J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bourne, N.
Right arrow Articles by Stanberry, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bourne, N.
Right arrow Articles by Stanberry, L. R.
Agricola
Right arrow Articles by Bourne, N.
Right arrow Articles by Stanberry, L. R.
Journal of General Virology (2002), 83, 2797-2801.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Modification of primary and recurrent genital herpes in guinea pigs by passive immunization

Nigel Bourne1, Richard B. Pyles1, David I. Bernstein1 and Lawrence R. Stanberry1

Children’s Hospital Medical Center, Division of Infectious Diseases, 3333 Burnet Ave, Cincinnati, OH 45229-3039, USA1

Author for correspondence: Nigel Bourne. Present address: Sealy Center for Vaccine Development, Department of Pediatrics, The University of Texas Medical Branch at Galveston, 301 University Boulevard, Galveston, TX 77555-0436, USA. Fax +1 409 7478150. e-mail nibourne{at}utmb.edu


   Abstract
TOP
Abstract
Main text
References
 
Guinea pigs were administered antiserum 24 h (As+24) or 72 h (As+72) after intravaginal herpes simplex virus type 2 (HSV-2) challenge. Treatment at either time reduced acute virus replication in the dorsal root ganglia and the overall magnitude of replication in the genital tract. In two studies, As+24 treatment significantly reduced the severity of primary genital skin disease and the frequency of subsequent spontaneous recurrent disease. In contrast, As+72 treatment produced a modest reduction in primary disease severity but did not impact on recurrent disease. Quantitative PCR analysis of dorsal root ganglia DNA from latently infected animals showed that As+24 treatment produced a significantly reduced viral DNA burden, which appeared to correlate with the reduction in recurrent disease. The amount of DNA in the ganglia of As+72-treated animals was not significantly lower than that of controls. These observations have implications for both the dynamics of latency establishment and desirable vaccine characteristics.


   Main text
TOP
Abstract
Main text
References
 
Passive immunization is used clinically against varicella-zoster virus for the prophylaxis of immunocompromised patients who are exposed to the virus (Zaia et al., 1983Down ; Kavaliotis et al., 1998Down ) and against cytomegalovirus for prophylaxis in bone marrow, renal and liver transplants, particularly in situations where the recipient is seronegative and the donor seropositive (Snydman, 1990Down ; Sawyer, 2000Down ). However, it has not been widely studied in humans for use against herpes simplex virus (HSV) infections. In contrast, passive transfer has been, and continues to be, explored in mouse models of HSV infection (eg Walz et al., 1976Down ; McKendall et al., 1979Down ; Morrison et al., 2001Down ). Differences in experimental protocols, e.g. the time of antibody administration relative to the virus inoculum and the challenge route, limit direct comparisons of these studies. However, they have generally shown that if antibody is present at the time of challenge or is administered soon after, acute disease outcome is improved. The results of some studies using explant co-cultivation techniques and more recently quantitative PCR analysis of virus DNA have also shown that passive immunization can reduce latent virus infection (Klein, 1980Down ; Morrison et al., 2001Down ). However, it has not been possible to determine whether the reduction in latent virus load is sufficient to produce an impact on recurrent disease, because mice do not develop spontaneous recurrences. Guinea pigs, unlike mice, experience a quantifiable, self-limiting, primary genital skin disease after intravaginal HSV challenge, which is followed by periodic spontaneous recurrent herpetic lesions on the perineum (Stanberry et al., 1982Down , 1985Down ). This allows the impact of interventional strategies such as vaccines and antivirals on both primary and recurrent disease to be evaluated (Stanberry et al., 1987Down ). Accordingly, in these studies we examined the effect of passive immunization on primary and subsequent recurrent genital herpes in the guinea pig model.

A pool of high-titre antiserum was produced from female Hartley guinea pigs (Charles River Breeding Laboratories, Wilmington, MA, USA) that had recovered from symptomatic primary genital HSV-2 infection. The animals were immunized with HSV-2 antigen prepared from infected Vero cell monolayers, which were harvested, washed and resuspended in PBS. Following freeze–thawing three times, the lysates were sonicated until all cell debris had been disrupted, then centrifuged to remove particulate matter. The supernatant was aliquoted and stored at -20 °C. Protein concentrations were determined by bicinchoninic acid assay (Pierce). For the first immunization, animals received antigen (~200 µg total protein) and complete Freund’s adjuvant into the rear footpads. Subsequent immunizations were given subcutaneously at 4 week intervals with incomplete Freund's adjuvant. Animals were bled weekly beginning 2 weeks after the initial immunization and the serum stored at -20 °C. Prior to use it was thawed, pooled, aliquoted and refrozen. The ELISA antibody titre was determined as previously described (Bernstein & Harrison, 1989Down ) and defined as the reciprocal of the highest serum dilution producing an absorbance >0·1 and twice that of control antigen. The neutralization titre was assayed by HSV-2 plaque reduction on rabbit kidney (RK) cells (Bernstein et al., 1986Down ) and defined as the reciprocal of the serum dilution producing a 50% reduction in plaque number compared with naïve serum. The antiserum pool used in these studies had an ELISA titre of 1:32000 and a neutralizing titre of 1:800.

In Study 1 we examined the effect of antiserum treatment on virus replication in the genital tract and the course of primary and recurrent genital HSV-2 disease. Forty-three Hartley guinea pigs were inoculated intravaginally with 5·7 log10 p.f.u. of HSV-2 strain MS as previously described (Stanberry et al., 1982Down ). Group 1 (As+24; n=15) received 5 ml antiserum per animal by intraperitoneal injection 24 h post-inoculation (p.i.). Group 2 (As+72; n=16) received antiserum 72 h p.i., while Group 3 (n=12) were untreated controls. Vaginal swabs were collected on days 1, 2, 3, 5, 7 and 10 p.i. and stored at -80 °C until virus was quantified by plaque assay on RK cells. Animals were examined daily and primary genital skin disease quantified as previously described (Stanberry et al., 1982Down ). Following recovery from primary disease, animals were monitored daily from day 15 to 63 p.i. for spontaneous recurrent herpetic lesions on the genital skin (Stanberry et al., 1982Down ).

Animals that did not develop primary genital skin disease were defined as infected if virus was isolated from vaginal swabs collected within the first 2 days p.i. By this definition 12/12 controls, 14/15 As+24 and 16/16 As+72 animals became infected and were included in the analysis. As+24 treatment profoundly altered the course of genital herpes (Table 1Down, Study 1). Both the incidence of primary genital skin disease (P<0·005; Fisher’s exact test) and, severity in symptomatic animals (P<0·01; ANOVA) were significantly reduced. Furthermore, when spontaneous recurrent disease was examined, As+24 treatment marginally reduced the number of animals that developed recurrences (P=0·08; Fisher’s exact test) and significantly reduced the number of days on which those animals experienced recurrent lesions (P<0·001 ANOVA). As+72 treatment was less effective, and although the incidence and severity of primary disease were reduced compared with controls, the reductions did not reach significance and the frequency of recurrent genital skin disease was comparable with that seen in controls (Table 1Down, Study 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of passive antibody administration on genital HSV

 
Peak vaginal virus titres were seen on day 2 p.i. and were not reduced by As+24 treatment (Fig. 1Down). However, by day 3 p.i., titres were lower in As+24 animals than in controls and remained lower on days 5 and 7 p.i., resulting in a significant reduction in the overall magnitude of virus replication in the genital tract during the first 10 days p.i. as measured by the area under the curve of the virus titre–day graph (25·3±0·7 for controls vs 19·2±1·9 for As+24; P<0·05). Virus replication in the genital tract was also reduced in As+72 animals on days 5 and 7 p.i. (Fig. 1Down) resulting in a significant reduction in the area under the curve compared with untreated controls (19·7±1·3; P<0·05).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Effect of administration of polyclonal antiserum 24 or 72 h post-intravaginal virus challenge on the course of virus replication in the genital mucosa of guinea pigs.

 
Studies in mice have shown that antiserum treatment reduces acute virus replication in the ganglia innervating the inoculation site (Walz et al., 1976Down ; Oakes & Rosemund-Hornbeak, 1978Down ; Klein, 1980Down ). Accordingly, in a separate study we examined the impact of antiserum on virus replication in the dorsal root ganglia (DRG) during primary infection in guinea pigs. Twenty-four animals were inoculated with HSV-2 strain MS and received As+24 (n=9), As+72 (n=6) or were untreated controls (n=9). On day 3 p.i., three As+24 and three control animals were sacrificed. The DRG from each animal were collected and homogenized on ice. The homogenates were centrifuged for 10 min at 6000 r.p.m. at 4 °C, returned to ice and the supernatant immediately titrated for virus on RK cells. The process was repeated on days 4 and 5 p.i. with the addition of three As+72 animals on each day. The limit of detection of the assay was 1·91 log10 p.f.u./g tissue. Virus was recovered from the supernatants of DRG homogenates in a total of 6/9 control animals on days 3–5 p.i. with mean (±SE) titres of 2·66±0·02 log10 p.f.u./g tissue on day 3, 3·49±0·33 on day 4 and 2·91±0·00 on day 5. In contrast, virus was detected in 0/15 animals that received antiserum 24 or 72 h p.i. during the same period (P<0·001; Fisher’s exact test).

It is reasonable to hypothesize that the dramatic reduction in acute virus replication seen in the DRG of As+24-treated animals would produce a concomitant reduction in the amount of virus returning intraneuronally to replicate in the genital mucosa and so be responsible at least in part for the reduced vaginal virus titres seen in treated animals after day 2 p.i. Furthermore, since primary genital skin disease in the guinea pig model is also thought to be caused by virus returning from the DRG to the periphery (Stanberry et al., 1982Down ), the reduction in virus replication in the DRG may contribute directly to the reduction in primary disease seen in As+24-treated animals. Support for this hypothesis can be found in ocular HSV challenge studies in mice where the protection against severe ocular damage provided by the administration of antibody is also believed to result from restriction of virus spread from the nervous system back to the periphery (Schimeld et al., 1990Down ). The enhanced protection against acute disease seen in As+24 compared with As+72 animals appears to result from an early reduction of acute virus replication, since the impact of treatment in the DRG in As+24 and As+72 animals was comparable after day 4 p.i. and vaginal titres were comparable from day 5 p.i.

We and others have shown by quantitative PCR analysis that prophylactic immunization can reduce the magnitude of latent virus DNA in the ganglia of guinea pigs after intravaginal HSV-2 challenge and that this reduction is paralleled by a reduction in recurrent disease (Bourne et al., 1996Down ; Wachsman et al., 2001Down ). Thus, the reduced recurrent disease in As+24 animals could be due to a reduction in the amount of latent virus DNA. To explore this possibility, 36 Hartley guinea pigs were inoculated with HSV-2 strain MS and received As+24 (n=12), As+72 (n=12) or were untreated controls (n=12). Vaginal swabs were collected on days 1 and 2 p.i. Animals were examined daily until day 14 p.i. for primary genital skin disease and from days 15–42 for recurrent disease. Table 1Up, Study 2 shows that the effect of treatment on disease outcome in this study was similar to that in Study 1, As+24 treatment significantly reducing the incidence (P<0·005) and severity (P<0·001) of primary genital skin disease and the incidence (P<0·01) and frequency (P<0·05) of recurrent disease. As+72 treatment again moderated primary genital skin disease with the impact on this occasion reaching significance. However, as in Study 1, delaying treatment until 72 h p.i. resulted in the animals developing recurrent genital skin disease comparable with controls. At the end of the study, the animals were sacrificed and the DRG collected, pooled on dry ice and stored at -80 °C. DNA was extracted from the DRG using a QIAmp DNA extraction system (Qiagen). DNA quality and quantity were evaluated by 35 cycles of PCR amplification of the single-copy guinea pig albumin gene using primers lacabf (5' AGTCCATTTCTTGTCTGTCTCTCT 3') and lacabr (5' CTGGGGAACAAAGTAAGAGTCAAC 3') to give a 500 bp amplimer, which was used to normalize sample DNA quantities. HSV-2 DNA underwent 35 amplification cycles using oligonucleotide primers GHF (5' TGGCGTTCGTGTTGGACAG 3') and GHR (5' GAGGTTTTTCTGGTCGGTC 3') to amplify a 311 bp amplimer within the glycoprotein H (gH) gene (HG52 nt 45105–45416). The amplification products were electrophoresed, transferred to nylon membranes (MagnaGraph, Micron Separations Inc.) and hybridized with synthetic digoxigenin-11-ddUTP (Roche Molecular Biochemicals)-end-labelled oligonucleotide probes for gH (5' GAGTTTCTCGGCGGCCGC 3') or albumin (5' CCTATCTTTTCTGCCAGTGTC 3'). The autoradiograms of Southern blots were quantified on a ChemiImager system (Alpha Innotech). Quantification of experimental samples was by extrapolation from the linear region of a standard curve generated by amplification of a dilution series of known HSV-2 DNA genomic equivalents extracted in parallel with the experimental samples. The total DNA load in each sample was normalized by comparison of the albumin copy number in the sample with the albumin gene amplification in a known standard (100 ng) guinea pig DNA. Each PCR reaction was loaded with ~100 ng total DNA as determined by the A260.

Fig. 2Down shows that As+24 but not As+72 treatment significantly reduced the amount of HSV-2 DNA present in the DRG compared with control animals (P<0·01). These results confirm previous studies in mouse HSV infection models that have shown that passive antibody transfer can reduce latent HSV-2 infection (Klein, 1980Down ; Morrison et al., 2001Down ) and extend them by showing that, in guinea pigs, the reduction in latent HSV infection can significantly reduce the frequency of spontaneous recurrent disease. However, our results also indicate that the treatment must occur soon after virus challenge to produce this effect. In As+72 animals, neither the amount of latent virus DNA in the ganglia nor the frequency of recurrent disease were significantly reduced compared with untreated controls. This strongly suggests that, at least in this model, much of the burden of latent virus is established within the first 3–4 days p.i., possibly even before initial symptoms are seen (genital lesions seldom develop prior to day 4 p.i.). If the same is true in humans, then by the time patients are seen at the onset of symptoms it is already too late for antibody therapy or indeed antivirals to impact on the burden of latent virus. Thus, clinical opportunities for therapy to affect latency would be limited to instances where the early initiation of treatment is possible, for example the post-exposure prophylaxis of rape victims and treatment of newborns at risk of developing neonatal herpes following passage through an infected birth canal.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 2. Effect of administration of polyclonal antiserum 24 h (As+24) or 72 h (As+72) post-intravaginal virus challenge on the amount of virus DNA detected by quantitative PCR in sacral dorsal root ganglia on day 42 post-inoculation.

 

   Acknowledgments
 
We thank Alisa Reece, Jim Ireland, Frances Childs and Tony Zalar for excellent technical assistance and Toni Cunningham and Tedra Kelly for help in manuscript preparation. Financial support was provided by the National Institute of Health AI-65289 and AI-22667.


   References
TOP
Abstract
Main text
References
 
Bernstein, D. I. & Harrison, C. J. (1989). Effects of the immunomodulating agent R837 on acute and latent herpes simplex virus type 2 infections. Antimicrobial Agents and Chemotherapy 33, 1511-1515.[Abstract/Free Full Text]

Bernstein, D. I., Stanberry, L. R., Harrison, C. J., Kappes, J. & Myers, M. G. (1986). Antibody response, recurrence pattern and subsequent herpes simplex virus type 2 (HSV-2) re-infection following initial HSV-2 infection of guinea pigs: effects of acyclovir. Journal of General Virology 67, 1601-1612.[Abstract/Free Full Text]

Bourne, N., Stanberry, L. R., Bernstein, D. I. & Lew, D. (1996). DNA immunization against experimental genital herpes simplex virus infection. Journal of Infectious Diseases 173, 800-807.[Medline]

Kavaliotis, J., Loukou, I., Trachana, M., Gombakis, N., Tsargaropoulou-Stigga, H. & Koliouskas, D. (1998). Outbreak of varicella in a pediatric oncology unit. Medical and Pediatric Oncology 31, 166-169.[Medline]

Klein, R. J. (1980). Effect of immune serum on the establishment of herpes simplex virus infection in trigeminal ganglia of hairless mice. Journal of General Virology 49, 401-405.[Abstract/Free Full Text]

McKendall, R. R., Klassen, T. & Baringer, J. R. (1979). Host defenses in herpes simplex infections of the nervous system: effect of antibody on disease and viral spread. Infection and Immunity 23, 305-311.[Abstract/Free Full Text]

Morrison, L. A., Zhu, L. & Thebeau, L. G. (2001). Vaccine-induced serum immunoglobulin contributes to protection from herpes simplex virus type 2 genital infection in the presence of immune T cells. Journal of Virology 75, 1195-1204.[Abstract/Free Full Text]

Oakes, J. E. & Rosemund-Hornbeak, H. (1978). Antibody-mediated recovery from subcutaneous herpes simplex virus type 2 infection. Infection and Immunity 21, 489-495.[Abstract/Free Full Text]

Sawyer, L. A. (2000). Antibodies for the prevention and treatment of viral diseases. Antiviral Research 47, 57-77.[Medline]

Shimeld, C. T., Hill, J., Blyth, W. A. & Easty, D. L. (1990). Passive immunization protects the mouse eye from damage after herpes simplex virus infection by limiting spread of virus in the nervous system. Journal of General Virology 71, 681-687.[Abstract/Free Full Text]

Snydman, D. R. (1990). Cytomegalovirus immunoglobulins in the prevention and treatment of cytomegalovirus disease. Reviews of Infectious Diseases 12 (Suppl. 7), 839–847.

Stanberry, L. R., Kern, E. R., Richards, J. T., Abbott, T. M. & Overall, J. C.Jr (1982). Genital herpes in guinea pigs: pathogenesis of the primary infection and description of recurrent disease. Journal of Infectious Diseases 146, 397-401.[Medline]

Stanberry, L. R., Kern, E. R., Richards, J. T. & Overall, J. C.Jr (1985). Recurrent genital herpes simplex virus infection in guinea pigs. Intervirology 24, 226-231.[Medline]

Stanberry, L. R., Bernstein, D. I., Burke, R. L., Pachl, C. & Myers, M. G. (1987). Recombinant herpes simplex virus glycoprotein vaccine protects against initial and recurrent genital herpes. Journal of Infectious Diseases 155, 397-404.

Wachsman, M., Kulka, M., Smith, C. C. & Aurelian, L. (2001). A growth and latency compromised herpes simplex virus type 2 mutant (ICP10{Delta}PK) has prophylactic and therapeutic protective activity in guinea pigs. Vaccine 19, 1879-1890.[Medline]

Walz, M. A., Yamamoto, H. & Notkins, A. L. (1976). Immunologic response restricts number of cells in sensory ganglia infected with herpes simplex virus. Nature 264, 554-556.[Medline]

Zaia, J. A., Levin, M. J., Preblud, S. R., Leszczynski, J., Wright, G. G., Ellis, R. J., Curtis, A. C., Valerio, M. A. & LeGore, J. (1983). Evaluation of varicella-zoster immune globulin: protection of immunosuppressed children after household exposure to varicella. Journal of Infectious Diseases 147, 737-743.[Medline]

Received 25 March 2002; accepted 16 July 2002.


This article has been cited by other articles:


Home page
J. Virol.Home page
G. N. Milligan, M. G. Meador, C.-F. Chu, C. G. Young, T. L. Martin, and N. Bourne
Long-Term Presence of Virus-Specific Plasma Cells in Sensory Ganglia and Spinal Cord following Intravaginal Inoculation of Herpes Simplex Virus Type 2
J. Virol., September 1, 2005; 79(17): 11537 - 11540.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bourne, N.
Right arrow Articles by Stanberry, L. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bourne, N.
Right arrow Articles by Stanberry, L. R.
Agricola
Right arrow Articles by Bourne, N.
Right arrow Articles by Stanberry, L. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS