|
|
||||||||
Animal: RNA Viruses |
Plant Research International, PO Box 16, 6700 AA Wageningen, The Netherlands1
De Ruiter Seeds, PO Box 1050, 2660 BB Bergschenhoek, The Netherlands2
Unité de Phytopathologie, IRD, BP 5045 Montpellier, France3
Author for correspondence: Manuela van Munster. Fax +31 317 410113. e-mail m.vanmunster{at}plant.wag-ur.nl
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Since the molecular characterization of Acyrthosiphon pisum virus (van der Wilk et al., 1997
), the nucleotide sequences of the genomes of several insect RNA viruses have been determined (Johnson & Christian, 1998
; Moon et al., 1998
). The availability of molecular data has enabled a new classification of insect picorna-like viruses. While Infectious flacherie virus (Isawa et al., 1998
) and Sacbrood virus (Ghosh et al., 1999
) have a genomic organization that resembles that of mammalian picornaviruses, Acyrthosiphon pisum virus could not be classified in any recognized taxon. Genome sequence analysis has shown that most of the insect RNA viruses belong to the genus of Cricket paralysis-like viruses (Christian et al., 2000
), recently renamed Cripavirus (family Dicistroviridae) (Mayo, 2002
). Whilst there is sequence relatedness between these viruses and the mammalian picornaviruses, there are also some fundamental differences. The genome of mammalian picornaviruses consists of a positive-strand RNA containing a single large open reading frame (ORF) that encodes the capsid precursor in its 5' end and the non-structural protein precursor in its 3' part (Minor et al., 1995
). In contrast, the genome of the dicistroviruses contains two ORFs that are separated by an intergenic region (IGR). The non-structural proteins are encoded in the 5' ORF and the capsid proteins are encoded in the downstream ORF. Moreover, it has been shown for Rhopalosiphum padi virus (RhPV), Plautia stali intestine virus (PSIV) and Cricket paralysis virus (CrPV) that translation of ORF2 is cap-independent (Domier et al., 2000
; Sasaki & Nakashima, 2000
; Wilson et al., 2000a
). In these three viruses, the non-coding region upstream of ORF2 functions as an internal ribosome entry site (IRES) that contains a pseudoknot that directs translation initiation at a non-AUG codon. Two other viruses, Drosophila C virus (DCV; Johnson & Christian, 1998
) and Triatoma virus (TrV; Czibener et al., 2000
), harbour nucleotide sequences highly similar to the IRES of PSIV, RhPV and CrPV, suggesting the presence of an IRES for these viruses as well. ALPV is serologically related to CrPV (Williamson et al., 1988
) and is possibly a member of the Dicistroviridae, like Acute bee paralysis virus (ABPV; Govan et al., 2000
), Himetobi P virus (HiPV; Nakashima et al., 1999
), Taura syndrome virus (TSV; Mari et al., 2002
) and Black queen cell virus (BQCV; Leat et al., 2000
).
In this paper, the complete nucleotide sequence of the ALPV genomic RNA is reported. Analysis of the sequence revealed the presence of two ORFs. The non-structural proteins were mapped in the 5' ORF, while the 3' ORF encoded the capsid protein subunits. It is concluded from the genomic organization that ALPV is a member of the Dicistroviridae. Phylogenetic analysis of the putative non-structural polyprotein and capsid proteins enabled the classification of ALPV among members of the Dicistroviridae. In addition, infectivity studies showed that the occurrence of ALPV was not restricted to aphid hosts, and the virus could also infect a member of the family Aleyrodidae.
| Methods |
|---|
|
|
|---|
Virus purification and RNA isolation.
Northern blot analysis.
Total RNA from 100 mg of healthy and ALPV-infected aphids was isolated by employing the Plant Total RNA kit (Qiagen), according to the manufacturers instructions. In order to detect specific ALPV sequences, 16 µg of the purified RNA was separated on a 1% agarose gel containing formaldehyde (Sambrook et al., 1989
), transferred to a Hybond-N membrane (Amersham) and probed with a 720 nt radiolabelled cDNA fragment (nt 90929812 of the ALPV genome).
Synthesis and cloning of cDNA.
Synthesis of cDNA was carried out by priming with oligo(dT) primers using the SuperScript System (Gibco-BRL) according to the suppliers instructions. The double-stranded cDNA fragments were ligated in the EcoRI site of the
ZAP II vector (Stratagene). The ligation mixture was used to transform Escherichia coli host strain XL-1 Blue MRF. Identification and isolation of recombinant clones was done by following standard procedures (Sambrook et al., 1989
).
The cDNA of the 5'-terminal sequence of the ALPV genomic RNA was synthesized by RTPCR using a 5' RACE kit (Gibco-BRL). The tailing reaction in the RACE procedure was performed with TdT and dCTP. PCR fragments were cloned using the TA cloning kit (Invitrogen), according to the manufacturers instructions.
Sequence determination.
Nucleotide sequencing was performed with an Applied Biosystems model 373 automated sequencer, employing a sequencing kit with AmpliTaq DNA polymerase (Applied Biosystems) and universal and ALPV sequence-specific primers.
The sequence of the ALPV genomic RNA was determined by sequencing both strands of three independently obtained, overlapping cDNA clones covering the whole genome, and was confirmed by sequence analysis of another three cDNA clones on one strand. RTPCR was carried out to amplify a 300 nt region to elucidate the beginning of the first ORF. Fragments were cloned and four of the clones obtained were analysed. The primers used in the RTPCR procedure were identical to nt 392412 and complementary to nt 707727 of the ALPV genome.
Computer analysis of nucleic acid and deduced protein sequences.
All computational sequence analysis was done using the Wisconsin package version 10.1 [Genetics Computer Group (GCG), Madison, WI, USA] and the BLAST suite (Altschul et al., 1990
). Multiple alignments were performed with CLUSTAL (Thompson et al., 1994
). Phylogenetic trees were constructed using the neighbour-joining method (Saitou & Nei, 1987
). For each tree, confidence levels were estimated using the bootstrap resampling procedure (1000 trials). The sequences (with accession numbers) used in the alignments were: DCV (AF014388), PSIV (AB006531), Cowpea mosaic virus (CPMV; P03600, X00729), RhPV (AF022937), BQCV (AF183905), HiPV (AB017037), CrPV (AF218039), TrV (AF178440), ABPV (AF150629) and TSV (AF277675).
Infection experiments.
Membrane feeding experiments were carried out for inoculation with ALPV of small-grain aphids (Rhopalosiphum padi, Schizaphis graminum and Metopolophium dirhodum), the green peach aphid Myzus persicae and the whitefly Trialeurodes vaporariorum. Aphid nymphs and adult whiteflies were allowed to feed on a 15% sucrose diet containing 0·01 and 1 mg/ml, respectively, of purified ALPV. Aphids and whiteflies feeding on a virus-free diet served as negative controls. After an acquisition period of 24 h, nymphs of R. padi, S. graminum and M. dirhodum were transferred to Avena sativa plants. M. persicae nymphs and adults of T. vaporariorum were respectively transferred to plants of Brassica oleracea and Phaseolus vulgaris. The presence of the virus was assayed 10 days later by double-antibody sandwich (DAS)-ELISA using two aphids or ten whiteflies per sample. Samples of 30 µl of the virus-free diet and of the diet containing 1 mg/ml ALPV were respectively used as negative and positive controls. Specific antibodies directed against ALPV were used to detect the virus in the samples. Moreover, the presence of the viral RNA within whiteflies was checked by RTPCR. The total RNA of ten mock-inoculated or ten ALPV-inoculated whiteflies was extracted using the RNeasy Total kit (Qiagen) according to the manufacturers instructions. Ten µl of the total RNA obtained (diluted to 30 µl final volume) was used in an RTPCR procedure with specific ALPV primers. Primers sequences were as follows: upstream primer ALPV1 (5' ATCTTCGCAGTGTTATTGGC 3'); downstream primer ALPV2 (5' GGAATAGCATCTAAGGGTTC 3'). PCR products obtained were analysed on agarose gels.
| Results |
|---|
|
|
|---|
At a concentration of 0·01 mg/ml purified virus, 5060% of R. padi aphids inoculated became ALPV-infected when tested by ELISA after 10 days. The other aphid species tested, S. graminum, M. dirhodum and M. persicae, also became infected after membrane-feeding experiments (Table 1
). Surprisingly, adult whiteflies could also acquire the virus from a diet containing 1 mg/ml purified ALPV. ALPV was still present in the whiteflies 10 days later when assayed by ELISA (Fig. 1
). It is most likely that the whiteflies became infected with ALPV, since the viral RNA was still present in the insect 10 days after the end of the feeding period, as shown by RTPCR (Fig. 1
).
|
|
The base composition of the entire genome is A (31·2%), U (30·2%), C (19·4%), G (19·2%). ALPV therefore resembles dicistroviruses and other insect picorna-like viruses.
Some 87% of the genome encodes two large ORFs, which are located on the same positive RNA strand but not in the same reading frame (Fig. 2
). The other 13% of the genome consists of untranslated regions (UTRs). These UTRs span positions 1506 of the 5' end (5'-UTR), the last 571 nt of the 3' end (3'-UTR) and the IGR (162 nt). In both the 5'-UTR and the IGR, three stemloops were identified using the program MFOLD (Jacobson & Zuker, 1993
), respectively between nt 300493 and nt 66606802. Sequence comparison revealed that the IGRs of the different members of the Dicistroviridae and ALPV were well conserved (Fig. 3
), whereas no sequence similarity could be detected in the 5'-UTRs of the viruses. The IGR of ALPV shared 66% sequence identity with the equivalent region of DCV and 64% with the IGR of RhPV. Moreover, a 5 nt inverted repeat sequence previously noted in other dicistroviruses was also present in the ALPV IGR. The first part of this inverted repeat sequence (located 20 nt upstream of the capsid coding region) is part of a loop in a stemloop structure, while the second part of the inverted repeat is probably part of the first codon of the second ORF (CCU), as demonstrated for CrPV (Wilson et al., 2000a
), PSIV (Sasaki & Nakashima, 1999
) and RhPV (Domier et al., 2000
).
|
|
The deduced amino acid sequence of the ALPV 5' ORF was compared with entries in protein sequence databases. This revealed the highest similarity to the non-structural proteins of RhPV, DCV and CrPV (respectively 38, 33 and 29% identity). Sequence similarity was also found to the non-structural proteins of the Picornaviridae, Sequiviridae and Caliciviridae. Motifs characteristic of helicases, 3C-like proteases and RNA-dependent RNA polymerases, conserved among the Picornaviridae, Comoviridae, Sequiviridae and Caliciviridae (Koonin & Dolja, 1993
), were identified in the 5' ORF product of ALPV (Fig. 2
).
The N-terminal region of the 5' ORF product (aa 400800) contained conserved motifs characteristic of helicases and showed 67% identity to the putative helicase domain of RhPV. Two (A and B) of the three motifs conserved in helicase domains were recognized (Koonin & Dolja, 1993
). Motif A, with the consensus sequence GX4GK (aa 569576), which is proposed to be responsible for nucleotide binding (Gorbalenya et al., 1989
), and motif B, WDGY (aa 612615), were highly conserved in the putative 5' ORF product of ALPV.
A region similar to the conserved domain of 3C-like proteases was detected in the 5' ORF product (aa 12001500). The core motif, GXCG, was identified at residue 1411 of the putative ALPV 5' ORF product. However, the RNA-binding region of picornavirus 3C proteases (KFRDI; Ryan & Flint, 1997
) was not detected.
In the C-terminal region of the putative 5' ORF product (aa 15502000), the conserved motifs of the putative RNA-dependent RNA polymerase (Koonin, 1991
) were present. The highest sequence identity was observed to the putative RNA-dependent RNA polymerase of RhPV, which showed 53% identity to this region of the ALPV 5' ORF product.
Capsid proteins
The second ORF (3' ORF), located in a different reading frame from the 5' ORF, starts at position 6808 and stops at position 9243 of the ALPV genome. The first AUG start codon in the 3' ORF is present 36 nt downstream of the start of the 3' ORF. However, on basis of sequence similarities of ALPV to the dicistroviruses and the presence of a CCU codon at position 6820, which is part of the aforementioned 5 nt inverted repeat, it is assumed that the beginning of the coding region is at position 6820, not at residue 6844. The 3' ORF encodes a polypeptide of 807 aa, corresponding to a molecular mass of 89·2 kDa. Amino acid sequence comparisons revealed that the ALPV 3' ORF product showed sequence similarity to the capsid proteins of the other members of the Dicistroviridae, Picornaviridae, Sequiviridae and Caliciviridae. The ALPV 3' ORF product respectively shared 38, 29 and 28% sequence identity with the capsid protein sequences of RhPV, DCV and CrPV. This indicates that the three major capsid proteins of 34, 32, 31 kDa and the minor one of 40·8 kDa detected on polyacrylamide gels (Williamson et al., 1988
) result from processing of the ALPV 3' ORF product. The structural protein of dicistroviruses, like picornaviruses (Palmenberg, 1990
), possesses specific cleavage sites that are recognized by the 3C-like protease. Published peptide sequences of cleavage sites determined by N-terminal sequencing of the capsid proteins of several dicistroviruses were aligned with the ALPV 3' ORF product. The putative cleavage sites at CP1/CP4 (analogous to VP4 of picornaviruses) (TAQ/VGT), CP4/CP2 (FGW/SKP) and CP2/CP3 (IAQ/VNV) were identified in the ALPV 3' ORF product at positions 241, 299 and 564, respectively (Fig. 4
), leading to proteins of 25, 32 and 28 kDa.
|
|
| Discussion |
|---|
|
|
|---|
The IGR of the dicistroviruses forms stemloop structures that act as an IRES (Sasaki & Nakashima, 1999
) in which the 3'-terminal stemloop is part of a pseudoknot structure. This structure leads to the start of translation of the 3' ORF at a non-AUG codon (Sasaki & Nakashima, 2000
). Recently, it has been shown that ribosomes bind the IGR-IRES of CrPV directly at the pseudoknot, and do not require the complete set of initiation factors, suggesting a novel mechanism of initiation of translation (Wilson et al., 2000b
). The IGR of ALPV shows structural similarities to the IGRs of various dicistroviruses and harbours a 5 nt inverted repeat at the 3' part of the IGR that is conserved in these viruses. Moreover, amino acid sequence similarities between the putative 3' ORF product of ALPV and the 3' ORF product of the dicistroviruses were detected upstream of the first methionine present in the second ORF. Furthermore, ALPV, like other dicistroviruses, does not produce subgenomic RNA, as demonstrated when carrying out a Northern blot procedure using infected R. padi aphids and purified virus (data not shown). Therefore, it is concluded that the start of translation of the ALPV 3' ORF probably occurs at a non-AUG codon via a pseudoknot structure. Analysis of the 5'-UTR of ALPV revealed the presence of three stemloop structures, which may also act as IRESs (data not shown). The 5'-UTRs of CrPV and RhPV have recently been shown to contain IRES elements that function in different in vitro translation systems (Wilson et al., 2000b
; Woolaway et al., 2001
) in a manner similar to those of picornaviruses (Belsham & Brangwyn, 1990
).
Based on amino acid sequence similarities to known cleavage sites of dicistroviruses and by analogy with those of picornaviruses, three putative cleavage sites could be identified in the ALPV 3' ORF product, at residues 241 (TAQ/VGT), 299 (FGW/SKP) and 564 (IAQ/VNV). It is known that most cleavage reactions catalysed by the picornavirus 3C protease occur within a small subset of dipeptides comprising QG, S, T, V, A and M (Hellen et al., 1989
). The putative cleavage sites of CP1/CP4 and CP2/CP3 of the ALPV 3' ORF product have the same dipeptide, QV, and the sequences flanking these sites are similar to each other. These residues surrounding the QV dipeptide might influence cleavage efficiency and are therefore conserved (Pallai et al., 1989
). While most of the cleavage sites of the picornaviruses harbour a proline residue in position 2 upstream of the cleavage junction (P2), an alanine residue seems to be prevalent at this position in dicistroviruses. Moreover, the prevalence of an alanine or other aliphatic residue at the P4 position has been shown in the cleavage site of picornaviruses (Nicklin et al., 1986
). The same observation could be made when the peptide sequences of cleavage sites of dicistroviruses were aligned. The putative cleavage site at CP4/CP2 occurs at a WS dipeptide. By analogy with picornaviruses, it is suggested that the CP4/CP2 cleavage in dicistroviruses occurs after capsid formation (Sasaki et al., 1998
). This cleavage site is located inside the mature particle, as shown for CrPV (Tate et al., 1999
), and is therefore inaccessible to the viral proteases. In picornaviruses, the cleavage of VP0 into CP4 and CP2 probably results from the suitable juxtaposition of catalytic residues in the assembled particle (Basavappa et al., 1994
), and the same mechanism may occur in dicistroviruses. The cleavage site at CP4/CP2 (FS, WS or FK) of ALPV and other dicistroviruses does not have the dipeptide preferred by 3C-like proteases, and the cleavage probably occurs catalytically.
The molecular masses of CP1, CP2 and CP3 calculated from the putative 3' ORF product (respectively 25, 32 and 28 kDa) are fairly consistent with the masses determined on SDSPAGE (34, 32 and 31 kDa). However, the discrepancy between the values for the mass of CP1 (25 versus 31 kDa) could be attributed to post-translational modifications, as suggested for BQCV (Leat et al., 2000
).
Sequence comparison showed that the putative non-structural proteins and the putative capsid proteins of ALPV shared a high level of sequence similarity with RhPV, a member of the Dicistroviridae. RhPV is also a virus that infects small-grain aphids and was first purified from R. padi (DArcy et al., 1981
). Phylogenetic analysis suggested the presence of two major clusters among the dicistroviruses. One cluster contains ALPV, RhPV, DCV, CrPV and possibly ABPV, while the second cluster harbours PSIV, BQCV, TrV and HiPV. TSV seems to be more distantly related and forms a separate group.
Studies to date have shown that ALPV infects mainly aphids that infest small grains, such as S. graminum, M. dirhodum, Rhopalosiphum maidis and Diuraphis noxia (Williamson et al., 1988
). In our study, we have shown that ALPV can also infect a member of the family Aleyrodidae. The host range of dicistroviruses varies considerably depending on the virus. While CrPV has a broad host range and can infect species of different insect orders (Scotti et al., 1981
), RhPV infection is restricted to aphid species (DArcy et al., 1981
). To date, there are only a few reports of viruses that infect whiteflies. Costa et al. (1996)
described the presence of virus-like particles approximately 30 nm in diameter in the mycetocytes of Bemisia tabaci. Recently, a DNA virus belonging to the family Iridoviridae was reported to infect B. tabaci (Hunter et al., 2001
). However, the pathogenicity of these viruses was not determined.
Whiteflies and aphids cause economic losses worldwide because of their feeding behaviour and their role as vectors of plant viruses. Therefore, control of these insect pests is needed. Current measures of control rely largely upon frequent applications of hazardous insecticides during the growing season. The extensive use of insecticides has led to widespread development of resistance in many aphid and whitefly species and this represents one of the major threats to the future success of chemical pest control. The development of non-chemical biological agents like insect viruses may lead to a significant reduction in the use of and dependence on insecticides. In this context, the potential of ALPV to infect species of both the families Aphididae and Aleyrodidae might open a window of opportunity for biological control of these insect pests.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Basavappa, R., Syed, R., Flore, O., Icenogle, J. P., Filman, D. J. & Hogle, J. M. (1994). Role and mechanism of the maturation cleavage of VP0 in poliovirus assembly: structure of the empty capsid assembly intermediate at 2·9
resolution. Protein Science 3, 1651-1669.[Abstract]
Belsham, G. J. & Brangwyn, J. K. (1990). A region of the 5' noncoding region of foot-and-mouth disease virus RNA directs efficient internal initiation of protein synthesis within cells: involvement with the role of L protease in translational control. Journal of Virology 64, 5389-5395.
Christian, P., Carstens, E., Domier, L., Johnson, K., Nakashima, N., Scotti, P. & van der Wilk, F. (2000). Genus Cricket paralysis-like viruses. In Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses , pp. 678-683. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle & R. B. Wickner. San Diego:Academic Press.
Costa, H. S., Westcot, D. M., Ullman, D. E., Rosell, R. C., Brown, J. K. & Johnson, M. W. (1996). Virus-like particles in the mycetocytes of the sweetpotato whitefly, Bemisia tabaci (Homoptera, Aleyrodidae). Journal of Invertebrate Pathology 67, 183-186.[Medline]
Czibener, C., La Torre, J. L., Muscio, O. A., Ugalde, R. A. & Scodeller, E. A. (2000). Nucleotide sequence analysis of Triatoma virus shows that it is a member of a novel group of insect RNA viruses. Journal of General Virology 81, 1149-1154.
DArcy, C. J., Burnett, P. A., Hewings, A. D. & Goodman, R. M. (1981). Purification and characterization of a virus from the aphid Rhopalosiphum padi. Virology 112, 346-349.
Domier, L. L., McCoppin, N. K. & DArcy, C. J. (2000). Sequence requirements for translation initiation of Rhopalosiphum padi virus ORF2. Virology 268, 264-271.[Medline]
Ghosh, R. C., Ball, B. V., Willcocks, M. M. & Carter, M. J. (1999). The nucleotide sequence of sacbrood virus of the honey bee: an insect picorna-like virus. Journal of General Virology 80, 1541-1549.[Abstract]
Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P. & Blinov, V. M. (1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Research 17, 4713-4730.
Govan, V. A., Leat, N., Allsopp, M. & Davison, S. (2000). Analysis of the complete genome sequence of acute bee paralysis virus shows that it belongs to the novel group of insect-infecting RNA viruses. Virology 277, 457-463.[Medline]
Hellen, C. U. T., Krausslich, H.-G. & Wimmer, E. (1989). Proteolytic processing of polyproteins in the replication of RNA viruses. Biochemistry 28, 9881-9890.[Medline]
Hunter, W. B., Patte, C. P., Sinisterra, X. H., Achor, D. S., Funk, C. J. & Polston, J. E. (2001). Discovering new insect viruses: whitefly iridovirus (Homoptera: Aleyrodidae: Bemisia tabaci). Journal of Invertebrate Pathology 78, 220-225.[Medline]
Isawa, H., Asano, S., Sahara, K., Iizuka, T. & Bando, H. (1998). Analysis of genetic information of an insect picorna-like virus, infectious flacherie virus of silkworm: evidence for evolutionary relationships among insect, mammalian and plant picorna(-like) viruses. Archives of Virology 143, 127-143.[Medline]
Jacobson, A. B. & Zuker, M. (1993). Structural analysis by energy dot plot of a large mRNA. Journal of Molecular Biology 233, 261-269.[Medline]
Johnson, K. N. & Christian, P. D. (1998). The novel genome organization of the insect picorna-like virus Drosophila C virus suggests this virus belongs to a previously undescribed virus family. Journal of General Virology 79, 191-203.[Abstract]
Koonin, E. V. (1991). The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses. Journal of General Virology 72, 2197-2206.
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Medline]
Laubscher, J. M. & von Wechmar, M. B. (1992). Influence of aphid lethal paralysis virus and Rhopalosiphum padi virus on aphid biology at different temperatures. Journal of Invertebrate Pathology 60, 134-140.
Laubscher, J. M. & von Wechmar, M. B. (1993). Assessment of aphid lethal paralysis virus as an apparent population growth-limiting factor in grain aphids in the presence of other natural enemies. Biocontrol Science and Technology 3, 455-466.
Leat, N., Ball, B., Govan, V. & Davison, S. (2000). Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees. Journal of General Virology 81, 2111-2119.
Mari, J., Poulos, B. T., Lightner, D. V. & Bonami, J.-R. (2002). Shrimp Taura syndrome virus: genomic characterization and similarity with members of the genus Cricket paralysis-like viruses. Journal of General Virology 83, 915-926.
Mayo, M. A. (2002). Virology Division news: virus taxonomy Houston 2002. Archives of Virology 147, 1071-1076.[Medline]
Minor, P. D., Brown, F., Domingo, E., Hoey, E., King, A., Knowles, N., Lemon, S., Palmenberg, A., Rueckert, R. R., Stanway, G., Wimmer, E. & Yin-Murphy, M. (1995). Family Picornaviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses , pp. 329-336. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York:Springer-Verlag.
Moon, J. S., Domier, L. L., McCoppin, N. K., DArcy, C. J. & Jin, H. (1998). Nucleotide sequence analysis shows that Rhopalosiphum padi virus is a member of a novel group of insect-infecting RNA viruses. Virology 243, 54-65.[Medline]
Nakashima, N., Sasaki, J. & Toriyama, S. (1999). Determining the nucleotide sequence and capsid-coding region of himetobi P virus: a member of a novel group of RNA viruses that infect insects. Archives of Virology 144, 2051-2058.[Medline]
Nicklin, M. J. H., Toyoda, H., Murray, M. G. & Wimmer, E. (1986). Proteolytic processing in the replication of polio and related viruses. Bio/Technology 4, 33-42.
Pallai, P. V., Burkhardt, F., Skoog, M., Schreiner, K., Bax, P., Cohen, K. A., Hansen, G., Palladino, D. E. H., Harris, K. S., Nicklin, M. J. & Wimmer, E. (1989). Cleavage of synthetic peptides by purified poliovirus 3C proteinase. Journal of Biological Chemistry 264, 9738-9741.
Palmenberg, A. C. (1990). Proteolytic processing of picornaviral polyprotein. Annual Review of Microbiology 44, 603-623.[Medline]
Ryan, M. D. & Flint, M. (1997). Virus-encoded proteinases of the picornavirus super-group. Journal of General Virology 78, 699-723.[Medline]
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sasaki, J. & Nakashima, N. (1999). Translation initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro. Journal of Virology 73, 1219-1226.
Sasaki, J. & Nakashima, N. (2000). Methionine-independent initiation of translation in the capsid protein of an insect RNA virus. Proceedings of the National Academy of Sciences, USA 97, 1512-1515.
Sasaki, J., Nakashima, N., Saito, H. & Noda, H. (1998). An insect picorna-like virus, Plautia stali intestine virus, has genes of capsid proteins in the 3' part of the genome. Virology 244, 50-58.[Medline]
Scotti, P. D., Longworth, J. F., Plus, N., Croizier, G. & Reinganum, C. (1981). The biology and ecology of strains of an insect small RNA virus complex. Advances in Virus Research 26, 117-143.[Medline]
Tate, J., Liljas, L., Scotti, P., Christian, P., Lin, T. & Johnson, J. E. (1999). The crystal structure of cricket paralysis virus: the first view of a new virus family. Nature Structural Biology 6, 765-774.[Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.
van den Heuvel, J. F. J. M., Hummelen, H., Verbeek, M., Dullemans, A. M. & van der Wilk, F. (1997). Characteristics of Acyrthosiphon pisum virus, a newly identified virus infecting the pea aphid. Journal of Invertebrate Pathology 70, 169-176.[Medline]
van der Wilk, F., Dullemans, A. M., Verbeek, M. & van den Heuvel, J. F. J. M. (1997). Nucleotide sequence and genomic organization of Acyrthosiphon pisum virus. Virology 238, 353-362.[Medline]
Williamson, C., Rybicki, E. P., Kasdorf, G. G. F. & Von Wechmar, M. B. (1988). Characterization of a new picorna-like virus isolated from aphids. Journal of General Virology 69, 787-795.
Wilson, J. E., Powell, M. J., Hoover, S. E. & Sarnow, P. (2000a). Naturally occurring dicistronic cricket paralysis virus RNA is regulated by two internal ribosome entry sites. Molecular and Cellular Biology 20, 4990-4999.
Wilson, J. E., Pestova, T. V., Hellen, C. U. T. & Sarnow, P. (2000b). Initiation of protein synthesis from the A site of the ribosome. Cell 102, 511-520.[Medline]
Woolaway, K. E., Lazaridis, K., Belsham, G. J., Carter, M. J & Roberts, L. O. (2001). The 5' untranslated region of Rhopalosiphum padi virus contains an internal ribosome entry site which functions efficiently in mammalian, plant, and insect translation systems. Journal of Virology 75, 10244-10249.
Received 16 July 2002;
accepted 12 August 2002.
This article has been cited by other articles:
![]() |
E. Maori, S. Lavi, R. Mozes-Koch, Y. Gantman, Y. Peretz, O. Edelbaum, E. Tanne, and I. Sela Isolation and characterization of Israeli acute paralysis virus, a dicistrovirus affecting honeybees in Israel: evidence for diversity due to intra- and inter-species recombination J. Gen. Virol., December 1, 2007; 88(12): 3428 - 3438. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Ryabov A novel virus isolated from the aphid Brevicoryne brassicae with similarity to Hymenoptera picorna-like viruses J. Gen. Virol., September 1, 2007; 88(9): 2590 - 2595. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pal, S. Boyapalle, R. Beckett, W. A. Miller, and B. C. Bonning A Baculovirus-Expressed Dicistrovirus That Is Infectious to Aphids J. Virol., September 1, 2007; 81(17): 9339 - 9345. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Ongus, D. Peters, J.-M. Bonmatin, E. Bengsch, J. M. Vlak, and M. M. van Oers Complete sequence of a picorna-like virus of the genus Iflavirus replicating in the mite Varroa destructor J. Gen. Virol., December 1, 2004; 85(12): 3747 - 3755. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. de Miranda, M. Drebot, S. Tyler, M. Shen, C. E. Cameron, D. B. Stoltz, and S. M. Camazine Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus J. Gen. Virol., August 1, 2004; 85(8): 2263 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, J. Zhang, J. Lu, F. Yi, C. Liu, and Y. Hu Sequence analysis and genomic organization of a new insect picorna-like virus, Ectropis obliqua picorna-like virus, isolated from Ectropis obliqua J. Gen. Virol., May 1, 2004; 85(5): 1145 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nishiyama, H. Yamamoto, N. Shibuya, Y. Hatakeyama, A. Hachimori, T. Uchiumi, and N. Nakashima Structural elements in the internal ribosome entry site of Plautia stali intestine virus responsible for binding with ribosomes Nucleic Acids Res., May 1, 2003; 31(9): 2434 - 2442. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |