acknowledgments
 
I am grateful to K. Uehira and T. Suda (Electron Microscope Center) for helpful advice and technical support, V. Cowell for careful reading of the manuscript and providing useful comments and T. Iwabuchi for DNA sequencing. RNA phages GA and SP were kindly provided by I. Watanabe and A. Hirashima, Keio University. The expression vector pPLc245 and E. coli K12 {Delta}H1 {Delta}trp were kindly provided by LMBP (Universiteit Gent, Belgium).


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Adhin, M. R. & van Duin, J. (1989). Translational regulation of the lysis gene in RNA bacteriophage fr requires a UUG initiation codon. Molecular & General Genetics 218, 137-142.

Adhin, M. R., Hirashima, A. & van Duin, J. (1989). Nucleotide sequence from the ssRNA bacteriophage JP34 resolves the discrepancy between serological and biophysical classification. Virology 170, 238-242.[Medline]

Bernard, H.-U., Remaut, E., Hershfield, M. V., Das, H. K., Helinski, D. R., Yanofsky, C. & Franklin, N. (1979). Construction of plasmid cloning vehicles that promote gene expression from the bacteriophage lambda pL promoter. Gene 5, 59-76.[Medline]

Bernhardt, T. G., Roof, W. D. & Young, R. (2000). Genetic evidence that the bacteriophage {phi}X174 lysis protein inhibits cell wall synthesis. Proceedings of the National Academy of Sciences, USA 97, 4297-4302.[Abstract/Free Full Text]

Bernhardt, T. G., Struck, D. K. & Young, R. (2001a). The lysis protein E of {phi}X174 is a specific inhibitor of the MraY-catalyzed step in peptidoglycan synthesis. Journal of Biological Chemistry 276, 6093-6097.[Abstract/Free Full Text]

Bernhardt, T. G., Wang, I.-N., Struck, D. K. & Young, R. (2001b). A protein antibiotic in the phage Q{beta} virion: diversity in lysis targets. Science 292, 2326-2329.[Abstract/Free Full Text]

Coleman, J., Inouye, M. & Atkins, J. (1983). Bacteriophage MS2 lysis protein does not require coat protein to mediate cell lysis. Journal of Bacteriology 153, 1098-1100.[Abstract/Free Full Text]

De Petris, S. (1967). Ultrastructure of the cell wall of Escherichia coli and chemical nature of its constituent layers. Journal of Ultrastructure Research 19, 45-83.[Medline]

Furuse, K., Hirashima, A., Harigai, H., Ando, A., Watanabe, K., Kurosawa, K., Inokuchi, Y. & Watanabe, I. (1979). Grouping of RNA coliphages based on analysis of the sizes of their RNAs and proteins. Virology 97, 328-341.[Medline]

Groeneveld, H., Oudot, F. & van Duin, J. (1996). RNA phage KU1 has an insertion of 18 nucleotides in the start codon of its lysis gene. Virology 218, 141-147.[Medline]

Inokuchi, Y., Takahashi, R., Hirose, T., Inayama, S., Jacobson, A. B. & Hirashima, A. (1986). The complete nucleotide sequence of the group II RNA coliphage GA. Journal of Biochemistry 99, 1169-1180.[Abstract/Free Full Text]

Inokuchi, Y., Jacobson, A. B., Hirose, T., Inayama, S. & Hirashima, A. (1988). Analysis of the complete nucleotide sequence of the group IV RNA coliphage SP. Nucleic Acids Research 16, 6205-6221.[Abstract/Free Full Text]

Karnik, S. & Billeter, M. (1983). The lysis function of RNA bacteriophage Q{beta} is mediated by the maturation (A2) protein. EMBO Journal 2, 1521-1526.[Medline]

Kastelein, R. A., Remaut, E., Fiers, W. & van Duin, J. (1982). Lysis gene expression of RNA phage MS2 depends on a frameshift during translation. Nature 276, 35-41.

Miyake, T., Shiba, T., Sakurai, T. & Watanabe, I. (1969). Isolation and properties of two new RNA phages SP and FI. Japanese Journal of Microbiology 13, 375-382.[Medline]

Priano, C., Arora, R., Butke, J. & Mills, D. R. (1995). A complete plasmid-based complementation system for RNA coliphage Q{beta}: three proteins of bacteriophages Q{beta} (group III) and SP (group IV) can be interchanged. Journal of Molecular Biology 249, 283-297.[Medline]

Remaut, E., Stanssens, P. & Fiers, W. (1983). Inducible high level synthesis of mature human fibroblast interferon in Escherichia coli. Nucleic Acids Research 11, 4677-4688.[Abstract/Free Full Text]

Rietsch, A. & Bläsi, U. (1993). Non-specific hole formation in the Escherichia coli inner membrane by {lambda}S proteins is independent of cellular secY and secA functions and of the proportion of membrane acidic phospholipids. FEMS Microbiology Letters 107, 101-105.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463-5467.[Abstract/Free Full Text]

Spurr, A. R. (1969). A low-viscosity epoxy resin embedding medium for electron microscopy. Journal of Ultrastructure Research 26, 31-43.[Medline]

van Duin, J. (1988). Single-stranded RNA bacteriophages. In The Bacteriophages , pp. 117-167. Edited by R. Calendar. New York:Plenum.

Watanabe, I., Miyake, T., Sakurai, T., Shiba, T. & Ohno, T. (1967a). Isolation and grouping of RNA phages. Proceedings of the Japan Academy 43, 204-209.

Watanabe, I., Nishihara, T., Kaneko, H., Sakurai, T. & Osawa, S. (1967b). Group characteristics of RNA phages. Proceedings of the Japan Academy 43, 210-213.

Winter, R. B. & Gold, L. (1983). Overproduction of bacteriophage Q{beta} maturation (A2) protein leads to cell lysis. Cell 33, 877-885.[Medline]

Witte, A., Reisinger, G. R., Saeckl, W., Wanner, G. & Lubitz, W. (1989). Characterization of Escherichia coli lysis using a family of chimeric E–L genes. FEMS Microbiology Letters 164, 159-167.[Medline]

Young, R. (1992). Bacteriophage lysis: mechanism and regulation. Microbiological Reviews 56, 430-481.[Abstract/Free Full Text]

Young, R., Wang, I.-N. & Roof, W. D. (2000). Phages will out: strategies of host cell lysis. Trends in Microbiology 8, 120-128.[Medline]

Received 11 March 2002; accepted 13 June 2002.


This article has been cited by other articles:


Home page
J. Virol.Home page
S. K. Brumfield, A. C. Ortmann, V. Ruigrok, P. Suci, T. Douglas, and M. J. Young
Particle Assembly and Ultrastructural Features Associated with Replication of the Lytic Archaeal Virus Sulfolobus Turreted Icosahedral Virus
J. Virol., June 15, 2009; 83(12): 5964 - 5970.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Nishihara, H. Morisawa, N. Ohta, J. F Atkins, and Y. Nishimura
A cryptic lysis gene near the start of the Q{beta} replicase gene in the +1 frame
Genes Cells, October 1, 2004; 9(10): 877 - 889.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nishihara, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nishihara, T.
Agricola
Right arrow Articles by Nishihara, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS