|
|
||||||||
Animal: DNA Viruses |
Laboratoire de Pathologie Comparée, UMR 5087 INRA/CNRS/Université de Montpellier II, 30380 Saint Christol les Alès, France1
Author for correspondence: Miguel López Ferber. Fax +33 4 66 52 46 99. e-mail lopez{at}ales.inra.fr
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Both forms of virus are usually produced in a sequential manner in the same cells: first BVs are produced, allowing the virus to spread to all susceptible tissues in the larvae; later, the virions are retained within the nuclei where they acquire specific proteins and are eventually included into the OB. OBs will only be released after the death of the larva.
Although the virions present in both forms differ in some of their virus-derived proteins and in the composition of their viral membranes (Braunagel & Summers, 1994
), they contain the same genome. The two phenotypes play different roles in the virus cycle. BVs are responsible for cell-to-cell infection within the host, while OBs ensure the propagation of the virus between hosts.
The differences in the tissue tropism and the ability of the two virus phenotypes to survive in the natural environment can be related to the specific proteins differentially associated with each type of virion. For instance, the BV of Autographa californica nucleopolyhedrovirus (AcMNPV) contains the GP64 protein, which is required for cell-to-cell transmission and which is not present in ODVs (Monsma et al., 1996
). The absence of the polyhedrin, the major OB protein in the NPV, severely impairs virus survival in the environment but does not affect their in vitro maintenance (Smith et al., 1983
).
The life cycle of baculoviruses in nature starts with the ingestion of OBs present on contaminated diet by a larva. The OBs are dissolved in the midgut and the virions they contain are released. The ODVs pass through the peritrophic membrane and infect the midgut cells. In some baculoviruses, virus enhancing factors (VEFs) present in the OBs increase infectivity (Bischoff & Slavicek, 1997
; Tanada, 1985
; Wang et al., 1994
).
Infection of the larval midgut cells occurs by direct fusion of the ODV envelope to the plasma membrane (Granados & Lawler, 1981
). Horton & Burand (1993)
analysed the entry of Lymantria dispar nucleopolyhedrovirus (LdMNPV) ODVs into L. dispar cells in culture (IPBL-LdEIta) and in brush-border membrane vesicles. They deduced that the entry of the virus could occur in two stages: binding of ODVs to the cell membrane followed by fusion, mediated by ODV attachment and fusion factors, respectively.
Knock-out experiments demonstrate that the P74 protein of AcMNPV, the expression product of AcMNPV ORF 138 (Ayres et al., 1994
), is required for the infectivity of ODVs (Kuzio et al., 1989
; Faulkner et al., 1997
), suggesting its involvement in the attachment to a specific receptor. This protein appears to be conserved among all sequenced baculoviruses.
The analysis of viral genes involved in the initial stages of virus entry into the host would greatly increase our understanding of this process. It would also enable the determination of what host defence mechanisms, if any, operate in the insect midgut.
In this report we show that a second protein, encoded by ORF 7 of the NotI D fragment of Spodoptera littoralis nucleopolyhedrovirus (SpliNPV), is required for the infectivity of the OBs. ORF 7 is homologous to ORF 119 of AcMNPV (Ayres et al., 1994
). This ORF is also conserved in all sequenced baculoviruses. We demonstrate that it is a structural protein of the ODV envelope required only in the first steps of per os infection.
| Methods |
|---|
|
|
|---|
Viruses, cells and larvae.
4, appeared in our stocks during a cloning procedure while studying the egt region (G. Croizier, L. Croizier and M. López Ferber, unpublished results). This mutant was cloned by plaque assay.
SpliNPV cell culture infections, co-transfections and titrations were done in S. littoralis Sl52 cells cultured in a modified TC100 medium supplemented with 10% FCS (Croizier et al., 2000
). AcMNPV recombinants were obtained and amplified on S. frugiperda Sf9 cells. BV titres in cell culture supernatants were estimated by the end-point dilution method according to Summers & Smith (1987)
.
Biological tests were carried out using S. littoralis larvae obtained from our laboratory colony. All larvae, healthy or infected, were reared on semi-synthetic medium (Poitout & Bues, 1974
) at 23 °C, 70% relative humidity and with a photoperiod of 16 h.
Purification and isolation of OBs and ODVs.
Healthy, third instar (L3) S. littoralis larvae were injected through a proleg with a 0·45±12 mm needle. Each larvae received 8 µl of ODV solution or infectious Sl52 cell culture supernatant diluted in TG3 medium. After injection, larvae were reared individually under the conditions indicated above. Dead larvae were processed as described previously (Croizier & Ribeiro, 1992
). After brief sonication to disrupt aggregates, the concentration of OBs was calculated using an improved Neubauer haemocytometer as outlined by Hunter-Fujita et al. (1998)
. To liberate ODVs, aliquots of 5x109 OBs were incubated in 1 ml of dissociation buffer (50 mM Na2C03) at room temperature for 40 min, followed by 2 min of centrifuging at 13000 r.p.m. in a microfuge. The pellet was re-suspended in 0·5 ml of dissociation buffer and centrifuged again. The combined supernatants were layered onto a 14 ml, 2060% (w/w) sucroseTE gradient and centrifuged at 18000 r.p.m. for 1 h at 4 °C. The multiple ODV bands were removed, diluted in TE, pelleted and finally re-suspended in 0·1x TE (Croizier et al., 1980
).
Bioassays.
The droplet feeding technique was used for all per os tests on neonates and L3 larvae (Hughes & Wood, 1981
). Lots of 48 larvae were either fed with five logarithmic suspensions of OBs to estimate the LD50 or injected as indicated above.
After per os infection or injection, larvae were reared individually in conditions similar to the non-infected larvae. Dead larvae were examined to determine the presence of OBs. OBs were purified from each group of dead larvae. Viral DNA was extracted from the larvae and submitted to restriction endonuclease analysis to assess its identity.
The infectivity of ODVs by injection was tested on groups of 20 L3 larvae. The larvae were reared as stated previously.
Plasmids and PCR fragments.
The wild-type NotI D restriction fragment was cloned into a pBluescript plasmid (Stratagene) to give p219.1 (Fig. 1
). Similarly, the PstI H and K restriction fragments were cloned into pUC19 to give p75.36 and p215.4, respectively. Plasmids p226.1, p228.12 and p229.41 were constructed by inserting into pUC19 the appropriate restriction fragments from p219.1 or p75.36 (Fig. 1
). The NotI restriction fragment encompassing the deletion in the SpliNPV
4 virus was similarly cloned to give p220.32. Both NotI D fragments from the wild-type virus (insert of p219.1, 8·6 kb) and the SpliNPV
4 deletion mutant (insert of p220.32, 4·2 kb) were sequenced by the dye terminator method on an ABI 373 automatic sequencer.
|
Complementation analysis.
4 DNA alone or mixed with different plasmids (50x molar ratio to the viral DNA) covering the deleted region (Fig. 1Larva that had fed on the solution over a 5 min period were isolated in rearing boxes with feeding medium. Mortality was recorded daily. Dead larvae were checked for OBs and the viral DNA was extracted, digested with endonucleases and analysed by electrophoresis. OBs were further passaged to test for per os infectivity.
PCR amplifications were performed on p226.1 DNA using the Expand High Fidelity Polymerase reagent (Roche). For PCR 2702, the universal forward and reverse primers were used to amplify the complete p226.1 insert. For PCR 1968, the primers used were the universal forward primer and oligonucleotide SpliNPVORF7/1 (5' cgtacgctcgaggcatgcctgcaggctaacgaacgctatagtttgggtacgtg 3'), which hybridizes to the last codons of ORF 7. As a negative control, a tube containing similar amounts of template, but which was not subjected to PCR, was used in each co-transfection. A 1:100 of the PCR product was used for each co-transfection, after digestion with SphI/EcoRI.
Construction of recombinant viruses.
The complete SpliNPV NotI D ORF 7 was amplified by PCR from p219.1 DNA. Two different PCR products were obtained encoding the complete ORF either with or without a 6x(His)-tag coding sequence at their 3' end, flanked by BglII sites. A single primer was used for the 5' ends (ORF7-BglII, 5' gctgaagatctatgtacaagatactattgatag 3') and two specific primers for the 3' ends (ORF7-His-BglII, 5' agctagatctctagtggtggtggtggtggtgacgaacgctatagtttgggtacgtg 3', and ORF7-BglII, 5' agctagatctctaacgaacgctatagtttgggtacgtg 3'). PCR products were cloned into the pAcUW21 vector (López Ferber et al., 1995
) under the AcMNPV p10 promoter to give p252 (ORF 7 with a histidine tag) and p253 (native ORF 7). Recombinant viruses BacPAKPIFHIS and BacPAKPIF were obtained by co-transfection on Sf9 cells of BacPAK6 DNA (Kitts & Possee, 1993
) and plasmids p252 and p253, respectively. Recombinant viruses were selected for their occlusion-positive phenotype by three rounds of plaque purification.
Antibodies, SDSPAGE and Western blot analysis.
Sequence analysis predicted that the regions between aa 163 and 179 and 429 and 442 of the deduced protein sequence of the SpliNPV NotI D fragment ORF 7 would be the most antigenic regions. Synthetic peptides were made against these two regions (Spli7-1 and Spli7-2, respectively), coupled to KLH and used to raise antibodies in rabbits (Ab262 and Ab263).
To detect the histidine tag, a monoclonal mouse anti-His antibody (Ab His) was used (Eurogentec). AcMNPV GP67 was detected using AcV5 monoclonal antibody (Hohmann & Faulkner, 1983
).
Vertical slab SDSPAGE was performed using a 3·5% stacking gel and a 10% separating gel. Before loading, samples were boiled for 10 min in 50 mM TrisHCl, pH 6·8, 2% SDS, 1%
-mercaptoethanol and 10% glycerol. Proteins were transferred onto PVDF membranes (Roche). The membranes were blocked with TBST [0·9% NaCl (w/v), 10 mM TrisHCl, pH 8·0, and 0·1% Tween 20] and 5% dry skimmed milk. Antibodies were allowed to bind overnight at 4 °C (Ab262, 1:3000 dilution; AbHis, 1:1500 dilution). Blots were washed four times (15 min) with TBST and incubated for 1 h with either horseradish peroxidase-linked anti-rabbit antibodies, 1:500 dilution (Sanofi Pasteur Diagnostics), or alkaline phosphatase-linked anti-mouse antibodies, 1:2000 dilution (Santa Cruz Biotechnology). Blots were washed four times with TBST and developed using chemiluminescence (Roche).
Glycosylation analysis.
Sf9 cells (5x106) were infected with BacPAKPIF. At 120 h post-infection, cells were collected, pelleted, washed with PBS and re-suspended in 300 µl PBS. Cells were disrupted by three freezethaw cycles followed by passage through a 26 gauge needle. The particulate material, containing the ORF 7 gene product was pelleted for 5 min at 13000 r.p.m. A sample of 3µl of concentrated BacPAKPIF BV suspension (10 µg of protein) was added to the pellet to provide an internal AcMNPV GP67-based positive control. After adding 50 µl of 5% SDS, the pellet was boiled for 10 min and the insoluble fraction was removed by centrifuging for 5 min at 13000 r.p.m. The supernatant was then diluted 2·5 times with water and distributed in 10 µl aliquots. Each 10 µl aliquot was mixed with an equal volume of 2xtreatment buffer (40 mM NaH2PO4, 20 mM EDTA, 2% NP-40 and 2%
-mercaptoethanol, pH 7·2) and either 2 units of F-endoglycosydase (Roche) or 2 µl of water as negative control, and incubated for 16 h at 37 °C. The proteins were separated by SDSPAGE, transferred to PVDF membranes and probed with Ab262 (1:2000 dilution) or AcV5 (1:2000 dilution) (Hohmann & Faulkner, 1983
).
Nucleotide sequence accession number.
The nucleotide sequence of the SpliNPV M2 NotI D fragment reported in this paper has been deposited in the databases under accession number AF527603. The predicted protein was analysed using the ANTHEPROT program, version 4.9 (Deléage et al., 1988
).
| Results |
|---|
|
|
|---|
4 mutant, non-infectious per os
4. This deletion is located in the NotI D restriction fragment (Figs 1
|
4 mutant to give plasmids p219.1 and p220.32, respectively, and their inserts were sequenced to determine the differences between both viruses. A 4415 nt long deletion was found and five genes are affected: ORFs 37 (Fig. 1A
4, a composite ORF is created by the in-phase fusion of the 5' end of ORF 7 to the 3' end of ORF 3 (Fig. 1B
Injection of supernatants from SpliNPV
4-infected cell culture into larvae led to the death of the larvae from polyhedrosis, similar to that produced by the wild-type virus (Table 1
, experiments 1 and 2). The OBs produced by the dead larvae were purified and used for bioassays. Purified SpliNPV
4 OBs were still not infectious per os (Table 2
, compare experiments 1 and 2 with 3 and 4). No difference in morphology was found using scanning electron microscopy between SpliNPV
4 and wild-type OBs purified from the dead larvae (data not shown). SpliNPV
4 ODVs were able to kill the larvae when injected into the haemocoel but not when the larvae were infected per os (Table 1
, experiments 4 and 6). Finally, DNA extracted from ODVs from both viruses was infectious by transfection into Sl52 cells.
|
|
4 mutant
4 polyhedra were not infectious per os, therefore a complementation analysis was set up to test which gene(s) could be involved. Purified DNA from SpliNPV
4 was co-transfected with p219.1, containing the complete wild-type NotI D fragment, which compensates for the deletion. The majority of the larvae ingesting the OBs produced by the co-transfected cells died, confirming that the deletion is responsible for the observed phenotype (Table 3
4 genotypes (Fig. 2
4 and p219.1 reconstructed a wild-type virus able to infect larvae per os. In addition, the presence of SpliNPV
4 genotypes indicates that those defective viruses were helped in their passage through the midgut.
|
Larvae died from baculovirus infection only when p226.1 was included in the co-transfection (Table 3
, experiment 10). p226.1 presents common sequences with SpliNPV
4 only in the 5' portion of ORF 7, the 3' moiety being affected by the deletion (Fig. 1C
). Under these conditions, no homologous recombination is possible. The viral DNA contained in the OBs extracted from the dead larvae always presents the 4·2 kb NotI D fragment characteristic from SpliNPV
4 (data not shown). Larvae fed with those OBs were not killed but ODVs extracted from them were infectious by injection, confirming that the genomes amplified were similar to SpliNPV
4 DNA and that no recombination had occurred during the co-transfection.
Plasmid p226.1 encompasses the region between the SphI (located at 4520) and the EcoRI (7226) sites, including two ORFs. ORF 6 can encode a 77 aa peptide. It is located immediately downstream to ORF 7, which has coding potential for a 525 aa protein.
Although ORF 6 was unlikely to be responsible because p229.41 did not rescue the phenotype (Table 3
, experiment 9), a PCR approach was chosen to confirm the involvement of ORF 7 in the observed phenotype.
The promoter region of ORF 7 has not been analysed but the rescue observed in p226.1 suggests that the region upstream of the ORF 7 ATG start codon contained in p226.1 is sufficient to drive transcription. Accordingly, we used the M13 forward primer (FP), thus including the region upstream of ORF 7 containing all of the putative promoter. The second primer, SpliNPVORF7/1, was designed to be complementary to the stop codon of ORF 7, eliminating ORF 6 (Fig. 1C
, PCR 1968). A positive control PCR containing the complete insert of p226 .1 was obtained by amplifying between the FP and the M13 reverse primer (Fig. 1C
, PCR 2702). To eliminate possible read-through artefacts, PCR products were digested at their extremities with EcoRI/SphI before being used in co-transfections. To prevent a positive response due to template carry-through, preliminary experiments were set up to reduce the amounts of template in the reactions to obtain negative results. No larva death was recorded when using less than 5 ng of template in a PCR volume of 100 µl.
Co-transfection of cells with SpliNPV
4 DNA and PCRs 2702 or 1968 allowed rescue at roughly similar levels to that of p226.1 (Table 3
, compare experiments 10, 11 and 12). The rescue observed with PCR 1968 confirms that the presence of ORF 7 is necessary and sufficient to rescue the infectivity of polyhedra in SpliNPV
4.
Protein sequence analysis
ORF 7 can encode a 525 residue protein (Fig. 3A
), with a theoretical molecular mass of 59·6 kDa and a predicted isoelectric point of 5·08. This gene product is well conserved among all sequenced baculoviruses. The maximal coding capacity of these ORFs varies between 510 and 540 aa. The global level of homology at the amino acid level between this ORF in SpliNPV and the homologous genes of AcMNPV (ORF 119, Ayres et al., 1994
), Bombyx mori nucleopolyhedrovirus (BmNPV) (ORF 97, Gomi et al., 1999
), Orgyia pseudotsugata nucleopolyhedrovirus (OpMNPV) (ORF 119, Ahrens et al., 1997
), LdMNPV (ORF 155, Kuzio et al., 1999
), Spodoptera exigua nucleopolyhedrovirus (ORF 36, IJkel et al., 1999
), SpltNPV (ORF 124, Pang et al., 2001
), Helicoverpa armigera NPV (ORF 111, Chen et al., 2001
), Epiphyas postvittana NPV (ORF 106, Hyink et al., 2002
), Xestia c-nigrum granulovirus (ORF 84, Hayakawa et al., 1999
), Plutella xylostella granulovirus (ORF 7, Hashimoto et al., 2000
), Cydia pomonella granulovirus (ORF 75, Luque et al., 2001
), Phthorimaea operculella granulovirus (ORF 66, L. Croizier, A. Taha, G. Croizier and M. López Ferber, unpublished, GenBank accession number AF499596) and Culex nigripalpus baculovirus (ORF 29, Afonso et al., 2001
) ranges around 40%. In all baculoviruses, 50 aa are absolutely conserved; among them, 19 of the 24 cysteines present in the SpliNPV gene are conserved. The most conserved portion of the protein is between residues 147 and 174, with 10 residues perfectly conserved in all baculoviruses. Higher variation is observed in the C-terminal moiety, where it is difficult to find a consensus.
|
ANTHEPROT predicts four transmembrane domains that delimit two intracellular and two extracellular regions (Fig. 3A
, B
). The consensus of secondary structure predictions (ANTHEPROT/NPSA) yields 18%
-helixes, 24% extended strands and 56% random coils. The most antigenic regions were predicted to be aa 163179 and 429442.
Four putative N-glycosylation sites were detected (Fig. 3A
). Two of them, 215NDTN218 and 521NYSV524 are predicted to be located in the external side of the membrane.
SpliNPV ORF 7 gene product is a structural protein of the ODV
Among the two predicted immunogenic peptides, only the antibody raised against Spli7-1 (Ab262) was sensitive and specific enough to detect a very weak band on Western blots of SpliNPV M2 ODVs. To confirm that this antibody is able to recognize the genuine ORF 7 gene product, the recombinant AcMNPV BacPAKPIFHIS was constructed. Commercial anti-HIS antibodies or Ab262 recognize the same two bands in Western blots of Sf9 cells infected by AcMNPV BacPAKPIFHIS, confirming the specificity of Ab262 (Fig. 4
). We have not investigated in detail why two bands are recognized but the upper band probably corresponds to the PIF precursor with uncleaved signal peptide. A single immunoreactive band is observed in SpliNPV M2 but not in SpliNPV
4 ODVs (Fig. 5A
), neither is it observed in the BVs. As a positive control, the recombinant protein produced by AcMNPV BacPAKPIF (Fig. 5A
, lane 1) was used. After fractionation of SpliNPV M2 ODV nucleocapsids and envelopes, the immunoreactive protein appears to be linked to the latter (Fig. 5B
). The possible glycosylation of the protein has been checked. No sensitivity to F-endoglycosydase (measured by electrophoretic mobility) has been detected, suggesting that none of the potential N-glycosylation sites is used. N-Glycosylation analysis was supplemented by detection of total glycoproteins using a concanavalin A-binding assay on total ODV proteins. No differences could be observed between the glycosylated protein patterns of SpliNPV M2 and SpliNPV
4 ODVs (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
4, a deletion mutant isolated in our laboratory, revealed its inability to infect S. littoralis larvae per os, while retaining the ability to kill upon injection with virus particles. The deletion is contained within the NotI D restriction fragment. This fragment was sequenced in both wild-type SpliNPV M2 and SpliNPV
4. Compared with the recently published sequence of a SpltNPV (Pang et al., 2001
A deletion of 4415 nt was found in SpliNPV
4 (Fig. 2
). This deletion eliminates the egt, fgf and ORF 6 genes and creates a composite ORF between the N-terminal part of ORF 7 (84 codons) and most of ORF 3 (from codon 46 to the end) (Fig. 1A
, B
). ORF 3 is homologous to SpltNPV ORF 120 (Pang et al., 2001
), which these authors consider as a member of the bro gene family (Kuzio et al., 1999
). It has been shown that deletion of some bro genes impairs virus survival in BmNPV strain T3 (Kang et al., 1999
). The number of bro genes varies not only between virus species but also between virus strains (López Ferber et al., 2001
).
The genes involved in the absence of infectivity of polyhedra are located in the observed deletion, as co-transfection with plasmid p219.1, which covers the deletion, generates fully functional viruses (Table 3
, experiment 5). By using a set of plasmids and PCR fragments in co-transfection experiments, it has been possible to attribute the phenotype exclusively to the absence of ORF 7 in the mutant virus.
When co-transfecting SpliNPV
4 DNA with either plasmid p226.1 or PCR fragments containing the complete ORF 7, no recombinant viruses can be recovered that have integrated the complete ORF 7 by recombination, as there is no sequence homology between the viral DNA and the plasmid at the 3' extremity of the gene. The OBs produced by those co-transfections are infectious per os but the virions do not contain the gene. Analysis of both the infectivity of the OBs recovered from the killed larvae and the DNA extracted from them confirmed that the gene has not been inserted.
These results reveal that the product of ORF 7 is not required once the first round of replication has begun, as the progeny viruses do not contain the gene. Accordingly, ORF 7 has been named the per os infectivity factor or pif.
The N-terminal hydrophobic sequence of PIF is predicted to act as a signal peptide, suggesting that the protein could be either secreted or located in the membrane. The protein is found, however, on the nuclei of the infected cells, in the ODV envelope. The mechanisms involved in nuclear targeting are unknown. Other signal peptide-containing viral proteins have been described with similar localization, like OpMNPV P91 (expression product of OpMNPV ORF 86) (Russell & Rohrmann, 1997
), suggesting the existence of a common mechanism.
The main difference between BVs and ODVs is the route of entry into the cells. To start the infection, the OBs ingested by the larva must be dissolved and the virions they contain released into the midgut lumen. A second step is the degradation of the peritrophic membrane to allow the virions to reach the brush-border cells. The last step is the binding to and entry of the virus into the cells, followed by migration of the nucleocapsids to the nuclei, liberation of the genome, replication and production of progeny viruses, which would be released to infect other cells. As SpliNPV
4 BVs or ODVs are infectious both to cells in culture and to the larvae by injection, they cannot lack any essential component required once the nucleocapsid reaches the nucleus.
Two different kinds of proteins have been described that act exclusively on the infectivity of OBs: those facilitating the onset of the infection and the P74 homologues.
Proteins belonging to the first category are trapped inside the OBs from where they are released when the OB is dissolved in the midgut but they are not components of the virions. Among these proteins are the synergistic factors (reviewed by Tanada, 1985
) and enhancins or VEFs (Derksen & Granados, 1988
). These factors were originally found in granuloviruses but, recently, VEF genes have been found in LdMNPV (Kuzio et al., 1999
; Popham et al., 2001
). It is possible to supplement a virus by adding the VEF to the mixture of OBs (Gallo et al., 1991
). Synergistic factors and VEFs disrupt the peritrophic membranes, facilitating the passage of virions to adhere to the midgut columnar cells (Derksen & Granados, 1988
). Another function attributed to synergistic factors was the increase of the fusion of nucleocapsids with the brush-border cells (Uchima et al., 1988
). Wang et al. (1994)
observed that the binding activity of the VEF of Trichoplusia ni granulovirus was not required for enhancing activity. All VEFs characterized present the consensus HEXXH, a signature of metalloproteases (Lepore et al., 1996
; Bischoff & Slavicek, 1997
). No such consensus has been found in ORF 7. Curiously, Derksen & Granados (1988)
detected a degradation of the peritrophic membrane of T. ni larvae following infection by AcMNPV, a virus in which no gene homologous to the known VEFs has been found. Proteins from other viruses have been shown to enhance baculovirus infectivity, like the entomopoxvirus spindle protein (Mitsuhashi et al., 1998
; Hukuhara & Wijonarko, 2001
), but the mechanisms involved are unclear. This protein presents between 30 and 40% homology with the baculovirus GP37 glycoprotein. GP37 concentrates in the cytoplasm of infected cells (Gross et al., 1993
) and is not essential for virus replication (Cheng et al., 2001
).
Sucrose gradient-purified SpliNPV M2 ODVs are infectious per os, while similarly obtained SpliNPV
4 ODVs are not (Table 1
). In addition, all attempts to rescue the SpliNPV
4 ODV with the protein fraction of dissolved OBs from wild-type SpliNPV were unsuccessful (data not shown). Finally, PIF appears to be located in the envelope fraction of ODVs. It is thus unlikely that PIF could be involved either in the dissolution of OBs or in the degradation of the peritrophic membrane.
P74 has been described previously by Faulkner et al. (1997)
in AcMNPV as a structural ODV protein required for infectivity of polyhedra. Deletion or disruption of the AcMNPV p74 gene results in a complete absence of the per os infectivity of OBs, while injection of ODVs into the haemocoel leads to polyhedrosis. This phenotype is similar to that obtained with SpliNPV
4. A homologous gene has been found in SpliNPV (Faktor et al., 1997
). P74 and PIF may interact to achieve entry into cells, either by direct contact or by acting in a cascade in the two steps proposed by Horton & Burand (1993)
.
In summary, it appears that PIF is a protein required between the binding of ODVs to the midgut cells and the beginning of DNA replication of the virus with the subsequent production of progeny BVs. Further experiments would allow the determination of the precise steps in which the deletion mutant SpliNPV
4 is impaired and the possible interactions with SpliNPV P74.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ahrens, C. H., Russell, R. L. Q., Funk, C. J., Evans, J. T., Harwood, S. H. & Rohrmann, G. F. (1997). The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 229, 381-399.[Medline]
Ayres, M. D., Howard, S. C., Kuzio, J., López Ferber, M. & Possee, R. D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605.[Medline]
Bischoff, D. S. & Slavicek, J. M. (1997). Molecular analysis of an enhancin gene in the Lymantria dispar nuclear polyhedrosis virus. Journal of Virology 71, 8133-8140.[Abstract]
Braunagel, S. C. & Summers, M. D. (1994). Autographa californica nuclear polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids: structural proteins, antigens, lipid and fatty acid profiles. Virology 202, 315-318.[Medline]
Chen, X., IJkel, W. F. J., Tarchini, R., Sun, X., Sandbrink, H., Wang, H., Peters, S., Zuidema, D., Lankhorst, R. K., Vlak, J. M. & Hu, Z. (2001). The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. Journal of General Virology 82, 241-257.
Cheng, X.-W., Krell, P. J. & Arif, B. M. (2001). P34.8 (GP37) is not essential for baculovirus replication. Journal of General Virology 82, 299-305.
Croizier, G. & Ribeiro, C. H. T. (1992). Recombination as a possible major cause of genetic heterogeneity in Anticarsia gemmatalis nuclear polyhedrosis virus wild populations. Virus Research 26, 183-196.
Croizier, G., Godse, D. & Vlak, J. M. (1980). Sélection de types viraux dans les infections doubles à baculovirus chez les larves de lépidoptères. Comptes Rendus de lAcademie des Sciences 290, 579582 (in French).
Croizier, G., Boukhoudmi-Amiri, K. & Croizier, L. (1989). A physical map of Spodoptera littoralis B-type nuclear polyhedrosis virus genome. Archives of Virology 104, 145-151.[Medline]
Croizier, L., Jousset, F.-X., Veyrunes, J.-C., López Ferber, M., Bergoin, M. & Croizier, G. (2000). Protein requirements for assembly of virus-like particles of Junonia coenia densovirus in insect cells. Journal of General Virology 81, 1605-1613.
Deléage, G., Clerc, F. F., Roux, B. & Gautheron, D. C. (1988). ANTHEPROT: a package for protein sequence analysis using a microcomputer. Computer Applications in the Biosciences 4, 351-356.
Derksen, A. C. G. & Granados, R. R. (1988). Alteration of a lepidopteran peritrophic membrane by baculoviruses and enhancement of viral infectivity. Virology 167, 242-250.[Medline]
Faktor, O., Toister-Achituv, M., Nahum, O. & Kamensky, B. (1997). The p10 gene of Spodoptera littoralis nucleopolyhedrovirus: nucleotide sequence, transcriptional analysis and unique gene organization in the p10 locus. Journal of General Virology 78, 2119-2128.[Abstract]
Faulkner, P., Kuzio, J., Williams, G. V. & Wilson, J. A. (1997). Analysis of p74, a PDV envelope protein of Autographa californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. Journal of General Virology 78, 3091-3100.[Abstract]
Funk, C. J., Braunagel, S. C. & Rohrmann, G. F. (1997). Baculovirus structure. In The Baculoviruses , pp. 7-32. Edited by L. K. Miller. New York:Plenum.
Gallo, L. G., Corsaro, B. G., Hughes, P. R. & Granados, R. R. (1991). In vivo enhancement of baculovirus infection by the viral enhancing factor of a granulosis virus of the cabbage looper, Trichoplusia ni (Lepidoptera: Noctuidae). Journal of Invertebrate Pathology 58, 203-210.
Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323-1337.[Abstract]
Granados, R. R. & Lawler, K. A. (1981). In vivo pathway of Autographa californica baculovirus invasion and infection. Virology 108, 297-308.
Gross, C. H., Wolgamot, G. M., Russell, R. L., Pearson, M. N. & Rohrmann, G. F. (1993). A 37-kilodalton glycoprotein from a baculovirus of Orgyia pseudotsugata is localized to cytoplasmic inclusion bodies. Journal of Virology 67, 469-475.
Hashimoto, Y., Hayakawa, T., Ueno, Y., Fujita, T., Sano, Y. & Matsumoto, T. (2000). Sequence analysis of the Plutella xylostella granulovirus genome. Virology 275, 358-372.[Medline]
Hayakawa, T., Ko, R., Okano, K., Seong, S.-I., Goto, C. & Maeda, S. (1999). Sequence analysis of the Xestia c-nigrum granulovirus genome. Virology 262, 277-297.[Medline]
Hohmann, A. W. & Faulkner, P. (1983). Monoclonal antibodies to baculovirus structural proteins: determination of specificities by Western blot analysis. Virology 125, 432-444.[Medline]
Horton, H. M. & Burand, J. P. (1993). Saturable attachment sites for polyhedron-derived baculovirus on insect cells and evidence for entry via direct membrane fusion. Journal of Virology 67, 1860-1868.
Hughes, P. R. & Wood, H. A. (1981). A synchronous peroral technique for the bioassay of insect viruses. Journal of Invertebrate Pathology 37, 154-159.
Hukuhara, T. & Wijonarko, A. (2001). Enhanced fusion of a nucleopolyhedrovirus with cultured cells by a virus enhancing factor from an entomopoxvirus. Journal of Invertebrate Pathology 77, 62-67.[Medline]
Hunter-Fujita, F., Entwistle, P. F. & Crook, N. E. (1998). Insect Viruses and Pest Management. Chichester: John Wiley.
Hyink, O., Dellow, R. A., Olsen, M. J., Caradoc-Davies, K. M., Drake, K., Herniou, E. A., Cory, J. S., OReilly, D. R. & Ward, V. K. (2002). Whole genome analysis of the Epiphyas postvittana nucleopolyhedrovirus. Journal of General Virology 83, 957-971.
IJkel, W. F. J., van Strien, E. A., Heldens, J. G. M., Broer, R., Zuidema, D., Goldbach, R. W. & Vlak, J. M. (1999). Sequence and organization of the Spodoptera exigua multicapsid nucleopolyhedrovirus genome. Journal of General Virology 80, 3289-3304.
Kang, W., Suzuki, M., Zemskov, E., Okano, K. & Maeda, S. (1999). Characterization of baculovirus repeated open reading frames (bro) in Bombyx mori nucleopolyhedrovirus. Journal of Virology 73, 10339-10345.
Kitts, P. A. & Possee, R. D. (1993). A method for producing recombinant baculovirus expression vectors at high frequency. Biotechniques 14, 810-817.[Medline]
Kuzio, J., Jacques, R. & Faulkner, P. (1989). Identification of p74, a gene essential for virulence of baculovirus occlusion bodies. Virology 173, 759-763.[Medline]
Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. M. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 17-34.[Medline]
Lepore, L. S., Roelvink, P. R. & Granados, R. R. (1996). Enhancin, the granulosis virus protein that facilitates nucleopolyhedrovirus (NPV) infections, is a metalloprotease. Journal of Invertebrate Pathology 68, 131-140.[Medline]
López Ferber, M., Sisk, W. P. & Possee, R. D. (1995). Baculovirus transfer vectors. Methods in Molecular Biology 39, 25-63.
López Ferber, M., Argaud, O., Croizier, L. & Croizier, G. (2001). Diversity, distribution, and mobility of bro gene sequences in Bombyx mori nucleopolyhedrovirus. Virus Genes 22, 247-254.[Medline]
Luque, T., Finch, R., Crook, N., OReilly, D. R. & Winstanley, D. (2001). The complete sequence of the Cydia pomonella granulovirus genome. Journal of General Virology 82, 2531-2547.
Mitsuhashi, W., Furuta, Y. & Sato, M. (1998). The spindles of an entomopoxvirus of Coleoptera (Anomala cuprea) strongly enhance the infectivity of a nucleopolyhedrovirus in Lepidoptera. Journal of Invertebrate Pathology 71, 186-188.[Medline]
Monsma, S. A., Oomens, A. G. & Blissard, G. W. (1996). The GP64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell transmission of infection. Journal of Virology 70, 4607-4616.[Abstract]
OReilly, D. R. & Miller, L. K. (1990). Regulation of expression of a baculovirus ecdysteroid UDP glucosyltransferase gene. Journal of Virology 64, 1321-1328.
Pang, Y., Yu, J., Wang, L., Hu, X., Bao, W., Li, G., Chen, C., Han, H., Hu, S. & Yang, H. (2001). Sequence analysis of the Spodoptera litura multicapsid nucleopolyhedrovirus genome. Virology 287, 391-404.[Medline]
Poitout, S. & Bues, R. (1974). Elevage des chenilles de vingt-huit espèces de lepidoptères Noctuidae et de deux espèces dArctiidae sur milieu artificiel simple. Particularité délevage selon les espèces. Annales de Zoologie Ecologie Animale 6, 431441 (in French).
Popham, H. J., Bischoff, D. S. & Slavicek, J. M. (2001). Both Lymantria dispar nucleopolyhedrovirus enhancin genes contribute to viral potency. Journal of Virology 75, 8639-8648.
Russell, R. L. & Rohrmann, G. F. (1997). Characterization of P91, a protein associated with virions of an Orgyia pseudotsugata baculovirus. Virology 233, 210-223.[Medline]
Smith, G. E., Fraser, M. D. & Summers, M. D. (1983). Molecular engineering of the Autographa californica nuclear polyhedrosis virus genome: deletion mutations within the polyhedrin gene. Journal of Virology 46, 584-593.
Summers, M. D. & Smith, G. E. (1987). A manual of methods for baculovirus vectors and insect cell culture procedures. Texas Agricultural Experimental State Bulletin, no. 1555.
Tanada, Y. (1985). A synopsis of studies on the synergistic property of an insect baculovirus: a tribute to Edward A. Steinhaus. Journal of Invertebrate Pathology 45, 125-138.
Uchima, K., Harvey, J. P., Omi, E. M. & Tanada, Y. (1988). Binding sites on the midgut cell membrane for the synergistic factor of a granulosis virus of the armyworm (Pseudaletia unipunctata). Insect Biochemistry 18, 645-650.
Wang, P., Hammer, D. A. & Granados, R. R. (1994). Interaction of Trichoplusia ni granulosis virus-encoded enhancin with the midgut epithelium and peritrophic membrane of four lepidopteran insects. Journal of General Virology 75, 1961-1967.
Received 6 May 2002;
accepted 16 July 2002.
This article has been cited by other articles:
![]() |
G. Clavijo, T. Williams, O. Simon, D. Munoz, M. Cerutti, M. Lopez-Ferber, and P. Caballero Mixtures of Complete and pif1- and pif2-Deficient Genotypes Are Required for Increased Potency of an Insect Nucleopolyhedrovirus J. Virol., May 15, 2009; 83(10): 5127 - 5136. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Garcia-Maruniak, A. M. M. Abd-Alla, T. Z. Salem, A. G. Parker, V.-U. Lietze, M. M. van Oers, J. E. Maruniak, W. Kim, J. P. Burand, F. Cousserans, et al. Two viruses that cause salivary gland hypertrophy in Glossina pallidipes and Musca domestica are related and form a distinct phylogenetic clade J. Gen. Virol., February 1, 2009; 90(2): 334 - 346. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Slack, S. D. Lawrence, P. J. Krell, and B. M. Arif Trypsin cleavage of the baculovirus occlusion-derived virus attachment protein P74 is prerequisite in per os infection J. Gen. Virol., October 1, 2008; 89(10): 2388 - 2397. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Song, R. Wang, F. Deng, H. Wang, and Z. Hu Functional studies of per os infectivity factors of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus J. Gen. Virol., September 1, 2008; 89(9): 2331 - 2338. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. M. Abd-Alla, F. Cousserans, A. G. Parker, J. A. Jehle, N. J. Parker, J. M. Vlak, A. S. Robinson, and M. Bergoin Genome Analysis of a Glossina pallidipes Salivary Gland Hypertrophy Virus Reveals a Novel, Large, Double-Stranded Circular DNA Virus J. Virol., May 1, 2008; 82(9): 4595 - 4611. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Deng, R. Wang, M. Fang, Y. Jiang, X. Xu, H. Wang, X. Chen, B. M. Arif, L. Guo, H. Wang, et al. Proteomics Analysis of Helicoverpa armigera Single Nucleocapsid Nucleopolyhedrovirus Identified Two New Occlusion-Derived Virus-Associated Proteins, HA44 and HA100 J. Virol., September 1, 2007; 81(17): 9377 - 9385. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fang, Y. Nie, Q. Wang, F. Deng, R. Wang, H. Wang, H. Wang, J. M. Vlak, X. Chen, and Z. Hu Open reading frame 132 of Heliocoverpa armigera nucleopolyhedrovirus encodes a functional per os infectivity factor (PIF-2) J. Gen. Virol., September 1, 2006; 87(9): 2563 - 2569. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Escasa, H. A. M. Lauzon, A. C. Mathur, P. J. Krell, and B. M. Arif Sequence analysis of the Choristoneura occidentalis granulovirus genome J. Gen. Virol., July 1, 2006; 87(7): 1917 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Simon, T. Williams, P. Caballero, and M. Lopez-Ferber Dynamics of deletion genotypes in an experimental insect virus population Proc R Soc B, April 7, 2006; 273(1588): 783 - 790. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ohkawa, J. O. Washburn, R. Sitapara, E. Sid, and L. E. Volkman Specific Binding of Autographa californica M Nucleopolyhedrovirus Occlusion-Derived Virus to Midgut Cells of Heliothis virescens Larvae Is Mediated by Products of pif Genes Ac119 and Ac022 but Not by Ac115 J. Virol., December 15, 2005; 79(24): 15258 - 15264. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Simon, T. Williams, M. Lopez-Ferber, and P. Caballero Functional Importance of Deletion Mutant Genotypes in an Insect Nucleopolyhedrovirus Population Appl. Envir. Microbiol., August 1, 2005; 71(8): 4254 - 4262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Zhang, T. Ohkawa, J. O. Washburn, and L. E. Volkman Effects of Ac150 on virulence and pathogenesis of Autographa californica multiple nucleopolyhedrovirus in noctuid hosts J. Gen. Virol., June 1, 2005; 86(6): 1619 - 1627. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Slack and S. D. Lawrence Evidence for proteolytic cleavage of the baculovirus occlusion-derived virion envelope protein P74 J. Gen. Virol., June 1, 2005; 86(6): 1637 - 1643. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. M. Lauzon, P. B. Jamieson, P. J. Krell, and B. M. Arif Gene organization and sequencing of the Choristoneura fumiferana defective nucleopolyhedrovirus genome J. Gen. Virol., April 1, 2005; 86(4): 945 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Simon, T. Williams, M. Lopez-Ferber, and P. Caballero Genetic Structure of a Spodoptera frugiperda Nucleopolyhedrovirus Population: High Prevalence of Deletion Genotypes Appl. Envir. Microbiol., September 1, 2004; 70(9): 5579 - 5588. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Haas-Stapleton, J. O. Washburn, and L. E. Volkman P74 Mediates Specific Binding of Autographa californica M Nucleopolyhedrovirus Occlusion-Derived Virus to Primary Cellular Targets in the Midgut Epithelia of Heliothis virescens Larvae J. Virol., July 1, 2004; 78(13): 6786 - 6791. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. A. M. Lauzon, C. J. Lucarotti, P. J. Krell, Q. Feng, A. Retnakaran, and B. M. Arif Sequence and Organization of the Neodiprion lecontei Nucleopolyhedrovirus Genome J. Virol., July 1, 2004; 78(13): 7023 - 7035. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Garcia-Maruniak, J. E. Maruniak, P. M. A. Zanotto, A. E. Doumbouya, J.-C. Liu, T. M. Merritt, and J. S. Lanoie Sequence Analysis of the Genome of the Neodiprion sertifer Nucleopolyhedrovirus J. Virol., July 1, 2004; 78(13): 7036 - 7051. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gutierrez, I. Kikhno, and M. Lopez Ferber Transcription and promoter analysis of pif, an essential but low-expressed baculovirus gene J. Gen. Virol., February 1, 2004; 85(2): 331 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fang, H. Wang, H. Wang, L. Yuan, X. Chen, J. M. Vlak, and Z. Hu Open reading frame 94 of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus encodes a novel conserved occlusion-derived virion protein, ODV-EC43 J. Gen. Virol., November 1, 2003; 84(11): 3021 - 3027. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Pijlman, A. J. P. Pruijssers, and J. M. Vlak Identification of pif-2, a third conserved baculovirus gene required for per os infection of insects J. Gen. Virol., August 1, 2003; 84(8): 2041 - 2049. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |