|
|
||||||||
Animal: RNA Viruses |
Institute of Medical Research1 and Department of Medical Technology2, Tzu Chi University, 701, Section 3, Chung-Yang Road, Hualien, Taiwan 970, Republic of China
Department of Medical Technology, Buddhist Tzu Chi General Hospital, Hualien, Taiwan, Republic of China3
Department of Internal Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan, Republic of China4
Author for correspondence: Shih-Yen Lo at Department of Medical Technology. Fax +886 3 8571917. e-mail losylo{at}mail.tcu.edu.tw
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Morphogenic studies of HCV have been hampered by the lack of a cell culture system for the efficient propagation of this virus. The interaction of the HCV capsid protein with positive-sense RNA has been characterized previously (Shimoike et al., 1999
). The interactions between the structural proteins of HCV are also important for the morphogenesis of this virus. There are extensive interactions between these structural proteins: the capsid protein can interact both with itself (Lo & Ou, 1998
; Matsumoto et al., 1996
) and with E1 (Baumert et al., 1998
; Lo et al., 1996
) and E2 (Baumert et al., 1998
); the E1 protein can also interact with the E2 protein (Dubuisson et al., 1994
; Yi et al., 1997
).
It has been demonstrated that the C-terminal sequences of both capsid and E1 proteins are important for their interaction in vivo (Lo et al., 1996
). In order to determine the binding region of the E1 protein with the capsid protein, we have performed proteinase K protection assays to study the topology of the E1 protein, and glutathione S-transferase (GST) pull-down assays to study the interaction between the capsid protein and various E1 mutant proteins in vitro.
| Methods |
|---|
|
|
|---|
Construction of expression plasmids.To clone the complete E1-coding sequence (aa 192383), primers 192-S (5' GGAATTCCATATGTACCAAGTGCGCAATTC 3') and 383-AS (5' GAAGATCTTTACGCGTCGACGCC 3') were used (underlined nucleotides indicate restriction sites; bold nucleotides indicate a stop codon). After amplification, the DNA fragment was digested with the restriction enzymes NdeI/BglII. This DNA insert was cloned into the pET3a vector (Novagen), linearized previously with NdeI/BamHI, to generate plasmid C383.
To clone the E1-coding sequence without the second hydrophobic domain (H2), primers 192-S and 328-AS (5' CGGGATCCTTAAGGGGACCAGTTCAT 3') were used. After amplification, the DNA fragment was digested with NdeI/BamHI. This DNA insert was cloned into pET3a, linearized previously with NdeI/BamHI, to generate plasmid C328.
To clone the E1-coding sequence without the first hydrophobic domain (H1), primers 192-S and 260-AS (5' GAGAAGGTACGTCGAAGCTGCGT 3') were used to amplify the gene fragment from aa 192 to 260, while primers 292-S (5' TCGACGTACCTTCTCTCCCAGG 3') and 383-AS were used to amplify the gene fragment from aa 292 to 383 (nucleotides in bold indicate the codon for aa 260; underlined nucleotides indicate the codon for aa 292). These two DNA fragments were linked and amplified using primers 192-S and 383-AS. After that, the DNA fragment was digested with NdeI/BglII. This DNA insert was cloned into pET3a, linearized previously with NdeI/BamHI, to generate plasmid C383D.
To clone the E1-coding sequence without either the H1 or the H2 domain, primers 192-S and 260-AS were used to amplify the gene fragment from aa 192 to 260, while primers 292-S and 328-AS were used to amplify the gene fragment from aa 292 to 328. These two DNA fragments were linked and amplified using primers 192-S and 328-AS. After that, the DNA fragment was digested with NdeI/BamHI and cloned into pET3a to generate plasmid C328D.
To clone the entire CE1-coding sequence (HCV nt 3211517), primers 321-S (5' CGGAATTCAGGTCTCGTAGACCG 3') and 1517-AS (5' GCTCTAGATTAGGCACTTCCCCCGGT 3') were used. After amplification, the DNA fragment was digested with EcoRI/XbaI. This DNA insert was then cloned into pcDNA3 (Invitrogen), linearized previously with EcoRI/XbaI, to generate plasmid pcDNA3-CCE1.
To clone the entire CE1-coding sequence without the H1 domain, primers 321-S and 260-AS were used to amplify the gene fragment from nt 321 to 1121 (aa 260), while primers 292-S and 1517-AS were used to amplify the gene fragment from nt 1215 (aa 292) to 1517. These two DNA fragments were linked and amplified using primers 321-S and 1517-AS. After that, the DNA fragment was digested with EcoRI/XbaI. This DNA insert was cloned into pcDNA3, linearized previously with EcoRI/XbaI, to generate plasmid pcDNA3-CCE1D.
To clone the entire CE1-coding sequence, but deleting aa 119152, primers 321-S and 118-AS (5' GACGCCATGATTGCGCGACCTACG 3') were used to amplify the gene fragment from nt 321 to 695 (aa 118), while primers 153-S (5' TCGCGCAATCATGGCGTCCGGGTT 3') and 1517-AS were used to amplify the gene fragment from nt 798 (aa 153) to 1517 (underlined nucleotides indicate the codon for aa 118; bold nucleotides indicate the codon for aa 153). These two DNA fragments were linked and amplified using primers 321-S and 1517-AS. After that, the DNA fragment was digested with EcoRI/XbaI. This DNA insert was then cloned into pcDNA3, linearized previously with EcoRI/XbaI, to generate pcDNA3-CCDE1.
To clone the H1-coding sequence (aa 261291), primers S (5' CGGGATCCCATATCGATCTGCTT 3') and AS (5' GGAATTCTTAAAACAGTTGACCAAC 3') were used. After amplification, the DNA fragment was digested with BamHI/EcoRI. This DNA insert was cloned into pGEX2T (Pharmacia), linearized previously with BamHI/EcoRI, to generate plasmid pGEX2T-E1H1.
To clone the H2-coding sequence (aa 329383), primers S2 (5' GAAGATCTACGGCAGCGTTGGTG 3') and AS2 (5' GGAATTCTTACGCGTCGACGCCGGC 3') were used. After amplification, the DNA fragment was digested with BglII/EcoRI. This DNA insert was cloned into pGEX2T, linearized previously with BamHI/EcoRI, to generate plasmid pGEX2T-E1H2.
All expression plasmids derived from PCR were verified by sequencing.
Proteins for making polyclonal antibodies.
The HCV capsid protein (aa 1191) of HCV strain RH (Lo et al., 1995
), a truncated capsid protein (aa 1115) of an HCV strain isolated from Taiwan and a partial E1 protein (aa 192328) of HCV strain RH were expressed separately in Escherichia coli. After expression, the capsid and E1 proteins were partially purified by SDSPAGE on a 13% polyacrylamide gel. Proteins were eluted for immunization in rabbits.
GST pull-down assay.
The GST pull-down assay was conducted using the Bulk GST Purification kit (Pharmacia Biotech), following the manufacturer's procedure. A sample of 10 µl of 35S-labelled, in vitro-translated protein was incubated with 2 µg purified GST or GSTcapsid fusion protein in 500 µl PBS containing 4 mM PMSF and 0·5% Triton X-100 at room temperature. At 2 h after incubation, glutathioneSepharose 4B gel slurry was added to the reaction mixture and incubation was continued for another 2 h. After washing, the precipitated products were analysed by SDSPAGE on a 13% polyacrylamide gel. A sample of 1 µl of 35S-labelled, in vitro-translated protein was loaded as the input control.
Proteinase K protection assay.
pcDNA3-CCE1 was used to express the HCV capsid and E1 proteins in vitro using the TNT Transcription·Translation system in the presence of canine pancreatic microsomal membranes (Promega). A sample of 0·5 µl of 35S-labelled, in vitro-translated protein was incubated with proteinase K (final concentration 30 µg/ml) on ice for 30 min. The incubation was stopped by adding 1 µl 200 mM PMSF. The protein samples were then analysed by SDSPAGE on a 13% polyacrylamide gel. For the disruption of the membrane, the in vitro-translated protein was treated with 1% Triton X-100.
Radioimmunoprecipitation.
Confluent HuH-7 (human hepatoma) cells maintained in Dulbeccos modified Eagles medium containing 10% foetal calf serum, 100 µg/ml penicillin/streptomycin and 100 µg/ml non-essential amino acids (Gibco BRL) were infected with a recombinant vaccinia virus (vTf7-3) carrying the T7 phage RNA polymerase gene (Fuerst et al., 1986
). At 2 h after infection, cells were transfected with 1 µg plasmid DNA using the Effectene Transfection reagent (Qiagen). At 18 h after transfection, cells were incubated in methionine-free medium for 23 h and were subsequently radiolabelled with [35S]methionine in the same medium (160 µCi/ml; 5·92 MBq/ml) for 12 h. Cells were lysed with 1 ml RIPA buffer (50 mM TrisHCl, pH 7·5, 300 mM NaCl, 4 mM EDTA, 0·5% Triton X-100, 0·1% SDS and 0·5% sodium deoxycholate) and immunoprecipitated with either 2·5 µl rabbit anti-capsid and/or anti-E1 antibody. Protein samples were then analysed by SDSPAGE on a 13% polyacrylamide gel.
Immunofluorescence.
HuH-7 cells infected with the recombinant vaccinia virus and transfected with the expression plasmids were fixed with -20 °C acetone for 2 min. The rabbit anti-capsid or anti-E1 antibody, diluted 1:200 in PBS containing 0·05% NaN3, 0·02% saponin and 1% BSA, was used as the primary antibody. The secondary antibody used was FITC-conjugated goat anti-rabbit antibody.
| Results |
|---|
|
|
|---|
|
Possible E1 topology: proteinase K protection assay
Based on the hydrophobicity of the E1 protein, there are two hydrophobic domains (H1 and H2) (Takamizawa et al., 1991
). H1 spans from aa 261 to 291, while H2 spans from aa 329 to 383. Based on amino acid hydrophobicity, there are two most likely models for the topology of the E1 protein (Fig. 2
): the first is that a short peptide (aa 364368) in the H2 domain is exposed in the cytosolic phase (model a) and the second is that the entire H2 domain is located in the membrane (model b). To study the topology of the E1 protein, we have performed previously trypsin-digestion protection assays in cells (Lo et al., 1996
). These data indicated that the E1 protein resides mostly, if not entirely, in the endoplasmic reticulum (ER) membrane and/or lumen. To study whether there is a short peptide (aa 364368) in the H2 domain exposed in the cytosolic phase, we have performed a proteinase K protection assay using in vitro-translated proteins. As shown in Fig. 3
, the intact, glycosylated E1 protein was protected by microsomal membranes when treated with proteinase K (Fig. 3
, lane 3), while the capsid protein was not. No obvious reduction in size of the E1 protein (e.g. a removal of 20 aa from the C terminus of E1) was observed. This result is similar to that of a previous report (Hijikata et al., 1991
), suggesting that the topology of the E1 protein was likely to be that of model B. This implies that the E1 protein does not interact with the capsid protein in the cytosolic phase.
|
|
|
The E1 protein without the H1 domain could not interact well with the capsid protein in vivo
We have shown previously that the E1 protein without the H2 domain could not interact with the capsid protein in cells (Lo et al., 1996
). This may be due to the fact that the H2 domain is the retention signal of the E1 protein in the ER (Cocquerel et al., 1999
). To determine the importance of the H1 domain in binding in vivo, the capsid protein and the E1 protein without the H1 domain were expressed together in HuH-7 cells. Similar to the subcellular localization of the E1 protein and the E1 protein without the H2 domain (Fig. 5a
, b
), the E1 protein without the H1 domain stains as a perinuclear protein (Fig. 5c
). In the immunoprecipitation experiment, unlike the complete E1 protein (Fig. 6b
, lane 2), the E1 protein lacking the H1 domain could not be co-immunoprecipitated with anti-capsid antibodies when in the presence of the capsid protein (Fig. 6a
, b
, lanes 2 and 3, respectively).
|
|
|
| Discussion |
|---|
|
|
|---|
There are two hydrophobic domains in the E1 protein based on its hydrophobicity (Takamizawa et al., 1991
): H1 (aa 261291) and H2 (aa 329383). Based on the topology of E1 (Fig. 2b
), the E1 protein without these two hydrophobic domains would not interact with capsid protein in cells. The interaction between the capsid and the E1 protein without these two hydrophobic domains (C328D) in vitro, which would not likely occur in cells, is due to the involvement of the E1 protein sequence exposed in the ER lumen (Fig. 4b
). Therefore, binding between the capsid and the E1 proteins in vitro would not be the same as that in vivo. However, the comparison of the binding efficiencies of various E1 mutant proteins with the capsid protein in vitro could still identify sequences of the E1 protein that are important for the interaction with capsid protein.
In the in vitro GST pull-down assay (Fig. 4b
, c
), the E1 protein lacking the H2 domain is better than that with the H2 domain (C328>C383 and C328D>C383D) in binding the capsid protein. This suggests that the H2 domain may interfere with the interaction between the capsid and the E1 proteins. This is supported by the observation that serially truncated E1 proteins (to aa 370, 360, 340 and 328) could still interact with the capsid protein with at least the same affinity as that of full-length E1 in vitro (Figs 1
and 4
). On the other hand, the E1 protein with the H1 domain is better than that without H1 domain (C383>C383D and C328>C328D) in binding the capsid protein. Therefore, the H1 domain of the E1 protein is more important than the H2 domain in binding the capsid protein in vitro. These data do not conflict with our previous finding that the H2 domain is essential for the interaction of the E1 protein with the capsid protein in cells (Lo et al., 1996
), because the H2 domain is the retention signal for the E1 protein in the ER membrane (Cocquerel et al., 1999
). To verify that the H1 domain of the E1 protein is indeed important for binding the capsid protein, the HCV capsid protein was co-expressed with downstream E1 protein without the H1 domain (E1D) in cells. The immunoprecipitation assay (Fig. 6
) showed that without the H1 domain, the E1 protein could not bind well with the capsid protein.
If the interaction between the HCV capsid and the E1 proteins occurs in the ER membrane and the H1 domain of the E1 protein is important for this interaction, it is reasonable to assume that the hydrophobic domain (aa 119152) of the capsid protein is involved in this interaction as well. It is difficult to prove this assumption because the capsid protein without this hydrophobic domain is relatively labile (Fig. 7
). Furthermore, in some instances, the majority of the capsid proteins lacking the hydrophobic domain stain as nuclear proteins (Fig. 5d
). This argues for the importance of this hydrophobic domain (aa 119152) in the association of capsid protein with the ER membrane. The capsid protein without this hydrophobic domain (C115) could not interact with serial E1 deletion proteins in vitro to the same efficiency as capsid protein with this hydrophobic domain (C153) (Fig. 1b
, c
). This argues for the importance of this hydrophobic domain in binding with E1 protein.
In other flaviviruses, the hydrophobic C-termini of both prM and E proteins are highly conserved and could be involved in envelopenucleocapsid interactions (Rice, 1996
). However, the H1 domain of the HCV E1 protein is not the most conserved region in this protein (Bukh et al., 1993
). Nor is the hydrophobic domain of the capsid protein the most conserved region in this protein (Bukh et al., 1994
). It may imply that the interaction between the HCV capsid and the E1 proteins depends on hydrophobic interactions but not sequence-specific interactions.
It has been demonstrated that the correct folding of the HCV E1 protein depends on the presence of the E2 protein (Deleersnyder et al., 1997
). Therefore, the interaction between the E1 and the capsid proteins is not dependent on conformation. In addition to being the signals for ER retention, the C-terminal hydrophobic domains of E1 and E2 are also responsible for E1/E2 heterodimerization (Charloteaux et al., 2002
; Op De Beeck et al., 2001
). Our data showed that the H1 domain of the E1 protein is important in binding with the capsid protein in vitro and that the H2 domain may interfere with this interaction (Fig. 4
). During the assembly of HCV particles, it is possible that the E2 protein helps the correct folding of the E1 protein by interacting with the H2 domain and subsequently facilitating the H1 domain to interact with the capsid protein.
Based on these data, a possible model for the E1 protein was proposed in Fig. 8
. This model explains why both hydrophobic domains of the HCV E1 proteins are required for the interaction with capsid protein in cells. The H2 domain is the retention signal for the E1 protein in the ER membrane, while the H1 domain is involved in binding with capsid protein.
|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bukh, J., Purcell, R. H. & Miller, R. H. (1993). At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative E1 gene of isolates collected worldwide. Proceedings of the National Academy of Sciences, USA 90, 8234-8238.
Bukh, J., Purcell, R. H. & Miller, R. H. (1994). Sequence analysis of the core gene of 14 hepatitis C virus genotypes. Proceedings of the National Academy of Sciences, USA 91, 8239-8243.
Charloteaux, B., Lins, L., Moereels, H. & Brasseur, R. (2002). Analysis of the C-terminal membrane anchor domains of hepatitis C virus glycoproteins E1 and E2: toward a topological model. Journal of Virology 76, 1944-1958.
Cocquerel, L., Duvet, S., Meunier, J.-C., Pillez, A., Cacan, R., Wychowski, C. & Dubuisson, J. (1999). The transmembrane domain of hepatitis C virus glycoprotein E1 is a signal for static retention in the endoplasmic reticulum. Journal of Virology 73, 2641-2649.
Deleersnyder, V., Pillez, A., Wychowski, C., Blight, K., Xu, J., Hahn, Y. S., Rice, C. M. & Dubuisson, J. (1997). Formation of native hepatitis C virus glycoprotein complexes. Journal of Virology 71, 697-704.[Abstract]
Dubuisson, J., Hsu, H. H., Cheung, R. C., Greenberg, H. B., Russell, D. G. & Rice, C. M. (1994). Formation and intracellular localization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia and Sindbis viruses. Journal of Virology 68, 6147-6160.
Fuerst, T. R., Niles, E. G., Studier, F. W. & Moss, B. (1986). Eucaryotic transient-expression system based on recombinant vaccinia virus that synthesize bacteriophage T7 RNA polymerase. Proceedings of the National Academy of Sciences, USA 83, 8122-8126.
Grakoui, A., Wychowski, C., Lin, C., Feinstone, S. M. & Rice, C. M. (1993). Expression and identification of hepatitis C virus polyprotein cleavage products. Journal of Virology 67, 1385-1395.
Heim, M. H., Moradpour, D. & Blum, H. E. (1999). Expression of hepatitis C virus proteins inhibits signal transduction through the Jak-STAT pathway. Journal of Virology 73, 8469-8475.
Hijikata, M., Kato, N., Ootsuyama, Y., Nakagawa, M. & Shimotohno, K. (1991). Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis. Proceedings of the National Academy of Sciences, USA 88, 5547-5551.
Houghton, M. (1996). Hepatitis C virus. In Fields Virology , pp. 1035-1095. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Hsieh, T.-Y., Matsumoto, M., Chou, H.-C., Schneider, R., Hwang, S.-B., Lee, A. S. & Lai, M. M. (1998). Hepatitis C virus core protein interacts with heterogeneous nuclear ribonucleoprotein K. Journal of Biological Chemistry 273, 17651-17659.
Lai, M. M. & Ware, C. F. (2000). Hepatitis C virus core protein: possible roles in viral pathogenesis. Current Topics in Microbiology and Immunology 242, 117-134.[Medline]
Lo, S.-Y. & Ou, J.-H. (1998). Expression and dimerization of hepatitis C virus core protein in E. coli. In Methods in Molecular Medicine , pp. 325-330. Edited by J. Y. N. Lau. Totowa, NJ:Humana Press.
Lo, S.-Y., Masiarz, F., Hwang, S.-B., Lai, M. M. C. & Ou, J.-H. (1995). Differential subcellular location of hepatitis C virus core gene products. Virology 213, 455-461.[Medline]
Lo, S.-Y., Selby, M. J. & Ou, J.-H. (1996). Interaction between hepatitis C virus core protein and E1 envelope protein. Journal of Virology 70, 5177-5182.
Lu, W., Lo, S.-Y., Chen, M., Wu, K.-J., Fung, Y. K.-T. & Ou, J.-H. (1999). Activation of p53 tumor suppressor by hepatitis C virus core protein. Virology 264, 134-141.[Medline]
Matsumoto, M., Hwang, S. B., Jeng, K.-S., Zhu, N. & Lai, M. M. C. (1996). Homotypic interaction and multimerization of hepatitis C virus core protein. Virology 218, 43-51.[Medline]
Moriya, K., Fujie, H., Shintani, Y., Yotsuyanagi, H., Tsutsumi, T., Ishibashi, K., Matsuura, Y., Kimura, S., Miyamura, T. & Koike, K. (1998). The core protein of hepatitis C virus induces hepatocellular carcinoma in transgenic mice. Nature Medicine 4, 1065-1067.[Medline]
Op De Beeck, A., Cocquerel, L. & Dubuisson, J. (2001). Biogenesis of hepatitis C virus envelope glycoproteins. Journal of General Virology 82, 2589-2595.
Ray, R. B., Lagging, L. M., Meyer, K., Steele, R. & Ray, R. (1995). Transcriptional regulation of cellular and viral promoters by the hepatitis C virus core protein. Virus Research 37, 209-220.[Medline]
Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology , pp. 931-959. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Santolini, E., Migliaccio, G. & La Monica, N. (1994). Biosynthesis and biochemical properties of the hepatitis C virus core protein. Journal of Virology 68, 3631-3641.
Shimoike, T., Mimori, S., Tani, H., Matsuura, Y. & Miyamura, T. (1999). Interaction of hepatitis C virus core protein with viral sense RNA and suppression of its translation. Journal of Virology 73, 9718-9725.
Shrivastava, A., Manna, S. K., Ray, R. & Aggarwal, B. B. (1998). Ectopic expression of hepatitis C virus core protein differentially regulates nuclear transcription factors. Journal of Virology 72, 9722-9728.
Takamizawa, A., Mori, C., Fuke, I., Manabe, S., Murakami, S., Fujita, J., Onishi, E., Andoh, T., Yoshida, I. & Okayama, H. (1991). Structure and organization of the hepatitis C virus genome isolated from human carriers. Journal of Virology 65, 1105-1113.
Trepo, C., Vierling, J., Zeytin, F. N. & Gerlich, W. H. (1997). The first Flaviviridae symposium. Intervirology 40, 279-288.[Medline]
Yasui, K., Wakita, T., Tsukiyama-Kohara, K., Funahashi, S.-I., Ichikawa, M., Kajita, T., Moradpour, D., Wands, J. R. & Kohara, M. (1998). The native form and maturation process of hepatitis C virus core protein. Journal of Virology 72, 6048-6055.
Yi, M. K., Nakamoto, Y., Kaneko, S., Yamashita, T. & Murakami, S. (1997). Delineation of regions important for heteromeric association of hepatitis C virus E1 and E2. Virology 231, 119-129.[Medline]
Received 1 March 2002;
accepted 23 July 2002.
This article has been cited by other articles:
![]() |
L.-S. Ai, Y.-W. Lee, and S. S.-L. Chen Characterization of Hepatitis C Virus Core Protein Multimerization and Membrane Envelopment: Revelation of a Cascade of Core-Membrane Interactions J. Virol., October 1, 2009; 83(19): 9923 - 9939. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Phan, R. K. F. Beran, C. Peters, I. C. Lorenz, and B. D. Lindenbach Hepatitis C Virus NS2 Protein Contributes to Virus Particle Assembly via Opposing Epistatic Interactions with the E1-E2 Glycoprotein and NS3-NS4A Enzyme Complexes J. Virol., September 1, 2009; 83(17): 8379 - 8395. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kota, C. Coito, G. Mousseau, J.-P. Lavergne, and A. D. Strosberg Peptide inhibitors of hepatitis C virus core oligomerization and virus production J. Gen. Virol., June 1, 2009; 90(6): 1319 - 1328. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakai, T. Okamoto, T. Kimura-Someya, K. Ishii, C. K. Lim, H. Tani, E. Matsuo, T. Abe, Y. Mori, T. Suzuki, et al. Oligomerization of Hepatitis C Virus Core Protein Is Crucial for Interaction with the Cytoplasmic Domain of E1 Envelope Protein J. Virol., November 15, 2006; 80(22): 11265 - 11273. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Klein, S. R. Dellos, and J. R. Lingappa Identification of Residues in the Hepatitis C Virus Core Protein That Are Critical for Capsid Assembly in a Cell-Free System J. Virol., June 1, 2005; 79(11): 6814 - 6826. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Meyer, A. Beyene, T. L. Bowlin, A. Basu, and R. Ray Coexpression of Hepatitis C Virus E1 and E2 Chimeric Envelope Glycoproteins Displays Separable Ligand Sensitivity and Increases Pseudotype Infectious Titer J. Virol., December 1, 2004; 78(23): 12838 - 12847. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Majeau, V. Gagne, A. Boivin, M. Bolduc, J.-A. Majeau, D. Ouellet, and D. Leclerc The N-terminal half of the core protein of hepatitis C virus is sufficient for nucleocapsid formation J. Gen. Virol., April 1, 2004; 85(4): 971 - 981. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Blanchard, C. Hourioux, D. Brand, M. Ait-Goughoulte, A. Moreau, S. Trassard, P.-Y. Sizaret, F. Dubois, and P. Roingeard Hepatitis C Virus-Like Particle Budding: Role of the Core Protein and Importance of Its Asp111 J. Virol., September 15, 2003; 77(18): 10131 - 10138. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |