J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stanton, R.
Right arrow Articles by Wilkinson, G. W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stanton, R.
Right arrow Articles by Wilkinson, G. W. G.
Agricola
Right arrow Articles by Stanton, R.
Right arrow Articles by Wilkinson, G. W. G.
Journal of General Virology (2002), 83, 2811-2820.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Analysis of the human herpesvirus-6 immediate-early 1 protein

Richard Stanton1, Julie D. Fox1, Richard Caswell3, Emma Sherratt2 and Gavin W. G. Wilkinson2

Department of Medical Microbiology1 and Section of Infection and Immunity2, University of Wales College of Medicine, Tenovus Building, Heath Park, Cardiff CF14 4XN, UK
Cardiff School of Biosciences, Cardiff University, Cardiff CF10 3US, UK3

Author for correspondence: Gavin Wilkinson. Fax +44 29 20745003. e-mail WilkinsonGW1{at}cf.ac.uk


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Herpesvirus immediate-early (IE) gene products play key roles in establishing productive infections, regulating reactivation from latency and evading immune recognition. Analyses of HHV-6 IE gene expression have revealed that the IE1 gene of the HHV-6A and HHV-6B variants exhibits a higher degree of sequence variation than other regions of the genome and no obvious similarity to its positional analogue in HCMV. We have analysed expression of the HHV-6 U1102 (HHV-6A) and Z29 (HHV-6B) IE1 gene products using transient expression vectors, stable cell lines and in the context of lytic virus infection. The IE1 transcripts from both variants demonstrate a similar pattern of splice usage within their translated regions. The HHV-6 IE1 proteins from both variants traffic to, and form a stable interaction with, PML-bodies (also known as ND10 or PODS). Remarkably, PML-bodies remained structurally intact and associated with the IE1 protein throughout lytic HHV-6 infection. Immunoprecipitation studies demonstrated that HHV-6 IE1 from both variants is covalently modified by conjugation to the small ubiquitin-like protein SUMO-1. Overexpression of SUMO-1 in cell lines resulted in substantially enhanced levels of IE1 expression; thus sumoylation may bestow stability to the protein. These results indicate that the HHV-6 IE1 protein interacts with PML-bodies yet, unlike other herpesviruses, HHV-6 appears to have no requirement or mechanism to induce PML-body dispersal during lytic replication.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Human herpesvirus-6 (HHV-6) is a betaherpesvirus classified along with human herpesvirus-7 in the Roseolavirus genus. Two distinct variants exist, designated HHV-6A and HHV-6B, that exhibit consistent differences in DNA sequence, reactivity to monoclonal antibodies, cell tropism and disease association (Pellett & Black, 1996Down ). The virus is ubiquitous with up to 95% of adults in industrialized nations being seropositive. Infection commonly occurs by age 3 years and the virus is the causative agent of the childhood disease exanthem subitum (Yamanishi et al., 1988Down ). HHV-6 virus load and antibody titre is frequently elevated in renal allograft patients and reactivation associated with immunosuppression has been correlated with organ rejection. In bone marrow transplant recipients, HHV-6 is associated with rash, graft-versus-host disease, pneumonitis, febrile episodes and suppression of graft outgrowth. Furthermore, HHV-6A has been associated with rapid progression of human immunodeficiency virus (HIV)-related symptoms and both variants have also been linked in some studies with the pathogenesis of multiple sclerosis and chronic fatigue syndrome (Brenmer & Clark, 1999Down ; Caserta et al., 2001Down ).

Concomitant HHV-6 and human cytomegalovirus (HCMV) infections occur frequently in immunosuppressed organ transplant patients (Irving et al., 1990Down ; DesJardin et al., 1998Down ) and, given that they infect overlapping cell types (Kondo et al., 1991Down ; Taylor-Wiedeman et al., 1991Down ), the potential exists for the two viruses to interact directly in vivo. The HHV-6 genome (162–170 kb) is composed of a unique long segment bracketed by direct repeats. The unique long genomic elements of HHV-6 and HCMV are essentially collinear (Neipel et al., 1992Down ), with 67% of HHV-6A (U1102) genes having counterparts in HCMV (Gompels et al., 1995Down ). In common with other herpesviruses, HHV-6 operates a cascade system of gene regulation conventionally divided into the immediate-early (IE), early and late phases. A positional homologue of the HCMV major IE gene (IE1) exists in HHV-6 (within the IE-A region). The HCMV major IE gene interacts with cellular factors (e.g. p107, E2F) and encodes a transcriptional trans-activator that acts synergistically with HCMV IE2 (Lukac et al., 1994Down ). HCMV IE1 is essential for efficient productive infection at low m.o.i. in vitro, but is dispensable at high-input m.o.i. (Mocarski et al., 1996Down ). HCMV IE1 induces the disruption of PML-bodies and causes both IE1 and PML to become associated with mitotic chromatin (Lafemina et al., 1989Down ; Wilkinson et al., 1998Down ). PML-bodies (also known as ND10 or PODs) are punctate structures associated with the nuclear matrix that contain, or transiently associate with, an assortment of cellular proteins including SUMO-1, Sp100, Sp140, CBP, BLM, Daxx, pRB and p53 (Zhong et al., 2000Down ). PML is the defining marker for PML-bodies and is required for the recruitment of other proteins to the domain (Ishov, 1999Down ). PML modification by covalent linkage to SUMO-1 (a small ubiquitin-like molecule) is required for its migration to PML-bodies (Muller et al., 1998Down ). Both HCMV IE1 and IE2 are SUMO-modified and, in the case of IE2, this modification is necessary for its transactivating functions (Muller & Dejean, 1999Down ; Hofmann et al., 2000Down ).

There is no obvious amino acid sequence homology between HCMV IE1 and its positional homologue in HHV-6. Four transcripts are produced from the HHV-6 IE-A region of which only one, designated HHV-6 IE1, is produced under IE conditions (Schiewe et al., 1994Down ; Mirandola et al., 1998Down ). The HHV-6A IE1 transcript is produced from five exons; translation is initiated in exon 3 and encodes an open reading frame (ORF) (2826 bp) predicted to encode a product of 104 kDa (IE1941aa). The designated HHV-6B IE1 ORF is slightly longer (3237 bp) and is predicted to encode a 120 kDa protein (IE11078aa) (Dominguez et al., 1999Down ). Interestingly, the IE-A region is the most variable part of the HHV-6 genome, with ORFs in this region showing only 63% nucleotide identity between HHV-6A and HHV-6B variants as compared with an overall identity for all ORFs of 94% (Isegawa et al., 1999Down ).

The herpesvirus IE genes exhibit extreme sequence variation and have diverse biological properties yet clearly play a pivotal role in both initiating and establishing the lytic phase of the replication cycle. We were intrigued by the elevated level of sequence variation in the IE1 region between the HHV-6 variants and its absolute divergence from its counterpart in HCMV. It is possible that while the sequence of this genetic element may have diverged during the evolution of the betaherpesviruses, many of its functions have been conserved. In this study we therefore sought to analyse the products of the HHV-6A and HHV-6B IE1 genes and, more specifically, to explore their potential interactions with components of PML-bodies.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Cells and viruses.
HHV-6 variant A strain U1102 was kindly provided by U. Gompels (London School of Hygiene and Tropical Medicine, UK), and variant B strain Z29 was provided by D. Clarke (University College London, UK) with permission from P. E. Pellett (Centers for Disease Control and Prevention, Atlanta, Georgia). HHV-6 variants were propagated using Molt 3 cells (strain Z29), JJhan cells (strain U1102) or peripheral blood mononuclear cells (PBMC) (strain U1102) in RPMI (Sigma) supplemented with 10% foetal calf serum and 5mM L-glutamine (Life Technologies). To infect PBMCs, strain U1102-infected JJhan cells were incubated with 83 µg/ml mitomycin C (Sigma) at 37 °C for 20 min. Cells were washed twice in PBS and added to separated peripheral blood cells. Infected PBMC were stimulated with 0·1 units/ml interleukin-2 (Sigma) and 5 µg/ml lectin (Sigma).

DNA transfections were carried out using Polyfect (Qiagen) according to the manufacturer’s standard protocol. U373 cells expressing 6xHis-tagged SUMO-1 (U373-SUMO) were generated by puromycin (Invitrogen) selection following transfection with pIRES-HisSUMO, kindly provided by D. Bailey (Marie Curie Research Institute, Oxted, UK). pZ29-GFP and pU1102-GFP (see below) were transfected into U373 cells and cell lines generated following G418 sulphate selection (2mg/ml; Sigma).

{blacksquare} Plasmid construction.
The HHV-6 IE1 ORFs from strains U1102 (Gompels et al., 1995Down ) and Z29 (Dominguez et al., 1999Down ) were amplified by PCR from genomic DNA and cloned directly as C-terminal GFP fusion constructs in the transient mammalian expression vector pCT-GFP-TOPO (Invitrogen) to generate the plasmids pU1102-GFP and pZ29-GFP. HHV-6 template DNA was extracted from tissue culture preparations of the appropriate virus using a silica slurry method previously described (Boom et al., 1990Down ). For Z29 IE1 the 5' primer was Z29IE-CL (GATAAATTTGAGCATTTTCTTCG) and the 3' primer was A-IECL2 (GCGGTGTCTCAATTTGCATC). For U1102, the 5' primer A-IECL1 (GATAGATTTGAGCATTTTCTACG) and the 3' primer A-IECL2 were utilized. Primers were obtained from Oswel DNA services and HPLC-purified. The PCR conditions involved denaturation at 94 °C for 2 min; 9 cycles of denaturation (94 °C for 30 s), annealing (50 °C for 30 s) and incubation (68 °C for 7 min); a further 19 cycles in which the incubation period increased by 20 s per cycle; and finally incubation at 68 °C for 14 min. 100 pmol of each primer, 200 µM dNTPs (Amersham Biosciences), manufacturer’s buffer containing 1·5 mM MgCl2 and 1 unit Pwo polymerase (Hybaid) were used in a final reaction volume of 50µl. Thermocycling was undertaken in a PTC-100 thermocycler (GRI Ltd). All PCR-generated fragments for cloning were sequenced and constructs that matched the published sequence used for each variant.

A plasmid expressing a nuclear form of GFP was made by amplifying exons 2 and 3 of HCMV IE1 by PCR and inserting the fragment into the EGFP-N1 mammalian expression vector (Clontech) as an N-terminal GFP fusion.

{blacksquare} Construction of a recombinant adenovirus.
The complete HHV-6 IE1 ORF from strain U1102 was amplified using primers RS1 (GGCCGTCGACGCGGTGTCTCAATTTGCATC) and RS2 (GGCCACTAGTACATCTAGGTTTCATCTAGCTA) with the same cycling conditions as for the generation of pU1102-GFP and pZ29-GFP. The DNA sequence of the clone used in expression studies matched the published sequence (Gompels et al., 1995Down ). A replication-deficient adenovirus recombinant (RAdHHV-6) encoding HHV-6-IE1941aa under the control of the HCMV major IE promoter was generated as described previously (Wilkinson et al., 1992Down ).

{blacksquare} Immunohistochemistry.
An anti-HHV-6 IE1-specific polyclonal antibody was generated by intraperitoneal murine immunization with the RAdHHV-6 recombinant as described previously (Tomasec et al., 2000Down ) and diluted 1 in 100 for use in immunofluorescence and Western blots. Monoclonal antibodies to SUMO-1 (Zymed) and PML (Santa Cruz) and rabbit polyclonal antisera specific for PML (MBL) were diluted 1 in 100 for use in immunofluorescence. FITC- and Texas red-conjugated secondary antibodies were obtained from Sigma. Immunofluorescence and Western blotting conditions were performed as described previously (Sambrook & Russell, 2001bDown ). For co-immunofluorescence primary antibodies were mixed and applied together, as were secondary antibodies.

{blacksquare} Immunoprecipitation.
Extracts were made from U373 cell lines by lysing centrifuged intact cells in 500 µl RIPA buffer (0·5%, v/v, NP-40, 0·5%, w/v, sodium deoxycholate, 0·5%, w/v, SDS, 150 mM NaCl, 10 mM Tris pH 7·4, 5 mM EDTA, 2 mM PMSF, 4 mM N-ethylmaleimide). Lysates were cleared by centrifugation at 10000 g (10 min). Rabbit polyclonal anti-GFP (2 µl; Abcam, UK) was added to 500 µl lysate and incubated with mixing overnight at 4 °C. Protein A–agarose (20 µl; Amersham Biosciences) was added for a further 3 h at 4 °C. Precipitated material was recovered by centrifugation (10000 g for 10 min) and washed four times in RIPA buffer. The sample was boiled for 5 min in 1x SDS–PAGE running buffer containing 100 mM DTT and analysed in Western blot experiments (as above) following electrophoresis on a 6% polyacrylamide gel (Sambrook & Russell, 2001aDown ).


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Co-localization of HHV-6 IE1 with PML-bodies
Although two potential in-frame ATG initiation codon sites, 162 bp apart, have been identified in the HHV-6 strain U1102 IE1 sequence, only the upstream site is maintained in both A (U1102) and B (HST and Z29) variant IE1 gene sequences (Schiewe et al., 1994Down ; Gompels et al., 1995Down ; Isegawa et al., 1999Down ; Dominguez et al., 1999Down ); the upstream start site was therefore selected for expression of the strain U1102 IE1 gene. HHV-6 IE1 gene fusions were inserted into mammalian expression vectors both in native form and as GFP-fusion constructs as detailed in the Methods. Splicing of both HHV-6 IE1 variant mRNAs in transient transfections was found to match that previously published (data not shown) (Kondo et al., 2002Down ; Schiewe et al., 1994Down ).

To examine the intracellular distribution of the HHV-6 IE1 gene product in eukaryotic cells, U373 cells were transfected with plasmids expressing GFP-tagged IE1 proteins from both A and B type HHV-6 variants. Proteins from both variant A (IE1941aa-GFP) and B (IE11078aa-GFP) were demonstrated during real-time imaging to traffic to and remain associated with punctate nuclear domains (data not shown). This observation was followed up with immunofluorescence experiments in which the endogenous fluorescence associated with expressed IE1941aa-GFP and IE11078aa-GFP was shown to co-localize with PML (Fig. 1Down). When expressed in isolation, both IE1941aa-GFP and IE11078aa-GFP clearly traffic to and form a stable interaction with the PML-associated nuclear domain. Unlike its positional analogue in HCMV, the HHV-6 IE1 gene product did not obviously perturb the intracellular distribution of PML nor associate with chromatin in cells undergoing mitosis.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1. IE11078aa-GFP (a–d) or IE1941aa-GFP (e–h) co-localizes with PML when transfected into U373 cells. Where indicated, cells were imaged by EGFP autofluorescence (b, f), DAPI (a, e) or by using a PML-specific monoclonal antibody (c, g).

 
Association of HHV-6 IE-1 with SUMO-1
Both of the HCMV major IE proteins (IE1491aa and IE2579aa) have been reported to form a covalent linkage with the small ubiquitin-like protein SUMO-1, an interaction that may play a crucial role in regulating their function (Hofmann et al., 2000Down ; Xu et al., 2001Down ). Consequently, we wished to explore any potential relationship between the HHV-6 IE1 gene products and SUMO-1. In normal cells, SUMO-1 exhibits a diffuse nuclear distribution combined with a concentration at PML-bodies. To facilitate studies, a U373 cell line expressing a myc/his-tagged version of SUMO-1 was generated (U373-SUMO). The U373-SUMO cell line was transfected with the pZ29-GFP and pU1102-GFP constructs and both IE1941aa-GFP and IE11078aa-GFP were observed to co-localize with SUMO-1 (Fig. 2Down). Remarkably, levels of IE1941aa-GFP and IE11078aa-GFP fluorescence were also substantially enhanced in the U373-SUMO cell line. This observation was supported by data from Western blots (Fig. 3Down) in which IE11078aa-GFP levels were substantially greater in the U373-SUMO cell line compared to control U373 cells. Similar results were obtained with the HHV-6 IE1941aa-GFP construct. Levels of the HHV-6 IE1 protein accumulate over time, suggesting that its association with SUMO-1 may be enhancing its stability. Control U373 and U373-SUMO cells transfected with plasmids either expressing GFP alone or expressing a nuclear form of GFP [which has the nuclear localization signal (NLS) from exon 2 of CMV IE1] demonstrated approximately equal levels of GFP-expression in both cell types (Fig. 3Down). Thus the difference in levels of HHV-6 IE1-GFP protein in the two cell types does not appear to be due to the ability of the cells to be transfected, or to differences in levels of expression of transfected DNA. In addition, no association of NLS-tagged GFP with PML was seen by immunofluorescence (data not shown), excluding the possibility that IE1941aa-GFP or IE11078aa-GFP traffic to PML bodies purely as a result of their overexpression.



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 2. IE11078aa-GFP (a–h) or IE1941aa-GFP (i–p) co-localizes with both PML and SUMO-1 in a U373 cell line overexpressing SUMO-1. Where indicated, cells were imaged by EGFP autofluorescence (b, f, j, n), DAPI (a, e, i, m) or by monoclonal antibodies specific for SUMO-1 (g, o) or PML (c, k). IE11078aa-GFP forms large nuclear inclusion bodies in approximately 10% of transfected cells (b, f), as opposed to the normal punctate pattern of staining (see arrowed cell in f). The inclusion bodies remain co-localized with SUMO-1 (e–h). No such inclusion bodies are seen with IE1941aa-GFP, which remains in a nuclear punctate pattern in all cells (j, n). Cells expressing HHV-6 IE1 exhibit more punctate SUMO-1 staining than those not expressing HHV-6IE1 (compare arrowed cells in n and o with cells in the same field which are not expressing IE1941aa-GFP).

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. HHV-6 IE1 is more stable in U373 cells overexpressing SUMO-1 (U373-SUMO) than in the parent cell line (U373). Control transfections with nuclear GFP (lanes 1–2) and GFP expressing plasmids (3–4) demonstrate equal levels of expression in both U373 and U373-SUMO cells at 48 h. IE1-GFP expression (5–8), demonstrating enhanced expression in U373-SUMO cell line compared to U373 cells at 48 h. All samples stained with anti-GFP monoclonal antibody.

 
The intranuclear distribution of IE11078aa-GFP is altered in a subpopulation of transfected U373-SUMO cells, possibly as a consequence of its overexpression. In approximately 10% of cells transfected with pZ29-GFP large intranuclear inclusions (one or two per cell) formed as both SUMO-1 and IE11078aa-GFP accumulated (Fig. 2e–hUp). While PML also associates with intranuclear inclusions induced in IE11078aa-transfected U373-SUMO cells, some PML remains in small punctate domains (Fig. 2a–dUp). The large intranuclear inclusion associated with SUMO-1 could not be detected in cells that did not exhibit IE11078aa expression. Intranuclear inclusions were also not detected in cells transfected with the pU1102-GFP construct. U373-SUMO cells expressing IE1941aa-GFP exhibited only punctate staining while still co-localizing with PML and SUMO-1 (Fig. 2i–pUp). SUMO-1 is clearly more strongly associated with a punctate nuclear structure in cells expressing either IE1941aa-GFP or IE11078aa-GFP (Fig. 2nUp, oUp, arrowed).

HHV-6 IE1 is SUMO-1-modified
To detect expression of the HHV-6 IE1 gene product, an antibody specific for GFP was used in Western blot experiments. Two discrete protein species with estimated molecular masses of approximately 235 and 260 kDa were detected in cells transfected with pZ29-GFP (Fig. 3Up.). These values are significantly larger than the 147·5 kDa predicted size of the fusion protein (IE11078aa is estimated at 121·5 kDa and GFP at 27 kDa). Interestingly, the HCMV major IE protein also migrates anomalously on SDS–PAGE suggesting a significantly higher apparent molecular mass than that predicted from its sequence. The presence of a second higher molecular mass species detected in Western blot experiments would be consistent with HHV-6 IE1 being covalently conjugated to SUMO-1.

To further investigate expression of HHV-6 IE1, the gene derived from strain U1102 was inserted into a replication-deficient adenovirus vector. Mice were immunized with the adenovirus recombinant (RAdHHV-6) to generate limited amounts of HHV-6 IE1-specific polyclonal antibodies. Co-immunofluorescence using the murine antibody demonstrated that the native form of the HHV-6 IE941aa co-localized with PML-bodies when expressed following infection with RAdHHV-6IE1 (Fig. 4aDown). No cross-reactivity of either secondary antibody with the incorrect primary antibody was seen, nor was any staining observed on the green channel when the same immunofluorescence was carried out on cells infected with empty adenovirus vector (data not shown). Cell extracts prepared from U373 cells infected with RAdHHV-6IE1 were analysed by Western blot using the HHV-6 IE1-specific polyclonal antibody. A major protein species with an estimated molecular mass of around 160 kDa was identified (by SDS–PAGE) (Fig. 4bDown); thus the native protein also migrates with an anomalous mobility. Although only a single predominant species was clearly identifiable for the native form of the protein, this does not exclude SUMO-modification since the gross overexpression of the protein from the adenovirus recombinant has the potential to overwhelm sumoylation pathways and mask detection of low abundance SUMO-modified species on Western blots.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4. Expression of native IE1941aa from a replication-deficient adenovirus. Immunofluorescence (a) stained with a mouse polyclonal antibody to HHV-6 IE1 and rabbit antibody to PML and Western blot (b) stained with mouse polyclonal antibody to HHV-6 IE1. Track 1: empty adenovirus vector. Track 2: Rad HHV6, m.o.i.=100.

 
Continuous cell lines stably expressing IE1941aa-GFP and IE11078aa-GFP were generated and an anti-GFP rabbit polyclonal antiserum was used to purify the GFP-fusion protein by immunoprecipitation. When analysed by Western blot, the fastest migrating IE1941aa-GFP and IE11078aa-GFP species reacted only with the GFP-specific antibody (Fig. 5Down). These same bands also reacted with the HHV-6 IE1-specific antibody (data not shown). Two co-migrating species reacted with the SUMO-1-specific monoclonal antibody. The sizes of these additional protein species would be consistent with IE1941aa-GFP and IE11078aa-GFP being covalently conjugated with one and two SUMO-1 molecules (arrowed). A third slower-migrating species is strongly labelled with the SUMO-1-specific antibody but only weakly with the anti-GFP antibody. It was therefore concluded that the HHV-6 U1102- and Z29-variant IE1 proteins are subjected to covalent linkage with SUMO-1.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5. Immunoprecipitation of IE11078aa-GFP (lane 2 and 3) and IE1941aa-GFP (lane 5 and 6) with anti-GFP show three bands staining with anti-GFP antibody (lanes 3 and 5). The upper two bands and a possible third band (arrowed) co-stain with antibody to SUMO-1 (lanes 2 and 6). Untransfected control stained for SUMO-1 (lane 1) or GFP (lane 4).

 
The fate of PML-bodies during productive HHV-6 infection
In transient DNA transfection, HHV-6 IE1 migrates to PML-bodies without exerting any obvious effect on their integrity. We wished to investigate the fate of both the HHV-6 IE gene product and PML-bodies during productive HHV-6 infection. HHV-6 exhibits restricted tropism and growth properties in vitro. To analyse HHV-6 during the lytic cycle, co-immunofluorescence assays were performed on cells infected with both HHV-6A U1102 (grown in PBMC and JJhan cells) and HHV-6B Z29 (grown in Molt 3 cells) using the murine polyclonal anti-IE1 antibody and the rabbit anti-PML antibody. Both HHV-6 U1102 and Z29 IE1 gene products exhibited a punctate nuclear distribution and co-localized with PML-bodies (Fig. 6Down). In both HHV-6 variants, on average three nuclear domains per cell were immunolabelled, although the actual number per cell ranged from two to five. The disruption of PML-bodies is a common feature of herpesvirus infection; thus their persistence during lytic infection was unexpected. To address this issue directly, a further co-immunofluorescence experiment was undertaken with an antibody known to be specific for a late HHV-6 antigen (Fox et al., 1990Down ). Even in cells expressing HHV-6 late antigen, we were unable to detect any obvious effect on the integrity of PML-bodies for HHV-6A in PBMC or HHV-6A and HHV-6B in continuous T cell lines (Fig. 7Down). Thus productive HHV-6 infection does not promote the destruction of PML-associated nuclear domains.



View larger version (144K):
[in this window]
[in a new window]
 
Fig. 6. HHV-6 IE1 co-localizes with PML in infected cells. HHV-6 Z29-infected Molt 3 cells (a–d), U1102-infected JJhan cells (e–h) and U1102-infected PBMC (i–l).

 


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 7. HHV-6 does not disrupt PODs even at late times of the infectious life-cycle. Z29-infected Molt 3 cells (a–d), U1102-infected JJhan cells (e–h) and U1102-infected PBMC (i–l) co-stained for PML and HHV-6 late antigen.

 

   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
The HHV-6 IE1 gene product was demonstrated to be a nuclear protein that associates with PML-bodies without compromising their integrity and to be post-translationally modified by conjugation to SUMO-1. The IE1 genes of HHV-6A strain U1102 and HHV-6B strain Z29 exhibit a substantially higher level of sequence divergence than other HHV-6 genes and therefore both genes were studied in parallel. Both HHV-6 IE1 proteins were observed to migrate anomalously when analysed by SDS–PAGE, indicating significantly higher molecular masses than predicted from their sequence. The strain U1102 IE1 gene product is predicted to encode a 104 kDa product but the protein expressed using an adenovirus vector migrates with an apparent size of 160 kDa. The HCMV IE1 gene product also migrates anomalously, a property associated with the presence of a large C-terminal acidic domain (Wilkinson et al., 1998Down ). Although the strain Z29 IE11078aa protein exhibited a tendency to form large intracellular aggregates when expressed in the U373-SUMO cell line, no clear biological differences were observed in assays performed with the two constructs.

PML-bodies have been implicated in a wide range of cellular processes including transcriptional control, chromatin remodelling, apoptosis, cellular transformation and immune regulation. PML expression is stimulated by treatment with interferon and its enhanced association with its nuclear domain may act as a barrier to virus infection (Bonilla et al., 2002Down ). Following infection, the HCMV genome traffics to PML-bodies and this is the site at which virus transcription and DNA replication are established (Ishov & Maul, 1996Down ; Maul et al., 1996Down ; Ahn et al., 1999Down ). Expression of the HCMV IE1 gene product promotes the disruption of PML-bodies, causing the PML protein to be dispersed throughout the nucleus and to associate with mitotic chromatin. It is not clear why DNA virus genomes are deposited at PML-bodies nor why viruses encode genes that compromise their integrity. Herpes simplex virus 1 ICP0 promotes both the dissolution of PML-bodies and the degradation of PML, Epstein–Barr virus BZLF1 promotes the nuclear dispersal of PML without its degradation and the adenovirus E4 ORF3 induces the formation of thread-like PML-structures (Adamson & Kenney, 2001Down ; Everett & Maul, 1994Down ; Carvalho et al., 1995Down ). HHV-6 IE1 is clearly functionally distinct from its positional analogue in HCMV in leaving PML-bodies superficially intact. Additionally, PML-bodies remain superficially intact in JJhan or Molt 3 lymphocytic cell lines and in PBMC cultures infected with either the HHV-6A or HHV-6B variant. HHV-6 infection is remarkable for not promoting the disruption or destruction of these nuclear domains.

In addition to PML, a large number of cellular proteins have been reported to either transiently or stably associate with PML-bodies, including p53, Rb, CBP, Daxx, Bax and SP100 (Zhong et al., 2000Down ). Furthermore, a significant number of viral proteins traffic to PML-bodies without perturbing their integrity, e.g. HCMV IE2, EBV EBNA-5, HHV-8 K8, simian virus 40 T Ag, bovine papillomavirus E2, L1 and L2 (Ahn & Hayward, 1997Down ; Katano et al., 2001Down ; Murges et al., 2001Down ; Szekely et al., 1996Down ; Day et al., 1998Down ; Jiang et al., 1996Down ; Bonilla et al., 2002Down ). Currently, the HHV-6 IE gene product has not been assigned any specific function. However, the strong association revealed by immunohistochemistry and real-time imaging suggests that HHV-6 IE1 may act by affecting the function of PML-bodies. HHV-6 IE1 clearly has the potential to modify components, regulate the composition, or influence trafficking to and from PML-bodies without inducing a morphological change.

SUMO-1 is conjugated to proteins by a thioester bond formed between the C terminus of SUMO-1 and a lysine residue in the targeted protein. Unlike ubiqitination, which targets proteins for degradation, modification by SUMO-1 can have a variety of different effects. Most significantly, SUMO-1 modification of the PML protein is necessary for its localization to PML-bodies and the trans-activating function of HCMV IE2 (Hofmann et al., 2000Down ; Rodriguez et al., 1999Down ). We observed that expression of the HHV-6 IE1-GFP fusion protein, but not GFP alone, was substantially enhanced in a U373-SUMO-1 cell line. It is therefore likely that sumoylation is required to stabilize the expressed HHV-6 IE1 gene product. This situation would not be unique; SUMO-1-modified I{kappa}B{alpha} and Mdm2 are resistant to ubiquitin-mediated degradation (Desterro et al., 1998Down ). Herpesvirus IE proteins are associated with establishment of a cellular environment compatible with the lytic phase of infection. SUMO-1 modification can be induced in response to stress. The heat-shock transcription factors 1 and 2 (HSF1 and HSF2) are both converted to their DNA-binding form by SUMO-1 modification in response to stress (Hong et al., 2001Down ), while DNA damage induces SUMO-modification of topoisomerase I and II (Goodson et al., 2001Down ; Mao et al., 2000Down ). It is possible that in both HCMV and HHV-6 infections the transition from latent to the lytic replication cycle may be promoted by the SUMO-1 modification of IE gene products. Sumoylation pathways may play an important role in determining the fate of betaherpesvirus infections.

On analysing the level of sumoylation of the HHV-6 IE protein three slower-migrating species were identified that would be consistent with the protein containing three sumoylation sites. This degree of sumoylation would be unusual, although PML has been demonstrated to have three SUMO-modification sites. However, analysis of the IE1 gene sequence revealed only a single consensus sequence for SUMO-1 modification (I/LKXE) in both U1102 and Z29 IE1 sequences at amino acids 665 and 802 respectively. Further cryptic sites may yet be present. Alternatively, conjugation with a single SUMO-1 molecule could potentially facilitate a second SUMO-1-independent modification resulting in reduced mobility, e.g. ubiquitination. Further analysis of the protein is required to determine the number of SUMO-1-modification sites it contains.


   Acknowledgments
 
Note added in proof. Since submission of this article, the following related paper has been published which describes the behaviour of the HHV-6 variant B IE1 protein in transient transfection and lytic virus infection: Gravel et al., Human herpesvirus 6 immediate-early 1 protein is a sumoylated nuclear phosphoprotein colocalizing with promyelocytic leukaemia protein-associated nuclear bodies. Journal of Biological Chemistry 277, 19679–19687, 2002.

The authors thank both Carole Rickards and Lynne Neale for their assistance throughout this work and Daniel Bailey for generously providing the plasmid pIRES-HisSUMO and for helpful discussions. G.W. was supported by funding from the Wellcome Trust.


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Adamson, A. L. & Kenney, S. (2001). Epstein–Barr virus immediate-early protein BZLF1 is SUMO-1 modified and disrupts promyelocytic leukemia bodies. Journal of Virology 75, 2388-2399.[Abstract/Free Full Text]

Ahn, J. H. & Hayward, G. S. (1997). The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells. Journal of Virology 71, 4599-4613.[Abstract]

Ahn, J. H., Jang, W. J. & Hayward, G. S. (1999). The human cytomegalovirus IE2 and UL112–113 proteins accumulate in viral DNA replication compartments that initiate from the periphery of promyelocytic leukemia protein-associated nuclear bodies (PODs or ND10). Journal of Virology 73, 10458-10471.[Abstract/Free Full Text]

Bonilla, W. V., Pinschewer, D. D., Klenerman, P., Rousson, V., Gaboli, M., Pandolfi, P. P., Zinkernagel, R. M., Salvato, M. S. & Hengartner, H. (2002). Effects of promyelocytic leukemia protein on virus–host balance. Journal of Virology 76, 3810-3818.[Abstract/Free Full Text]

Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M. & van der Noordaa, J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.[Abstract/Free Full Text]

Brenmer, J. A. G. & Clark, D. A. (1999). The clinical implications of human herpesvirus-6 infection. Reviews in Medical Microbiology 10, 11-18.

Carvalho, T., Seeler, J. S., Ohman, K., Jordan, P., Pettersson, U., Akusjarvi, G., Carmo-Fonseca, M. & Dejean, A. (1995). Targeting of adenovirus E1A and E4-ORF3 proteins to nuclear matrix-associated PML bodies. Journal of Cell Biology 131, 45-56.[Abstract/Free Full Text]

Caserta, M. T., Mock, D. J. & Dewhurst, S. (2001). Human herpesvirus-6. Clinical Infectious Diseases 33, 829-833.[Medline]

Day, P. M., Roden, R. B., Lowy, D. R. & Schiller, J. T. (1998). The papillomavirus minor capsid protein, L2, induces localization of the major capsid protein, L1, and the viral transcription/replication protein, E2, to PML oncogenic domains. Journal of Virology 72, 142-150.[Abstract/Free Full Text]

DesJardin, J. A., Gibbons, L., Cho, E., Supran, S. E., Falagas, M. E., Werner, B. G. & Snydman, D. R. (1998). Human herpesvirus-6 reactivation is associated with cytomegalovirus infection and syndromes in kidney transplant recipients at risk for primary cytomegalovirus infection. Journal of Infectious Diseases 178, 1783-1786.[Medline]

Desterro, J. M., Rodriguez, M. S. & Hay, R. T. (1998). SUMO-1 modification of I{kappa}B{alpha} inhibits NF-{kappa}B activation. Molecular Cell 2, 233-239.[Medline]

Dominguez, G., Dambaugh, T. R., Stamey, F. R., Dewhurst, S., Inoue, N. & Pellett, P. E. (1999). Human herpesvirus-6B genome sequence: coding content and comparison with human herpesvirus-6A. Journal of Virology 73, 8040-8052.[Abstract/Free Full Text]

Everett, R. D. & Maul, G. G. (1994). HSV-1 IE protein Vmw110 causes redistribution of PML. EMBO Journal 13, 5062-5069.[Medline]

Fox, J. D., Briggs, M., Ward, P. A. & Tedder, R. S. (1990). Human herpesvirus-6 in salivary glands. Lancet 336, 590-593.[Medline]

Gompels, U. A., Nicholas, J., Lawrence, G., Jones, M., Thomson, B. J., Martin, M. E. D., Efstathiou, S., Craxton, M. & Macaulay, H. A. (1995). The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209, 29-51.[Medline]

Goodson, M. L., Hong, Y., Rogers, R., Matunis, M. J., Park-Sarge, O. K. & Sarge, K. D. (2001). Sumo-1 modification regulates the DNA binding activity of heat shock transcription factor 2, a promyelocytic leukemia nuclear body-associated transcription factor. Journal of Biological Chemistry 276, 18513-18518.[Abstract/Free Full Text]

Hofmann, H., Floss, S. & Stamminger, T. (2000). Covalent modification of the transactivator protein IE2-p86 of human cytomegalovirus by conjugation to the ubiquitin-homologous proteins SUMO-1 and hSMT3b. Journal of Virology 74, 2510-2524.[Abstract/Free Full Text]

Hong, Y., Rogers, R., Matunis, M. J., Mayhew, C. N., Goodson, M., Park-Sarge, O. K. & Sarge, K. D. (2001). Regulation of heat shock transcription factor 1 by stress-induced SUMO-1 modification. Journal of Biological Chemistry 276, 40263-40267.[Abstract/Free Full Text]

Irving, W. L., Ratnamohan, V. M., Hueston, L. C., Chapman, J. R. & Cunningham, A. L. (1990). Dual antibody rises to cytomegalovirus and human herpesvirus type 6: frequency of occurrence in CMV infections and evidence for genuine reactivity to both viruses. Journal of Infectious Diseases 161, 910-916.[Medline]

Isegawa, Y., Mukai, T., Nakano, K., Kagawa, M., Chen, J., Mori, Y., Sunagawa, T., Kawanishi, K., Sashihara, J., Hata, A., Zou, P., Kosuge, H. & Yamanishi, K. (1999). Comparison of the complete DNA sequences of human herpesvirus-6 variants A and B. Journal of Virology 73, 8053-8063.[Abstract/Free Full Text]

Ishov, A. M. (1999). PML is critical for ND10 formation and recruits the PML-interacting protein Daxx to this structure when modified by SUMO-1. Journal of Cell Biology 147, 221-234.[Abstract/Free Full Text]

Ishov, A. M. & Maul, G. G. (1996). The periphery of nuclear domain 10 (ND10) as a site of DNA virus deposition. Journal of Cell Biology 134, 815-826.[Abstract/Free Full Text]

Jiang, W. Q., Szekely, L., Klein, G. & Ringertz, N. (1996). Intranuclear redistribution of SV40T, p53, and PML in a conditionally SV40T-immortalized cell line. Experimental Cell Research 229, 289-300.[Medline]

Katano, H., Ogawa-Goto, K., Hasegawa, H., Kurata, T. & Sata, T. (2001). Human-herpesvirus-8-encoded K8 protein colocalizes with the promyelocytic leukemia protein (PML) bodies and recruits p53 to the PML bodies. Virology 286, 446-455.[Medline]

Kondo, K., Kondo, T., Okuno, T., Takahashi, M. & Yamanishi, K. (1991). Latent human herpesvirus-6 infection of human monocytes/macrophages. Journal of General Virology 72, 1401-1408.[Abstract/Free Full Text]

Kondo, K., Shimada, K., Sashihara, J., Tanaka-Taya, K. & Yamanishi, K. (2002). Identification of human herpesvirus-6 latency-associated transcripts. Journal of Virology 76, 4145-4151.[Abstract/Free Full Text]

Lafemina, R. L., Pizzorno, M. C., Mosca, J. D. & Hayward, G. S. (1989). Expression of the acidic nuclear immediate-early protein (IE1) of human cytomegalovirus in stable cell lines and its preferential association with metaphase chromosomes. Virology 172, 584-600.[Medline]

Lukac, D. M., Manuppello, J. R. & Alwine, J. C. (1994). Transcriptional activation by the human cytomegalovirus immediate-early proteins: requirements for simple promoter structures and interactions with multiple components of the transcription complex. Journal of Virology 68, 5184-5193.[Abstract/Free Full Text]

Mao, Y., Desai, S. D. & Liu, L. F. (2000). SUMO-1 conjugation to human DNA topoisomerase II isozymes. Journal of Biological Chemistry 275, 26066-26073.[Abstract/Free Full Text]

Maul, G. G., Ishov, A. M. & Everett, R. D. (1996). Nuclear domain 10 as pre-existing potential replication start sites of herpes simplex virus type-1. Virology 217, 67-75.[Medline]

Mirandola, P., Menegazzi, P., Merighi, S., Ravaioli, T., Cassai, E. & DiLuca, D. (1998). Temporal mapping of transcripts in herpesvirus 6 variants. Journal of Virology 72, 3837-3844.[Abstract/Free Full Text]

Mocarski, E. S., Kemble, G. W., Lyle, J. M. & Greaves, R. F. (1996). A deletion mutant in the human cytomegalovirus encoding IE1 is replication defective due to a failure in autoregulation. Proceedings of the National Academy of Sciences, USA 93, 11321-11326.[Abstract/Free Full Text]

Muller, S. & Dejean, A. (1999). Viral immediate-early proteins abrogate the modification by SUMO-1 of PML and Sp100 proteins, correlating with nuclear body disruption. Journal of Virology 73, 5137-5143.[Abstract/Free Full Text]

Muller, S., Matunis, M. J. & Dejean, A. (1998). Conjugation with the ubiquitin-related modifier SUMO-1 regulates the partitioning of PML within the nucleus. EMBO Journal 17, 61-70.[Medline]

Murges, D., Quadt, I., Schroer, J. & Knebel-Morsdorf, D. (2001). Dynamic nuclear localization of the baculovirus proteins IE2 and PE38 during the infection cycle: the promyelocytic leukemia protein colocalizes with IE2. Experimental Cell Research 264, 219-232.[Medline]

Neipel, F., Ellinger, K. & Fleckenstein, B. (1992). The unique region of the human herpesvirus-6 genome is essentially collinear with the UL segment of human cytomegalovirus. Journal of General Virology 72, 2293-2297.[Abstract/Free Full Text]

Pellett, P. E. & Black, J. B. (1996). Human herpesvirus 6. In Fields Virology , pp. 2587-2608. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:Lippincott–Raven.

Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P. & Hay, R. T. (1999). SUMO-1 modification activates the transcriptional response of p53. EMBO Journal 18, 6455-6461.[Medline]

Sambrook, J. & Russell, D. (2001a). Agarose gel electrophoresis. In Molecular Cloning: a Laboratory Manual, 3rd edn, pp. 5.4–5.13. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sambrook, J. & Russell, D. (2001b). Commonly used techniques in molecular cloning. In Molecular Cloning: a Laboratory Manual, 3rd edn, pp. A8.40–A8.51. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schiewe, U., Neipel, F., Schreiner, D. & Fleckenstein, B. (1994). Structure and transcription of an immediate-early region in the human herpesvirus-6 genome. Journal of Virology 68, 2978-2985.[Abstract/Free Full Text]

Szekely, L., Pokrovskaja, K., Jiang, W. Q., de The, H., Ringertz, N. & Klein, G. (1996). The Epstein–Barr virus-encoded nuclear antigen EBNA-5 accumulates in PML-containing bodies. Journal of Virology 70, 2562-2568.[Abstract]

Taylor-Wiedeman, J., Sissons, J. G. P., Borysiewicz, L. K. & Sinclair, J. H. (1991). Monocytes are a major site of persistence of human cytomegalovirus in peripheral blood mononuclear cells. Journal of General Virology 72, 2059-2064.[Abstract/Free Full Text]

Tomasec, P., Braud, V. M., Rickards, C., Powell, M. B., McSharry, B. P., Gadola, S., Cerundolo, V., Borysiewicz, L. K., McMichael, A. J. & Wilkinson, G. W. (2000). Surface expression of HLA-E, an inhibitor of natural killer cells, enhanced by human cytomegalovirus gpUL40. Science 287, 1031.[Abstract/Free Full Text]

Wilkinson, G. W. & Akrigg, A. (1992). Constitutive and enhanced expression from the CMV major IE promoter in a defective adenovirus vector. Nucleic Acids Research 20, 2233-2239.[Abstract/Free Full Text]

Wilkinson, G. W., Kelly, C., Sinclair, J. H. & Rickards, C. (1998). Disruption of PML-associated nuclear bodies mediated by the human cytomegalovirus major immediate early gene product. Journal of General Virology 79, 1233-1245.[Abstract]

Xu, Y., Ahn, J. H., Cheng, M., apRhys, C. M., Chiou, C. J., Zong, J., Matunis, M. J. & Hayward, G. S. (2001). Proteasome-independent disruption of PML oncogenic domains (PODs), but not covalent modification by SUMO-1, is required for human cytomegalovirus immediate-early protein IE1 to inhibit PML-mediated transcriptional repression. Journal of Virology 75, 10683-10695.[Abstract/Free Full Text]

Yamanishi, K., Okuno, T., Shiraki, K., Takahashi, M., Kondo, T., Asano, Y. & Kurata, T. (1988). Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet i, 1065–1067.

Zhong, S., Salomoni, P. & Pandolfi, P. P. (2000). The transcriptional role of PML and the nuclear body. Nature Cell Biology 2, 85-90.

Received 17 April 2002; accepted 17 July 2002.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
E. Kofod-Olsen, K. Ross-Hansen, J. G. Mikkelsen, and P. Hollsberg
Human herpesvirus 6B U19 protein is a PML-regulated transcriptional activator that localizes to nuclear foci in a PML-independent manner
J. Gen. Virol., January 1, 2008; 89(1): 106 - 116.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Tomoiu, A. Gravel, R. M. Tanguay, and L. Flamand
Functional Interaction between Human Herpesvirus 6 Immediate-Early 2 Protein and Ubiquitin-Conjugating Enzyme 9 in the Absence of Sumoylation.
J. Virol., October 1, 2006; 80(20): 10218 - 10228.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
H. Kang, E. T. Kim, H.-R. Lee, J.-J. Park, Y. Y. Go, C. Y. Choi, and J.-H. Ahn
Inhibition of SUMO-independent PML oligomerization by the human cytomegalovirus IE1 protein.
J. Gen. Virol., August 1, 2006; 87(Pt 8): 2181 - 2190.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Takemoto, M. Koike, Y. Mori, S. Yonemoto, Y. Sasamoto, K. Kondo, Y. Uchiyama, and K. Yamanishi
Human Herpesvirus 6 Open Reading Frame U14 Protein and Cellular p53 Interact with Each Other and Are Contained in the Virion
J. Virol., October 15, 2005; 79(20): 13037 - 13046.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. Gravel, V. Dion, N. Cloutier, J. Gosselin, and L. Flamand
Characterization of human herpesvirus 6 variant B immediate-early 1 protein modifications by small ubiquitin-related modifiers
J. Gen. Virol., May 1, 2004; 85(5): 1319 - 1328.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Mori, X. Yang, P. Akkapaiboon, T. Okuno, and K. Yamanishi
Human Herpesvirus 6 Variant A Glycoprotein H-Glycoprotein L-Glycoprotein Q Complex Associates with Human CD46
J. Virol., April 15, 2003; 77(8): 4992 - 4999.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stanton, R.
Right arrow Articles by Wilkinson, G. W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stanton, R.
Right arrow Articles by Wilkinson, G. W. G.
Agricola
Right arrow Articles by Stanton, R.
Right arrow Articles by Wilkinson, G. W. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS