|
|
||||||||
Plant |
John Innes Centre, Department of Metabolic Biology1 and Department of Disease and Stress Biology2, Norwich Research Park, Norwich NR4 7UH, UK
Author for correspondence: Roger Hull. Fax +44 1603 450045. e-mail roger.hull{at}bbsrc.ac.uk
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
|
Picornaviral 3C proteases display a high degree of substrate specificity (Nicklin et al., 1986
; Pallai et al., 1989
) and catalyse the majority of processing events, including the cleavage of the coat proteins (CPs). The CP polyprotein precursor is processed in trans either by a mature 3C protease (Clarke & Sangar, 1988
; Harmon et al., 1992
; Jia et al., 1991
; Vakharia et al., 1987
) or by a 3C precursor (Jore et al., 1988
; Ypma-Wong et al., 1988
).
In this paper, we report on some of the trans-activity properties of the RTSV 3C-like protease and on the mutational studies of conserved amino acids considered to define the active site and/or the substrate-binding pocket of the protease.
Previously, we demonstrated a proteolytic activity in the C-terminal part of the RTSV polyprotein by analysing the primary translation products of pBat1534 [91 kDa; nucleotides (nt) 70559498; Figs 1C
and 2F
] and pBatE1 (58 kDa; nt 79209498; Fig. 1C
) (Thole & Hull, 1998
). To study RTSV polyprotein-processing further, deletion mutants containing C-terminal deletions in/of the predicted RTSV 3C-like protease domain (pBat
9, pBat
11 and pBat
15, Fig. 1C
) were constructed by exonuclease III and restriction enzyme digestions of pBat1534. RTSV polypeptides were expressed in coupled in vitro transcription/translation systems using either wheat germ extract or rabbit reticulocyte lysate as translation systems and in the absence/presence of the reducing agent dithiothreitol as described by Thole & Hull (1998)
. Polyprotein synthesis was analysed under different conditions as proteases can be inactive in a certain translation system and/or require reducing agents for expression and (full) catalytic activity (Mavankal & Rhoads, 1991
; Pelham, 1979
; Shih et al., 1987
; Verchot et al., 1991
, 1992
). Independently of the experimental conditions, the transcription/translation of pBat
9 (nt 70558136), pBat
11 (nt 70558520) and pBat
15 (nt 70559001) for 0·524 h yielded stable polyproteins of 41, 55 and 73 kDa, respectively (Fig. 2AC
and data not shown). Although it covers most of the protease gene (nt 80909068), the region spanning nt 70559001 did not yield active protease, which points to the key role of the amino acids encoded by the stretch spanning nt 90019068 in determining the protease function (Fig. 1A
).
|
9, pBat
11 and pBat
15 to a similar extent and gave virtually identical product patterns (Fig. 2AC
15, with the cleavage pattern observed following self-processing of pBat1534 (Fig. 2C
|
15 (Fig. 2C
The nature of the RTSV CP cleavage sites led to the prediction that they might be processed by a 3C-like protease (Shen et al., 1993
; Zhang et al., 1993
). To explore this, the trans-processing activity of the RTSV 3C-type protease was analysed on a polypeptide substrate consisting of the three RTSV CPs without the predicted C terminus of CP 3 (nt 21174388; pBatCP; Fig. 1B
). pBatCP was constructed by removing the CP-encoding fragment from pB3ea6 (Zhang et al., 1993
) and joining it in-frame with the translational start consensus sequence. As a prerequisite for the trans-assays, it was demonstrated that the substrate pBatCP (83 kDa) had no catalytic activity in either wheat germ (data not shown) or rabbit reticulocyte translation systems (Fig. 2E
), which also suggests that an (entire) protease is absent in the RTSV polyprotein region encoded by nt 21174388. In the trans-assays, the CP polyprotein precursor was co-incubated with the wild-type (pBatE1 and pBat1534) or mutant (pBatQ2526P) protease forms at different substrate:protease ratios (1:1, 1:3, 1:5 and 1:10) for 3 to 24 h in the presence/absence of a reducing agent in both animal and plant cell-free translation systems (Fig. 2E
and data not shown). The proteolytic activity of the enzyme sources used was simultaneously verified by trans-cleavage of the pBat
15 polyprotein (data not shown). In all our trans-assays, processing of the RTSV CP polyprotein was not detectable which might be because of the following reasons. (1) An inhibitor(s) prevented the release of the CPs. (2) The protease and/or substrate required a specific precursor form for cleavage, e.g. a proteasepolymerase intermediate (Jore et al., 1988
; Ypma-Wong et al., 1988
). This could not be investigated due to the instability of pBat clones containing the RTSV 3C-like protease and polymerase domain (Thole & Hull, 1998
). (3) The protease may require accessory protein(s)/factor(s) that modulate cleavage at particular sites (Blair et al., 1993
; Chambers et al., 1991
; Failla et al., 1994
; Peters et al., 1992
). (4) Alternatively, the RTSV CP polyprotein might be processed only/most efficiently in a cis-dependent fashion (Carrington et al., 1989
; Jia et al., 1991
; Palmenberg et al., 1992
; Verchot et al., 1992
) or by another protease.
To identify the putative active site and/or substrate-binding pocket of the protease residing in the C-terminal part of the RTSV polyprotein, mutational analyses of conserved amino acids were carried out. The conserved residues were selected based on computer analyses of cellular serine proteases and viral serine-like cysteine proteases (Bazan & Fletterick, 1988
; Gorbalenya et al., 1989
; Koonin & Dolja, 1993
), the crystal structure of two 3C proteases (Allaire et al., 1994
; Matthews et al., 1994
) and mutational studies of viral proteases (Cheah et al., 1990
; Dessens & Lomonossoff, 1991
; Dougherty et al., 1989
; Hämmerle et al., 1991
; Margis & Pinck, 1992
). Substitution mutations were individually introduced into construct pBat1534 by inserting PCR fragments containing single amino acid alterations as described by Thole & Hull (1998)
. The transversions for candidates of the active catalytic triad were His2680 to Gly (5' CATCCAGGTAACCTGCAGGCAT; pBatH2680G) (reverse), Glu2717 to Gln (5' CCCACACAACTGTCTGTTGAAATCC; pBatE2717Q) (reverse), Asp2735 to Glu (5' GCCACCCAGTCGGAATTATATTGAATTTATTGC; pBatD2735E) (forward) and Cys2811 to Ala (5' ATGCCAGGCTTTGCAGGAGCTGCTAT; pBatC2811A) (forward) (Fig. 1D
). Further, the conserved His2830 which is thought to constitute part of the substrate-binding pocket was analysed by conversion to Glu (5' TAATAGGAATGGAAGTCAGCGGTTTGCGC; pBatH2830E) (forward) (Fig. 1D
). The alterations of Glu2717, Cys2811 and His2830 which were analysed in a time-course from 0·5 to 2024 h (Fig. 3A
and data not shown) abolished each processing. The mutation at His2680 led to a severe limitation of processing, with a delayed and very partial cleavage after about 23 h of incubation (Fig. 3A
). The substitution of Asp2735 did not have any detectable effect on proteolysis (Fig. 3A
compared with control in Fig. 2F
).
The mutant constructs were tested for their trans-cleavage properties by using the pBat
11-derived polypeptide as a substrate (Fig. 3B
). Corresponding to the effects on their cis-proteolytic activities, the mutated proteases of pBatE2717Q, pBatC2811A and pBatH2830E did not act in trans on the deletion mutant polypeptide. Further, intermolecular activity of pBatH2680G was not detected in our assays. When Asp2735 was replaced by Glu the trans-activity was at wild-type level.
To examine whether the eliminated proteolytic activity was due to protein misfolding, the conserved amino acid mutants served as substrates for the wild-type protease pBat1534 in trans-assays. The mutant polyproteins were partially cleaved to several consistent products suggesting that the formation of an active enzyme was not prevented by (merely) altering the protein structure with the conversion of the amino acids (data not shown).
Our results suggest that the RTSV protease, located in the C-terminal half of the polyprotein, could belong to the group of serine-like cysteine proteinases and that it contains at its catalytic site the conserved residues Glu2717 and Cys2811. The potential active-site candidate Asp2735, analysed based on the prediction of Bazan & Fletterick (1988)
, does not constitute part of the catalytic centre. Glu2717 is consistent with the model of Gorbalenya et al. (1989)
and mutational analyses of polioviral 3C proteases (Hämmerle et al., 1991
; Kean et al., 1991
). The almost-fully destroyed cis-activity and the diminished trans-activity of the substitution mutation at His2680 confirm its proposed role in an efficient catalysis but its role cannot be assessed with certainty as the third residue of the catalytic triad. Alterations of catalytic site residues can result in partial processing (Carter & Wells, 1988
; Dessens & Lomonossoff, 1991
; Dougherty et al., 1989
; Snijder et al., 1996
) and mutations can also have differential effects at particular cleavage sites (Kean et al., 1991
, 1993
). The substitution at His2830 of the RTSV polyprotein abolished processing, indicating its probable importance in substrate binding by analogy to RTSV His2830 equivalents in 3C-like proteases (Blair et al., 1996
; Cheah et al., 1990
; Hans & Sanfaçon, 1995
; Ivanoff et al., 1986
; Lawson & Semler, 1991
; Snijder et al., 1996
). This is in accord with the suggestion that when His is present in the binding pocket of a 3C-like proteinase, the proteinase seems to prefer Gln or Glu at the -1 position (Bazan & Fletterick, 1988
; Gorbalenya et al., 1989
; Allaire et al., 1994
; Matthews et al., 1994
).
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bazan, J. F. & Fletterick, R. J. (1988). Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional applications. Proceedings of the National Academy of Sciences, USA 85, 7872-7876.
Blair, W. S., Li, X. & Semmler, B. L. (1993). A cellular cofactor facilitates efficient 3CD cleavage of the poliovirus P1 precursor. Journal of Virology 67, 2336-2343.
Blair, W. S., Nguyen, J. H. C., Parsley, T. B. & Semmler, B. L. (1996). Mutations in the poliovirus 3CD proteinase S1-specificity pocket affect substrate recognition and RNA binding. Virology 218, 1-13.[Medline]
Carrington, J. C., Freed, D. D. & Sanders, T. C. (1989). Autocatalytic processing of the potyvirus helper component proteinase in Escherichia coli and in vitro. Journal of Virology 63, 4459-4463.
Carter, P. & Wells, J. A. (1988). Dissecting the catalytic triad of a serine protease. Nature 332, 564-568.[Medline]
Chambers, T. J., Grakoui, A. & Rice, C. M. (1991). Processing of the yellow fever virus nonstructural polyprotein: a catalytically active NS3 proteinase domain and NS2B are required for cleavages at dibasic sites. Journal of Virology 65, 6042-6050.
Cheah, K.-C., Leong, L. E.-C. & Porter, A. G. (1990). Site-directed mutagenesis suggests close functional relationship between a human rhinovirus 3C cysteine protease and cellular trypsin-like serine proteases. Journal of Biological Chemistry 265, 7180-7187.
Clarke, B. E. & Sangar, D. V. (1988). Processing and assembly of foot-and-mouth disease virus proteins using subgenomic RNA. Journal of General Virology 69, 2313-2325.
Dessens, J. T. & Lomonossoff, G. P. (1991). Mutational analysis of the putative catalytic triad of the cowpea mosaic virus 24K protease. Virology 184, 738-746.[Medline]
Dessens, J. T. & Lomonossoff, G. P. (1992). Sequence upstream of the 24 kDa protease enhances cleavage of the cowpea mosaic virus B RNA-encoded polyprotein at the junction between the 24K and 87K proteins. Virology 189, 225-232.[Medline]
Dougherty, W. G. & Semler, B. L. (1993). Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Microbiological Reviews 57, 781-822.
Dougherty, W. G., Parks, T. D., Cary, S. M., Bazan, J. F. & Fletterick, R. J. (1989). Characterization of the catalytic residues of the tobacco etch virus 49-kDa proteinase. Virology 172, 302-310.[Medline]
Failla, C., Tomei, L. & De Francesco, R. (1994). Both NS3 and NS4A are required for proteolytic processing of hepatitis C virus nonstructural proteins. Journal of Virology 68, 3753-3760.
Gorbalenya, A., Donchenko, A. P., Blinov, V. M. & Koonin, E. V. (1989). Cysteine proteases of positive-strand RNA viruses and chymotrypsin-like serine proteases: a distinct protein superfamily with common structural fold. FEBS Letters 243, 103-114.[Medline]
Hall, D. J. & Palmenberg, A. C. (1996). Cleavage site mutations in the encephalomyocarditis virus P3 region lethally abrogate the normal processing cascade. Journal of Virology 70, 5954-5961.[Abstract]
Hämmerle, T., Hellen, C. U. T. & Wimmer, E. (1991). Site-directed mutagenesis of the putative catalytic triad of poliovirus 3C proteinase. Journal of Biological Chemistry 266, 5412-5416.
Hans, F. & Sanfaçon, H. (1995). Tomato ringspot nepovirus protease: characterization and cleavage site specificity. Journal of General Virology 76, 917-927.
Harmon, S. A., Updike, W., Jia, X.-Y., Summers, D. F. & Ehrenfeld, E. (1992). Polyprotein processing in cis and trans by hepatitis A virus 3C protease cloned and expressed in Escherichia coli. Journal of Virology 66, 5242-5247.
Hull, R. (2001). Matthews Plant Virology. London: Academic Press.
Ivanoff, L. A., Towatari, T., Ray, J., Korant, B. D. & Petteway, S. R. (1986). Expression and site-specific mutagenesis of the poliovirus 3C protease in Escherichia coli. Proceedings of the National Academy of Sciences, USA 83, 5392-5396.
Jia, X.-Y., Ehrenfeld, E. & Summers, D. F. (1991). Proteolytic activity of hepatitis A virus 3C protein. Journal of Virology 65, 2595-2600.
Jore, J., de Geus, B., Jackson, R. J., Pouwels, P. H. & Enger-Valk, B. E. (1988). Poliovirus protein 3CD is the active protease for processing of the precursor protein P1 in vitro. Journal of General Virology 69, 1627-1636.
Kean, K. M., Teterina, N. L., Marc, D. & Girad, M. (1991). Analysis of putative active site residues of the poliovirus 3C protease. Virology 181, 609-619.[Medline]
Kean, K. M., Howell, M. T., Grünert, S., Girard, M. & Jackson, R. J. (1993). Substitution mutations at the putative catalytic triad of the poliovirus 3C protease have differential effects on cleavage at different sites. Virology 194, 360-364.[Medline]
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Medline]
Lawson, M. A. & Semler, B. L. (1991). Poliovirus thiol proteinase 3C can utilize a serine nucleophile within the putative catalytic triad. Proceedings of the National Academy of Sciences, USA 88, 9919-9923.
Margis, R. & Pinck, L. (1992). Effect of site-directed mutagenesis on the presumed catalytic triad and substrate-binding pocket of grapevine fanleaf nepovirus 24-kDa proteinase. Virology 190, 884-888.[Medline]
Margis, R., Viry, M., Pinck, M., Bardonnet, N. & Pinck, L. (1994). Differential proteolytic activities of precursor and mature forms of the 24K proteinase of grapevine fanleaf nepovirus. Virology 200, 79-86.[Medline]
Matthews, D. A., Smith, W. W., Ferre, R. A., Condon, B., Budahazi, G., Sisson, W., Villafranca, J. E., Janson, C. A., McElroy, H. E., Gribskov, C. L. & Worland, S. (1994). Structure of human rhinovirus 3C protease reveals trypsin-like polypeptide fold, RNA-binding site, and means for cleaving precursor polyprotein. Cell 77, 761-771.[Medline]
Mavankal, G. & Rhoads, R. E. (1991). In vitro cleavage at or near the N-terminus of the helper component protein in tobacco vein mottling virus polyprotein. Virology 185, 721-731.[Medline]
Nicklin, M. J. H., Toyoda, H., Murray, M. G. & Wimmer, E. (1986). Proteolytic processing in the replication of polio and related viruses. Biotechnology 4, 36-42.
Pallai, P. V., Burkhardt, F., Skoog, M., Schreiner, K., Baxt, P., Cohen, K. A., Hansen, G., Palladino, D. E. H., Harris, K. S., Nicklin, M. J. H. & Wimmer, E. (1989). Cleavage of synthetic peptides by purified poliovirus 3C proteinase. Journal of Biological Chemistry 264, 9738-9741.
Palmenberg, A. C., Parks, G. D., Hall, D. J., Ingraham, R. H., Seng, T. W. & Pallai, P. V. (1992). Proteolytic processing of the cardioviral P2 region: primary 2A/2B cleavage in clone-derived precursors. Virology 190, 754-762.[Medline]
Pelham, H. R. B. (1979). Synthesis and processing of cowpea mosaic virus proteins in reticulocyte lysates. Virology 96, 463-477.[Medline]
Peters, S. A., Voorhorst, W. G. B., Wery, J., Wellink, J. & van Kammen, A. (1992). A regulatory role for the 32K protein in proteolytic processing of cowpea mosaic virus polyproteins. Virology 191, 81-89.[Medline]
Ryan, M. D. & Flint, M. (1997). Virus-encoded proteinases of the picornaviral super-group. Journal of General Virology 78, 699-723.[Medline]
Shen, P., Kaniewska, M., Smith, C. & Beachy, R. N. (1993). Nucleotide sequence and genomic organization of rice tungro spherical virus. Virology 193, 621-630.[Medline]
Shih, D. S., Bu, M., Price, M. A. & Shih, C.-Y. T. (1987). Inhibition of cleavage of a plant viral polyprotein by an inhibitor activity present in wheat germ and cowpea embryos. Journal of Virology 61, 912-915.
Snijder, E. J., Wassenaar, A. L. M., van Dinten, L. C., Spaan, W. J. M. & Gorbalenya, A. E. (1996). The arterivirus Nsp4 protease is the prototype of a novel group of chymotrypsin-like enzymes, the 3C-like serine protease. Journal of Biological Chemistry 271, 4864-4871.
Spall, V. E., Shanks, M. & Lomonossoff, G. P. (1997). Polyprotein processing as a strategy for gene expression in RNA viruses. Seminars in Virology 8, 15-23.
Thole, V. & Hull, R. (1996). Rice tungro spherical virus: nucleotide sequence of the 3' genomic half and studies on the 3' two small open reading frames. Virus Genes 13, 239-246.[Medline]
Thole, V. & Hull, R. (1998). Rice tungro spherical virus polyprotein processing: identification of a virus-encoded protease and mutational analysis of putative cleavage sites. Virology 247, 106-114.[Medline]
Vakharia, V. N., Devaney, M. A., Moore, D. M., Dunn, J. J. & Grubman, M. J. (1987). Proteolytic processing of foot-and-mouth disease virus polyproteins expressed in a cell-free system from clone-derived transcripts. Journal of Virology 61, 3199-3207.
Verchot, J., Koonin, E. V. & Carrington, J. C. (1991). The 35-kDa protein from the N-terminus of the potyviral polyprotein functions as a third virus-encoded proteinase. Virology 185, 527-535.[Medline]
Verchot, J., Herndon, K. L. & Carrington, J. C. (1992). Mutational analysis of tobacco etch virus potyviral 35-kDa proteinase: identification of essential residues and requirements for autoproteolysis. Virology 190, 298-306.[Medline]
Ypma-Wong, M. F., Dewalt, P. G., Johnson, V. H., Lamb, J. G. & Semler, B. L. (1988). Protein 3CD is the major poliovirus proteinase responsible for cleavage of the P1 precursor. Virology 166, 265-270.[Medline]
Zhang, S., Jones, M. C., Barker, P., Davies, J. W. & Hull, R. (1993). Molecular cloning and sequencing of coat protein-encoding cDNA of rice tungro spherical virus a plant picornavirus. Virus Genes 7, 121-132.[Medline]
Received 28 June 2002;
accepted 26 August 2002.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |