|
|
||||||||
Animal: DNA Viruses |
Childrens Hospital Medical Center, Division of Infectious Diseases, 3333 Burnet Ave, Cincinnati, OH 45229-3039, USA1
Author for correspondence: Nigel Bourne. Present address: Sealy Center for Vaccine Development, Department of Pediatrics, The University of Texas Medical Branch at Galveston, 301 University Boulevard, Galveston, TX 77555-0436, USA. Fax +1 409 7478150. e-mail nibourne{at}utmb.edu
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
A pool of high-titre antiserum was produced from female Hartley guinea pigs (Charles River Breeding Laboratories, Wilmington, MA, USA) that had recovered from symptomatic primary genital HSV-2 infection. The animals were immunized with HSV-2 antigen prepared from infected Vero cell monolayers, which were harvested, washed and resuspended in PBS. Following freezethawing three times, the lysates were sonicated until all cell debris had been disrupted, then centrifuged to remove particulate matter. The supernatant was aliquoted and stored at -20 °C. Protein concentrations were determined by bicinchoninic acid assay (Pierce). For the first immunization, animals received antigen (
200 µg total protein) and complete Freunds adjuvant into the rear footpads. Subsequent immunizations were given subcutaneously at 4 week intervals with incomplete Freund's adjuvant. Animals were bled weekly beginning 2 weeks after the initial immunization and the serum stored at -20 °C. Prior to use it was thawed, pooled, aliquoted and refrozen. The ELISA antibody titre was determined as previously described (Bernstein & Harrison, 1989
) and defined as the reciprocal of the highest serum dilution producing an absorbance >0·1 and twice that of control antigen. The neutralization titre was assayed by HSV-2 plaque reduction on rabbit kidney (RK) cells (Bernstein et al., 1986
) and defined as the reciprocal of the serum dilution producing a 50% reduction in plaque number compared with naïve serum. The antiserum pool used in these studies had an ELISA titre of 1:32000 and a neutralizing titre of 1:800.
In Study 1 we examined the effect of antiserum treatment on virus replication in the genital tract and the course of primary and recurrent genital HSV-2 disease. Forty-three Hartley guinea pigs were inoculated intravaginally with 5·7 log10 p.f.u. of HSV-2 strain MS as previously described (Stanberry et al., 1982
). Group 1 (As+24; n=15) received 5 ml antiserum per animal by intraperitoneal injection 24 h post-inoculation (p.i.). Group 2 (As+72; n=16) received antiserum 72 h p.i., while Group 3 (n=12) were untreated controls. Vaginal swabs were collected on days 1, 2, 3, 5, 7 and 10 p.i. and stored at -80 °C until virus was quantified by plaque assay on RK cells. Animals were examined daily and primary genital skin disease quantified as previously described (Stanberry et al., 1982
). Following recovery from primary disease, animals were monitored daily from day 15 to 63 p.i. for spontaneous recurrent herpetic lesions on the genital skin (Stanberry et al., 1982
).
Animals that did not develop primary genital skin disease were defined as infected if virus was isolated from vaginal swabs collected within the first 2 days p.i. By this definition 12/12 controls, 14/15 As+24 and 16/16 As+72 animals became infected and were included in the analysis. As+24 treatment profoundly altered the course of genital herpes (Table 1
, Study 1). Both the incidence of primary genital skin disease (P<0·005; Fishers exact test) and, severity in symptomatic animals (P<0·01; ANOVA) were significantly reduced. Furthermore, when spontaneous recurrent disease was examined, As+24 treatment marginally reduced the number of animals that developed recurrences (P=0·08; Fishers exact test) and significantly reduced the number of days on which those animals experienced recurrent lesions (P<0·001 ANOVA). As+72 treatment was less effective, and although the incidence and severity of primary disease were reduced compared with controls, the reductions did not reach significance and the frequency of recurrent genital skin disease was comparable with that seen in controls (Table 1
, Study 1).
|
|
It is reasonable to hypothesize that the dramatic reduction in acute virus replication seen in the DRG of As+24-treated animals would produce a concomitant reduction in the amount of virus returning intraneuronally to replicate in the genital mucosa and so be responsible at least in part for the reduced vaginal virus titres seen in treated animals after day 2 p.i. Furthermore, since primary genital skin disease in the guinea pig model is also thought to be caused by virus returning from the DRG to the periphery (Stanberry et al., 1982
), the reduction in virus replication in the DRG may contribute directly to the reduction in primary disease seen in As+24-treated animals. Support for this hypothesis can be found in ocular HSV challenge studies in mice where the protection against severe ocular damage provided by the administration of antibody is also believed to result from restriction of virus spread from the nervous system back to the periphery (Schimeld et al., 1990
). The enhanced protection against acute disease seen in As+24 compared with As+72 animals appears to result from an early reduction of acute virus replication, since the impact of treatment in the DRG in As+24 and As+72 animals was comparable after day 4 p.i. and vaginal titres were comparable from day 5 p.i.
We and others have shown by quantitative PCR analysis that prophylactic immunization can reduce the magnitude of latent virus DNA in the ganglia of guinea pigs after intravaginal HSV-2 challenge and that this reduction is paralleled by a reduction in recurrent disease (Bourne et al., 1996
; Wachsman et al., 2001
). Thus, the reduced recurrent disease in As+24 animals could be due to a reduction in the amount of latent virus DNA. To explore this possibility, 36 Hartley guinea pigs were inoculated with HSV-2 strain MS and received As+24 (n=12), As+72 (n=12) or were untreated controls (n=12). Vaginal swabs were collected on days 1 and 2 p.i. Animals were examined daily until day 14 p.i. for primary genital skin disease and from days 1542 for recurrent disease. Table 1
, Study 2 shows that the effect of treatment on disease outcome in this study was similar to that in Study 1, As+24 treatment significantly reducing the incidence (P<0·005) and severity (P<0·001) of primary genital skin disease and the incidence (P<0·01) and frequency (P<0·05) of recurrent disease. As+72 treatment again moderated primary genital skin disease with the impact on this occasion reaching significance. However, as in Study 1, delaying treatment until 72 h p.i. resulted in the animals developing recurrent genital skin disease comparable with controls. At the end of the study, the animals were sacrificed and the DRG collected, pooled on dry ice and stored at -80 °C. DNA was extracted from the DRG using a QIAmp DNA extraction system (Qiagen). DNA quality and quantity were evaluated by 35 cycles of PCR amplification of the single-copy guinea pig albumin gene using primers lacabf (5' AGTCCATTTCTTGTCTGTCTCTCT 3') and lacabr (5' CTGGGGAACAAAGTAAGAGTCAAC 3') to give a 500 bp amplimer, which was used to normalize sample DNA quantities. HSV-2 DNA underwent 35 amplification cycles using oligonucleotide primers GHF (5' TGGCGTTCGTGTTGGACAG 3') and GHR (5' GAGGTTTTTCTGGTCGGTC 3') to amplify a 311 bp amplimer within the glycoprotein H (gH) gene (HG52 nt 4510545416). The amplification products were electrophoresed, transferred to nylon membranes (MagnaGraph, Micron Separations Inc.) and hybridized with synthetic digoxigenin-11-ddUTP (Roche Molecular Biochemicals)-end-labelled oligonucleotide probes for gH (5' GAGTTTCTCGGCGGCCGC 3') or albumin (5' CCTATCTTTTCTGCCAGTGTC 3'). The autoradiograms of Southern blots were quantified on a ChemiImager system (Alpha Innotech). Quantification of experimental samples was by extrapolation from the linear region of a standard curve generated by amplification of a dilution series of known HSV-2 DNA genomic equivalents extracted in parallel with the experimental samples. The total DNA load in each sample was normalized by comparison of the albumin copy number in the sample with the albumin gene amplification in a known standard (100 ng) guinea pig DNA. Each PCR reaction was loaded with
100 ng total DNA as determined by the A260.
Fig. 2
shows that As+24 but not As+72 treatment significantly reduced the amount of HSV-2 DNA present in the DRG compared with control animals (P<0·01). These results confirm previous studies in mouse HSV infection models that have shown that passive antibody transfer can reduce latent HSV-2 infection (Klein, 1980
; Morrison et al., 2001
) and extend them by showing that, in guinea pigs, the reduction in latent HSV infection can significantly reduce the frequency of spontaneous recurrent disease. However, our results also indicate that the treatment must occur soon after virus challenge to produce this effect. In As+72 animals, neither the amount of latent virus DNA in the ganglia nor the frequency of recurrent disease were significantly reduced compared with untreated controls. This strongly suggests that, at least in this model, much of the burden of latent virus is established within the first 34 days p.i., possibly even before initial symptoms are seen (genital lesions seldom develop prior to day 4 p.i.). If the same is true in humans, then by the time patients are seen at the onset of symptoms it is already too late for antibody therapy or indeed antivirals to impact on the burden of latent virus. Thus, clinical opportunities for therapy to affect latency would be limited to instances where the early initiation of treatment is possible, for example the post-exposure prophylaxis of rape victims and treatment of newborns at risk of developing neonatal herpes following passage through an infected birth canal.
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bernstein, D. I., Stanberry, L. R., Harrison, C. J., Kappes, J. & Myers, M. G. (1986). Antibody response, recurrence pattern and subsequent herpes simplex virus type 2 (HSV-2) re-infection following initial HSV-2 infection of guinea pigs: effects of acyclovir. Journal of General Virology 67, 1601-1612.
Bourne, N., Stanberry, L. R., Bernstein, D. I. & Lew, D. (1996). DNA immunization against experimental genital herpes simplex virus infection. Journal of Infectious Diseases 173, 800-807.[Medline]
Kavaliotis, J., Loukou, I., Trachana, M., Gombakis, N., Tsargaropoulou-Stigga, H. & Koliouskas, D. (1998). Outbreak of varicella in a pediatric oncology unit. Medical and Pediatric Oncology 31, 166-169.[Medline]
Klein, R. J. (1980). Effect of immune serum on the establishment of herpes simplex virus infection in trigeminal ganglia of hairless mice. Journal of General Virology 49, 401-405.
McKendall, R. R., Klassen, T. & Baringer, J. R. (1979). Host defenses in herpes simplex infections of the nervous system: effect of antibody on disease and viral spread. Infection and Immunity 23, 305-311.
Morrison, L. A., Zhu, L. & Thebeau, L. G. (2001). Vaccine-induced serum immunoglobulin contributes to protection from herpes simplex virus type 2 genital infection in the presence of immune T cells. Journal of Virology 75, 1195-1204.
Oakes, J. E. & Rosemund-Hornbeak, H. (1978). Antibody-mediated recovery from subcutaneous herpes simplex virus type 2 infection. Infection and Immunity 21, 489-495.
Sawyer, L. A. (2000). Antibodies for the prevention and treatment of viral diseases. Antiviral Research 47, 57-77.[Medline]
Shimeld, C. T., Hill, J., Blyth, W. A. & Easty, D. L. (1990). Passive immunization protects the mouse eye from damage after herpes simplex virus infection by limiting spread of virus in the nervous system. Journal of General Virology 71, 681-687.
Snydman, D. R. (1990). Cytomegalovirus immunoglobulins in the prevention and treatment of cytomegalovirus disease. Reviews of Infectious Diseases 12 (Suppl. 7), 839847.
Stanberry, L. R., Kern, E. R., Richards, J. T., Abbott, T. M. & Overall, J. C.Jr (1982). Genital herpes in guinea pigs: pathogenesis of the primary infection and description of recurrent disease. Journal of Infectious Diseases 146, 397-401.[Medline]
Stanberry, L. R., Kern, E. R., Richards, J. T. & Overall, J. C.Jr (1985). Recurrent genital herpes simplex virus infection in guinea pigs. Intervirology 24, 226-231.[Medline]
Stanberry, L. R., Bernstein, D. I., Burke, R. L., Pachl, C. & Myers, M. G. (1987). Recombinant herpes simplex virus glycoprotein vaccine protects against initial and recurrent genital herpes. Journal of Infectious Diseases 155, 397-404.
Wachsman, M., Kulka, M., Smith, C. C. & Aurelian, L. (2001). A growth and latency compromised herpes simplex virus type 2 mutant (ICP10
PK) has prophylactic and therapeutic protective activity in guinea pigs. Vaccine 19, 1879-1890.[Medline]
Walz, M. A., Yamamoto, H. & Notkins, A. L. (1976). Immunologic response restricts number of cells in sensory ganglia infected with herpes simplex virus. Nature 264, 554-556.[Medline]
Zaia, J. A., Levin, M. J., Preblud, S. R., Leszczynski, J., Wright, G. G., Ellis, R. J., Curtis, A. C., Valerio, M. A. & LeGore, J. (1983). Evaluation of varicella-zoster immune globulin: protection of immunosuppressed children after household exposure to varicella. Journal of Infectious Diseases 147, 737-743.[Medline]
Received 25 March 2002;
accepted 16 July 2002.
This article has been cited by other articles:
![]() |
G. N. Milligan, M. G. Meador, C.-F. Chu, C. G. Young, T. L. Martin, and N. Bourne Long-Term Presence of Virus-Specific Plasma Cells in Sensory Ganglia and Spinal Cord following Intravaginal Inoculation of Herpes Simplex Virus Type 2 J. Virol., September 1, 2005; 79(17): 11537 - 11540. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |