|
|
||||||||
Animal: RNA Viruses |
Division of Microbiology, School of Biochemistry and Molecular Biology, University of Leeds, Leeds LS2 9JT, UK1
Author for correspondence: Mark Harris. Fax +44 113 233 5638. e-mail mharris{at}bmb.leeds.ac.uk
| Abstract |
|---|
|
|
|---|
-galactosidase activity was limited to 1020% of cells. In contrast, the tetracycline-controlled expression system gave a low basal activity and was highly inducible in almost 100% of cells. Inducible expression was also obtained in almost 100% of cells infected with baculoviruses in which an HCV minigenome was placed downstream of the tetracycline-inducible promoter and upstream of either a hammerhead or hepatitis
virus ribozyme. Northern blot analysis was consistent with accurate cleavage of the minigenome transcript by the hepatitis
virus ribozyme. Finally, regulable transcript production and viral polypeptide processing could be demonstrated in HepG2 cells infected with baculoviruses bearing the full-length HCV genome. This system thus provides a novel tool for the analysis of HCV replication and hostcell interactions. | Introduction |
|---|
|
|
|---|
It has been shown for other positive-strand RNA viruses that full-length transcripts produced in the nucleus by Pol-II are delivered in a functional form into the cytoplasm (Almazan et al., 2000
; Beard et al., 1999
; Dubensky et al., 1996
; Khromykh et al., 2001
; Semler et al., 1984
). This enables the utilization of various viral systems to deliver viral cDNA into cells, and could be adapted to facilitate inducible expression of the viral transcript. Hybrid baculovirus vectors that contain mammalian promoters have advantages in this respect as they are effective for gene delivery into hepatocyte and hepatocyte-derived cell lines (Boyce & Bucher, 1996
; Hofmann et al., 1995
; Shoji et al., 1997
) and have already been shown to accommodate an entire HCV genome (Fipaldini et al., 1999
). Furthermore, cytopathic effects on infected cells are limited, as compared to some other viral delivery systems, and potential risks associated with viral delivery of a full-length HCV genome are likely to be reduced in vectors, such as baculovirus, which are unable to replicate in mammalian cells. For this reason we have investigated the potential for controlled gene expression from baculovirus using two established methods, the tet-off system (Gossen & Bujard, 1992
) and ecdysone/ponasterone-inducible (pon) system (No et al., 1996
). The tet-off system relies on the presence of tetracycline (tet) to inhibit the interaction of the VP16 fusion protein, tTA, with a tet response element that is situated upstream of a minimal CMV promoter, thereby preventing transcription. In contrast, the pon system requires ponasterone for activation of transcription by allowing heterodimerization of a modified VP16ecdysone receptor hybrid and the retinoid X receptor, thereby targeting the VP16 domain to a DNA sequence containing hybrid glucocorticoidecdysone response element repeats upstream of a minimal promoter. Our results show that the tet-off system in baculovirus is an extremely effective delivery system for controllably driving high levels of reporter gene expression and for the expression of both HCV minigenome and full-length HCV constructs.
| Methods |
|---|
|
|
|---|
Cells and viruses.
Generation of baculovirus vectors.
For construction of pBACVgRxR, part of the CMV promoter of pVgRxR (Invitrogen) was amplified by PCR using primers VgRxR(Pcmv5') (5' ATTTAAATGGCTAGAGTCCGTTAC) and VgRxR(Pcmv3') (5' AATAGGGGGCGTACTTGG). The fragment was digested with SwaI and NdeI and cloned, along with the NdeINotI fragment of pVgRxR, into SphI(polished)NotI cut pBacMam2 (Novagen). pBACINDLacZpon was generated by cloning the SalI(polished)NotI fragment of pINDLacZ (Invitrogen) into the SphI(polished)NotI cut pBacMam2. To generate pBACINDLacZtet, the tetracycline-responsive promoter (Ptet) from pUHD10-3 (Gossen & Bujard, 1992
) was amplified by PCR using primers tet-cmv(fwd) (5' TTCTAGAGCATGCACGAGGCCCTTTCGTC 3') and tet-cmv(rev) (5' GGGGGCTGGCCGGTTCACTAAACGAGC 3'), and cloned into pCR-Blunt. Ptet was excised using SphI and HindIII (present within the MCS of pCR-Blunt) and cloned with the HindIIINotI fragment of pINDLacZ into SphINotI cut pBacMam-2. The tTA element was amplified from pUHD15-1 (Gossen & Bujard, 1992
) using primers tTA(fwd) (5' TAGATCTGCCACCATGTCTAGATTAGATAAAAG 3') and tTA(rev) (5' GCGGCCGCGCCCCCTACCCAC 3') and cloned directly into pBacMam2 using BglII and NotI to generate pBACtTA.
The construction of the HCV-based vectors involved several steps. The first stage in generating the 5' end of the constructs required coupling the ponasterone-inducible promoter (Ppon) to the start of the HCV 5'UTR [H77C clone (Yanagi et al., 1997
)]. This was by means of a two-step PCR reaction involving 5'pIND (5' GCATGCGGGAGATCTCGGCCGC 3'), 3'pIND (5' GGGGGCTGGCCTCCGTAGACGAAGCGCC 3'), 5'HCVlig (5' GTCTACGGAGGCCAGCCCCCTGATGGG 3') and 5'UTR(out) (5' TGTACTCACCGGTTCCGC 3') primers; the resulting fragment was cloned into pCR-Blunt to give pEC5'UTR. At the 3' end of the construct, the majority of the HCV 3'UTR was fused to a hammerhead (HH) ribozyme by PCR using the primers 3'UTR(out) (5' CTCGAGTAATACGACTCACTATAGGGAGGTTGGGGTAAACACTCC 3') and HH-3'UTR (5' GAATTCATCATGTTTCGAGCTTTCGCTCTCATCAGCTCTACTTTCGTAGAGGACATGATCTGCAGAGAGGC 3') and cloned into pCR-Blunt to generate p3'UTR(HH). The 3'UTR was also fused to part of the positive-strand hepatitis
virus (H
V) ribozyme by PCR using the 3'UTR(out) and H
V-3'UTR (5' GGCGCCAGCGAGGAGGCTGGGACCATGCCGGCCACATGATCTGCAGAGAGGC 3') primers. The resulting DNA fragment was cloned into a pBluescript SK-derived vector containing the full-length H
V ribozyme through XhoI and NarI sites, to give p3'UTR(H
V). To remove an AgeI site in pBacMam2 that would have interfered with subsequent cloning steps, the plasmid was cut with AgeI, polished, and religated to give pBacMam2*. Fragments representing both the 5' and 3' ends of the HCV construct were then excised from pEC5'UTR and either p3'UTR(HH) or p3'UTR(H
V) using SphI+XhoI and XhoI+EcoRI, and cloned as a three-way ligation into SphIEcoRI cut pBacMam2* to generate pEC5'/3'(HH) and pEC5'/3'(H
V) respectively. Due to cloning difficulties, the H77C ORF was inserted into these baculovirus transfer vectors in two sequential steps, first by cloning a NotIAflII fragment [to give pEC5'/3'1a(HH) and pEC5'/3'1a(H
V)] followed by the AgeINotI fragment to give pBACH77(HH)pon and pBACH77(H
V)pon. The former two plasmids were also used to derive the HCV minigenome constructs. In this instance the lacZ gene was excised from pINDlacZ using HindIII and NotI, and cloned into EcoRINotI cut SK-HCV 5'UTR (a gift from Professor S. Lemon), a construct consisting of the first 380 nucleotides of the HCV N2 strain, using lacZ linker(+) (5' AATTAATGGGGGTAGTGGTGGATCCA 3') and lacZ linker(-) (5' AGCTTGGATCCACCACTACCCCCATT 3') oligonucleotides to link the EcoRI and HindIII sites. An AgeINotI fragment was excised from this clone and cloned into AgeINotI cut pEC5'/3'1a(HH) and pEC5'/3'1a(H
V) to give pBAC
H77lacZ(HH)pon and pBAC
H77lacZ(H
V)pon.
When it was established that the tet-off system was more effective in baculovirus, Ppon was exchanged for the tetracycline promoter (Ptet) as follows. Ptet was coupled to the start of the HCV 5'UTR by means of a two-step PCR reaction involving tet-cmv(fwd) (5' TTCTAGAGCATGCACGAGGCCCTTTCGTC 3'), tet-cmv(rev) (5' GGGGGCTGGCCGGTTCACTAAACGAGC 3'), 5'UTR(fwd/tet) (5' TAGTGAACCGGCCAGCCCCCTGATGGG 3') and 5'UTR(out) primers, to give a DNA fragment which had the first nucleotide of the 5'UTR positioned at the previously mapped transcription start site (Akrigg et al., 1985
; Stenberg et al., 1984
). This fragment was cloned into pCR-Blunt to give pT5U. In addition, a fragment of the ORF1629 essential gene from pBacMam2 was obtained by PCR using 1629(fwd) (5' TATTTAAATTCAGATATAAAG 3') and 1629(rev) (5' TTCTAGACTGATCCGGGTTATTAG 3') primers and cloned into pCR-Blunt to give p1629. The Ptet/5'UTR DNA fragment was then excised from pT5U using XbaI and cloned into XbaI cut p1629 to generate p1629-T5U. The 1629-T5U gene fragment was excised using SwaI and AgeI, and cloned into the relevant SwaIAgeI cut vectors to give pBACH77(HH)tet, pBACH77(H
V)tet, pBAC
H77lacZ(HH)tet and pBAC
H77lacZ(H
V)tet.
Analysis of
-galactosidase expression.
Cells were washed in PBS, lysed in RLB (Promega) and a colorimetric assay with o-nitrophenyl
-D-galactopyranoside used to measure the level of
-galactosidase activity (Nielsen et al., 1983
). Protein was quantified using the BCA protein assay reagent (Pierce). Levels of
-galactosidase activity are expressed as units (µmol o-nitrophenyl
-D-galactopyranoside cleaved/min) per mg protein.
For histochemical detection of
-galactosidase activity, cells were washed twice with PBS, fixed with 0·25% glutaraldehyde for 15 min, and stained with a solution of 1 mg/ml 5-bromo-4-chloro-3-indolyl
-D-galactopyranoside (X-Gal), 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6 and 2 mM MgCl2 in PBS for 2 h.
Southern blot analysis of recombinant baculovirus clones.
Crude viral DNA was obtained from Sf9 cells that had been infected with virus supernatant 18 h previously, using a standard procedure (King & Possee, 1992
). Digested DNA was run on a 0·8% TBE agarose gel, along with a biotinylated DNA marker, and transferred under alkaline conditions to Bright-Star Nylon Plus membrane (Ambion) according to the manufacturers recommendations. Biotinylated probes and markers were generated using Biotin-Chem-Link reagent (Roche). Hybridization was performed overnight at 42 °C in Ultrahyb (Ambion) and bound probe was detected using a Bright-Star Detection Kit (Ambion).
Northern blot analysis of baculovirus-derived transcripts.
RNA was harvested from cells using Trizol (Life Technologies), separated on a MOPSformaldehyde gel and transferred to Bright-Star Nylon Plus membrane using standard procedures. Biotinylation of probes and RNA markers, and hybridization and detection of the probes were performed as for Southern blots.
Immunofluorescence.
HepG2 cells seeded on Lab-Tek II chamber slides (Life Technologies) pre-coated with E-C-L (Upstate Biotechnologies) were infected with 6·25x106 p.f.u./ml BACtTA and BACH77(H
V)tet for 4 h and allowed to recover for 24 h. To detect expressed antigen, cells were fixed with 1% formaldehyde in PBS for 1 h, permeabilized with 0·2% Triton X-100 (Merck) for 5 min, and incubated with sheep anti-NS5A sera (raised against E. coli expressed His-tagged NS5A). Bound antibody was detected with a donkey anti-sheep FITC conjugate (Sigma).
Western blot assays.
Cell lysates were separated by SDSPAGE and transferred to PVDF membrane (Millipore). Membranes were blocked with 5% (w/v) low-fat dried milk, 0·1% Tween 20 (Merck) in Tris-buffered saline and incubated with either sheep anti-NS3 sera (Aoubala et al., 2001
), sheep anti-NS5A, sheep anti-NS5B sera (raised against E. coli-expressed His-tagged NS5B) or the murine anti-Core mAb0126 (Biogenesis, 1:1000). Bound antibody was detected with an appropriate HRP-conjugated secondary antibody (Sigma) and ECL reagent (Amersham Pharmacia).
| Results |
|---|
|
|
|---|
The hepatoblastoma cell line HuH7 was co-infected with BACtTA and BACINDlacZtet or BACVgRxR and BACINDlacZpon and the levels of
-galactosidase activity were determined (Fig. 1
). Under conditions where reporter gene expression was suppressed (+tet/-pon respectively) levels of
-galactosidase were very low and appeared similar for both delivery systems. However, when reporter gene activity was induced,
-galactosidase activity increased up to 2000-fold in cells that had been co-infected with BACtTA and BACINDlacZtet, compared to only 20- to 50-fold in cells co-infected with BACVgRxR and BACINDlacZpon. Furthermore, only low virus concentrations were required to obtain both detectable (
2·5x106 p.f.u./ml of each virus) and saturable (2·5x107 p.f.u./ml of each virus)
-galactosidase expression with the tet system, whereas
-galactosidase activity was only detected at
1·25x107 p.f.u./ml with the pon system. Histochemical staining of the cells revealed that almost 100% expressed detectable levels of
-galactosidase when co-infected with BACtTA and BACINDlacZtet in the absence of tet (Fig. 2a
), as compared to at best 20% when co-infected with BACVgRxR and BACINDlacZpon in the presence of pon (data not shown). Cells co-infected with BACtTA and BACINDlacZtet in the presence of tet showed little or no staining (Fig. 2b
).
|
|
1·25x108 p.f.u./ml, well beyond that necessary for maximal
-galactosidase activity in the tet system. The two systems also showed similar relative patterns of
-galactosidase activity when the transfer vectors were introduced into HuH7 cells by transfection, compared to when introduced by baculovirus (data not shown). Therefore, it is likely that the difference in activity between the two is a reflection of their ability to function in HuH-7 cells, rather than their ability to operate in the context of a baculovirus genome.
Characterization of the tet delivery system
As control of baculovirus-derived gene expression was best facilitated using the tet promoter, this delivery system was characterized further. Temporal analysis showed that
-galactosidase expression was detectable 7 h after initiating infection of HuH7 cells; maximal levels were achieved between 24 and 48 h and remained high for at least 5 days (data not shown). Subsequent experiments were analysed at 48 h following infection. To ensure that
-galactosidase expression was as a direct result of tTA binding to Ptet, HuH7 cells were infected with either BACtTA or BACINDlacZtet in the presence or absence of tet, and the levels of
-galactosidase activity compared to cells co-infected with both vectors. As expected, infection with either BACtTA or BACINDlacZtet alone, irrespective of the presence of tet, did not result in significant expression of
-galactosidase (data not shown). Only when cells were infected with both viruses in the absence of tet were high levels of
-galactosidase activity observed.
An important aspect of an inducible delivery system is the ability to control the level of gene expression. It is clear that this can be done to a limited degree by altering the concentration of baculovirus used to infect the cell (Fig. 1
). However, an advantage of the tet system is that it should also allow gene expression to be more finely regulated. To examine this, HuH7 cells were co-infected with BACtTA and BACINDlacZtet, and then allowed to express
-galactosidase in the presence of various concentrations of tet. At concentrations of 0·01 µg/ml or less, little or no suppression of
-galactosidase was observed, but tet concentrations above this level resulted in reduced
-galactosidase expression such that between 0·4 and 1·0 µg/ml, inhibition was maximal (data not shown).
To determine the extent to which this system could be used for gene delivery, a number of other hepatocyte- and non-hepatocyte-derived cell lines were co-infected with BACtTA and BACINDlacZtet and levels of
-galactosidase measured (Fig. 3
). The hepatocellular carcinoma cell line HepG2 expressed
-galactosidase in the absence of tet at levels greater than HuH7 cells, with almost 100% of cells staining with X-Gal (Fig. 2d
). However, it also showed higher background levels in the presence of tet (Fig. 2c
) such that
-galactosidase expression was only induced 500-fold in the absence of tet. Two other cell lines tested, COS-7 and 293 cells, showed an intermediate response, with approximately 20% and 50% of the cells positive for
-galactosidase expression in the absence of tet (data not shown) and levels of expression being 2% and 10% of that seen for HuH7. No detectable
-galactosidase expression was seen in either of these cell lines in the presence of tet. Finally, one cell line, HeLaOHIO, repeatedly failed to express
-galactosidase when infected with BACtTA and BACINDlacZtet.
|
-galactosidase was mediated by the HCV IRES. Ptet was placed immediately upstream of the 5'UTR such that the first nucleotide of the genome corresponded to the previously mapped transcriptional start site (Akrigg et al., 1985
V ribozyme sequence and poly(A) signal, generating BAC
H77lacZ(HH)tet and BAC
H77lacZ(H
V)tet respectively. Southern blot analysis showed that both baculovirus constructs were intact (data not shown). Northern blot analysis of RNA extracted from HepG2 cells infected with both viruses, using a probe complementary to both the lacZ gene and the region between the ribozyme and poly(A) tail (Fig. 4b
4 kb) for the minigenome transcript for both constructs. The presence of a
0·5 kb species was consistent with ribozyme cleavage at the predicted site at the end of the 3'UTR. Interestingly, this species was only observed in cells infected with BAC
H77lacZ(H
V)tet, suggesting inefficient cleavage by the HH ribozyme.
|
H77lacZ(HH)tet,
-galactosidase activity was approximately 13% of BACINDlacZtet in both cell lines. In contrast, while
-galactosidase levels were also low in cells infected with BAC
H77lacZ(H
V)tet, there was a significant difference between the two cell lines, activities being 18·7% and 8·6% of those seen in HuH7 and HepG2 cells, respectively. Importantly, this difference does not appear to be due to differences in the percentage of cells expressing the minigenome transcript, as X-Gal staining indicated that almost 100% of both cell lines expressed
-galactosidase (Fig. 2e
|
V ribozyme immediately after the X-region of the 3'UTR, indicating that this delivery system had the potential to generate correctly processed, full-length HCV transcripts. To this end, baculovirus transfer vectors were constructed carrying the entire sequence of the infectious HCV 1a clone H77C (Yanagi et al., 1997
V (pBACH77(H
V)tet) ribozymes (Fig. 6a
V ribozyme was proven to be active (Fig. 5
V)tet. At 48 h post-infection, two tet-regulable transcripts of
1·5 kb and 9 kb that hybridized to a 5'UTR probe were detected (Fig. 7
|
|
V)tet co-infected HepG2 cells were analysed by Western blotting to determine whether the HCV polypeptide was appropriately processed. As shown in Fig. 8(a)
|
-galactosidase expression with the HCV minigenome construct (Fig. 2h| Discussion |
|---|
|
|
|---|
Numerous reports have described exogenous gene expression from a viral genome under the control of inducible promoters including the same tet (Corti et al., 1999
; Harding et al., 1998
; Hofmann et al., 1996
; Hwang et al., 1996
; Iida et al., 1996
; McVoy & Mocarski, 1999
; Neering et al., 1996
; Paulus et al., 1996
; Yoshida & Hamada, 1997
) and pon (Hoppe et al., 2000
; Johns et al., 1999
) systems used in this study. Consistent with these previous studies we found that the pon system did function to a limited extent in HuH7 cells, but the differences in the level of induced versus uninduced expression were at best 50-fold compared to 1000- to 2000-fold for the tet system. In addition, basal levels of
-galactosidase activity were also comparable between the two systems. The possibility that the difference between the two systems was solely due to changes in promoter activities as a result of using baculovirus seem unlikely as transient transfection of HuH7 cells with the transfer vectors produced similar results (data not shown). Nor was this difference attributable to cell type as the pon baculovirus delivery system also had low activity in HepG2 cells and was effectively inactive in COS-7 and 293 cells (data not shown). We therefore chose to develop the tet delivery system, although it is possible that alterations to the pon system, such as replacing the VgRxR element with a chimeric Drosophila/Bombyx ecdysone receptor (Hoppe et al., 2000
), might improve responsiveness.
Our long-term goal in developing the baculovirus tet delivery system was to establish an efficient delivery system for the complete HCV genome. To this end we first generated viruses in which Ptet was used to drive expression of HCV minigenomes, such that the lacZ gene was flanked by the HCV 5' and 3'UTR and either an HH or H
V ribozyme was placed immediately downstream of the 3'UTR. The expression of
-galactosidase in almost all infected HuH7 or HepG2 cells together with the detection of an appropriate sized transcript indicated that the minigenome RNA transcript was exported from the nucleus. Cleavage of the poly(A) tail from the transcript could also be detected in cells infected with the BAC
H77(H
V)tet vector but not in the related HH vector. Failure to detect cleavage of the BAC
H77(HH)tet transcript could reflect low ribozyme activity or a reduced half-life of the cleaved product. It is perhaps pertinent to note that the H
V but not HH ribozyme has been shown to cleave RNA transcripts at the 3' boundary of the 3'UTR in vitro (J. Avis, personal communication). Given this possible difference between the two minigenome constructs, it was of interest that they also appeared to differ in their ability to drive expression of
-galactosidase. Reporter gene activity in BAC
H77(HH)tet-infected cells was approximately 13% of that seen in the BACINDlacZtet-infected controls, both for HepG2 and HuH7 cells. In contrast, reporter gene activity showed a 2-fold difference when comparing HuH7 (18·7%) and HepG2 (8·6%) cells infected with BAC
H77(H
V)tet, these levels being higher and lower respectively than with the same cells infected with BAC
H77(HH)tet. It is likely that the ability to modulate IRES activity is necessary for HCV to switch between translation and replication as has been postulated for other positive-strand RNA viruses (Borman et al., 1994
; Gamarnik & Andino, 1998
). Domains within the HCV genome that have been implicated in modulation of IRES activity include the 3'UTR and particularly the X-region (Hoppe et al., 2000
; Ito et al., 1998
; Michel et al., 2001
; Murakami et al., 2001
). However, probably as a result of using different constructs, it is still unclear as to whether the 3'UTR and regions therein specifically enhance HCV IRES activity, generally enhance all forms of translation or suppress IRES activity. Although our results are complicated by the fact that the minigenome transcripts will be capped and may differ in their stability within the cell (even though no evidence of this was seen by Northern blot analysis), they do raise the possibility that 3'UTR modulation of HCV IRES activity could also be cell line dependent.
Observations made using the full-length HCV baculovirus vectors generally were in agreement with those of previous investigators who have expressed the entire HCV ORF in vivo (Fipaldini et al., 1999
; Grakoui et al., 1993
; Mizuno et al., 1995
; Moradpour et al., 1998
). Although the additional 1·5 kb transcript detected by Northern blotting has not been previously described the observation that at early times after infection this product is less abundant than the full-length transcript suggests that it is a degradation product that accumulates over time. It is unlikely that the HCV proteins are translated from this (or other) degraded RNAs because authentically processed proteins were observed both at 12 h (data not shown) and 48 h (Fig. 8a
). As we wish to use this system for HCV replication studies it will be important to confirm that the 5' and 3' ends of the transcripts correspond to the authentic ends of the HCV genome. Studies are under way to confirm this, as well as to investigate whether these capped transcripts will function as templates for negative-strand production (and subsequent positive-strand production) by the HCV replication complex.
In summary, we have developed an efficient viral delivery system for introducing the HCV genome into hepatocyte-derived cell lines. This should allow the effects of HCV RNA and polyprotein expression to be studied in a variety of cell lines without undertaking the laborious task of generating stable cell lines. Furthermore, given the cell tropism shown by recombinant baculovirus vectors it may be possible to introduce full-length HCV transcripts into the cognate host of the virus primary human hepatocytes. We are currently in the process of establishing this, as well as generating defective mutant HCV constructs as controls to determine whether virus replication and particle formation occur.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Almazan, F., Gonzalez, J. M., Penzes, Z., Izeta, A., Calvo, E., Plana-Duran, J. & Enjuanes, L. (2000). Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proceedings of the National Academy of Sciences, USA 97, 5516-5521.
Aoubala, M., Holt, J., Clegg, R. A., Rowlands, D. J. & Harris, M. (2001). The inhibition of cAMP-dependent protein kinase by full-length hepatitis C virus NS3/4A complex is due to ATP hydrolysis. Journal of General Virology 82, 1637-1646.
Bartenschlager, R. & Lohmann, V. (2000). Replication of hepatitis C virus. Journal of General Virology 81, 1631-1648.
Beard, C., Ward, G., Rieder, E., Chinsangaram, J., Grubman, M. J. & Mason, P. W. (1999). Development of DNA vaccines for foot-and-mouth disease, evaluation of vaccines encoding replicating and non-replicating nucleic acids in swine. Journal of Biotechnology 73, 243-249.[Medline]
Blight, K. J., Kolykhalov, A. A. & Rice, C. M. (2000). Efficient initiation of HCV RNA replication in cell culture. Science 290, 1972-1974.
Borman, A. M., Deliat, F. G. & Kean, K. M. (1994). Sequences within the poliovirus internal ribosome entry segment control viral-RNA synthesis. EMBO Journal 13, 3149-3157.[Medline]
Boyce, F. M. & Bucher, N. L. R. (1996). Baculovirus-mediated gene transfer into mammalian cells. Proceedings of the National Academy of Sciences, USA 93, 2348-2352.
Corti, O., Sabate, O., Horellou, P., Colin, P., Dumas, S., Buchet, D., Buc-Caron, M. H. & Mallet, J. (1999). A single adenovirus vector mediates doxycycline-controlled expression of tyrosine hydroxylase in brain grafts of human neural progenitors. Nature Biotechnology 17, 349-354.[Medline]
Dubensky, T. W., Driver, D. A., Polo, J. M., Belli, B. A., Latham, E. M., Ibanez, C. E., Chada, S., Brumm, D., Banks, T. A., Mento, S. J., Jolly, D. J. & Chang, S. M. W. (1996). Sindbis virus DNA-based expression vectors: Utility for in vitro and in vivo gene transfer. Journal of Virology 70, 508-519.[Abstract]
Fipaldini, C., Bellei, B. & La Monica, N. (1999). Expression of hepatitis C virus cDNA in human hepatoma cell line mediated by a hybrid baculovirus-HCV vector. Virology 255, 302-311.[Medline]
Gamarnik, A. V. & Andino, R. (1998). Switch from translation to RNA replication in a positive-stranded RNA virus. Genes & Development 12, 2293-2304.
Gossen, M. & Bujard, H. (1992). Tight control of gene-expression in mammalian-cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences, USA 89, 5547-5551.
Grakoui, A., Wychowski, C., Lin, C., Feinstone, S. M. & Rice, C. M. (1993). Expression and identification of hepatitis C virus polyprotein cleavage products. Journal of Virology 67, 1385-1395.
Harding, T. C., Geddes, B. J., Murphy, D., Knight, D. & Uney, J. B. (1998). Switching transgene expression in the brain using an adenoviral tetracycline-regulable system. Nature Biotechnology 16, 553-555.[Medline]
Hofmann, A., Nolan, G. P. & Blau, H. M. (1996). Rapid retroviral delivery of tetracycline-inducible genes in a single autoregulatory cassette. Proceedings of the National Academy of Sciences, USA 93, 5185-5190.
Hofmann, C., Sandig, V., Jennings, G., Rudolph, M., Schlag, P. & Strauss, M. (1995). Efficient gene-transfer into human hepatocytes by baculovirus vectors. Proceedings of the National Academy of Sciences, USA 92, 10099-10103.
Hoppe, U. C., Marban, E. & Johns, D. C. (2000). Adenovirus-mediated inducible gene expression in vivo by a hybrid ecdysone receptor. Molecular Therapy 1, 159-164.[Medline]
Hwang, J. J., Scuric, Z. & Anderson, W. F. (1996). Novel retroviral vector transferring a suicide gene and a selectable marker gene with enhanced gene expression by using a tetracycline-responsive expression system. Journal of Virology 70, 8138-8141.[Abstract]
Iida, A., Chen, S. T., Friedmann, T. & Yee, J. K. (1996). Inducible gene expression by retrovirus-mediated transfer of a modified tetracycline-regulated system. Journal of Virology 70, 6054-6059.[Abstract]
Ito, T., Tahara, S. M. & Lai, M. M. C. (1998). The 3'-untranslated region of hepatitis C virus RNA enhances translation from an internal ribosomal entry site. Journal of Virology 72, 8789-8796.
Johns, D. C., Marx, R., Mains, R. E., ORourke, B. & Marban, E. (1999). Inducible genetic suppression of neuronal excitability. Journal of Neuroscience 19, 1691-1697.
Khromykh, A. A., Varnavski, A. N., Sedlak, P. L. & Westaway, E. G. (2001). Coupling between replication and packaging of flavivirus RNA: Evidence derived from the use of DNA-based full-length cDNA clones of Kunjin virus. Journal of Virology 75, 4633-4640.
King, L. A & Possee, R. D. (1992). The Baculovirus Expression System: a Laboratory Guide, 1st edn. London: Chapman and Hall.
Kitts, P. A. & Possee, R. D. (1993). A method for producing recombinant baculovirus expression vectors at high-frequency. Biotechniques 14, 810-817.[Medline]
Lohmann, V., Korner, F., Koch, J. O., Herian, U., Theilmann, L. & Bartenschlager, R. (1999). Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285, 110-113.
McVoy, M. A. & Mocarski, E. S. (1999). Tetracycline-mediated regulation of gene expression within the human cytomegalovirus genome. Virology 258, 295-303.[Medline]
Michel, Y. M., Borman, A. M., Paulous, S. & Kean, K. M. (2001). Eukaryotic initiation factor 4Gpoly(A) binding protein interaction is required for poly(A) tail-mediated stimulation of picornavirus internal ribosome entry segment-driven translation but not for X-mediated stimulation of hepatitis C virus translation. Molecular and Cellular Biology 21, 4097-4109.
Mizuno, M., Yamada, G., Tanaka, T., Shimotohno, K., Takatani, M. & Tsuji, T. (1995). Virion-like structures in HeLa g cells transfected with the full-length sequence of the hepatitis-C virus genome. Gastroenterology 109, 1933-1940.[Medline]
Moradpour, D., Kary, P., Rice, C. M. & Blum, H. E. (1998). Continuous human cell lines inducibly expressing hepatitis C virus structural and nonstructural proteins. Hepatology 28, 192-201.[Medline]
Murakami, K., Abe, M., Kageyama, T., Kamoshita, N. & Nomoto, A. (2001). Down-regulation of translation driven by hepatitis C virus internal ribosomal entry site by the 3' untranslated region of RNA. Archives of Virology 146, 729-741.[Medline]
Myung, J., Khalap, N., Kalkeri, G., Garry, R. & Dash, S. (2001). Inducible model to study negative strand RNA synthesis and assembly of hepatitis C virus from a full-length cDNA clone. Journal of Virological Methods 94, 55-67.[Medline]
Neering, S. J., Hardy, S. F., Minamoto, D., Spratt, S. K. & Jordan, C. T. (1996). Transduction of primitive human hematopoietic cells with recombinant adenovirus vectors. Blood 88, 1147-1155.
Nielsen, D. A., Chou, J., Mackrell, A. J., Casadaban, M. J. & Steiner, D. F. (1983). Expression of a preproinsulin-beta-galactosidase gene fusion in mammalian cells. Proceedings of the National Academy of Sciences, USA 80, 5198-5202.
No, D., Yao, T. P. & Evans, R. M. (1996). Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proceedings of the National Academy of Sciences, USA 93, 3346-3351.
Paulus, W., Baur, I., Boyce, F. M., Breakefield, X. O. & Reeves, S. A. (1996). Self-contained, tetracycline-regulated retroviral vector system for gene delivery to mammalian cells. Journal of Virology 70, 62-67.[Abstract]
Sells, M. A., Chen, M. L. & Acs, G. (1987). Production of hepatitis-B virus-particles in HepG2 cells transfected with cloned hepatitis-B virus-DNA. Proceedings of the National Academy of Sciences, USA 84, 1005-1009.
Semler, B. L., Dorner, A. J. & Wimmer, E. (1984). Production of infectious poliovirus from cloned cDNA is dramatically increased by SV40 transcription and replication signals. Nucleic Acids Research 12, 5123-5141.
Shoji, I., Aizaki, H., Tani, H., Ishii, K., Chiba, T., Saito, I., Miyamura, T. & Matsuura, Y. (1997). Efficient gene transfer into various mammalian cells, including non-hepatic cells, by baculovirus vectors. Journal of General Virology 78, 2657-2664.[Abstract]
Shoji, I., Suzuki, T., Sato, M., Aizaki, H., Chiba, T., Matsuura, Y. & Miyamura, T. (1999). Internal processing of hepatitis C virus NS3 protein. Virology 254, 315-323.[Medline]
Stenberg, R. M., Thomsen, D. R. & Stinski, M. F. (1984). Structural-analysis of the major immediate early gene of human cytomegalovirus. Journal of Virology 49, 190-199.
Tsurimoto, T., Fujiyama, A. & Matsubara, K. (1987). Stable expression and replication of hepatitis-B virus genome in an integrated state in a human hepatoma-cell line transfected with the cloned viral-DNA. Proceedings of the National Academy of Sciences, USA 84, 444-448.
Yanagi, M., Purcell, R. H., Emerson, S. U. & Bukh, J. (1997). Transcripts from a single full-length cDNA clone of hepatitis C virus are infectious when directly transfected into the liver of a chimpanzee. Proceedings of the National Academy of Sciences, USA 94, 8738-8743.
Yang, S. H., Lee, C. G., Song, M. K. & Sung, Y. C. (2000). Internal cleavage of hepatitis C virus NS3 protein is dependent on the activity of NS34A protease. Virology 268, 132-140.[Medline]
Yap, C. C., Ishii, K., Aizaki, H., Tani, H., Aoki, Y., Ueda, Y., Matsuura, Y. & Miyamura, T. (1998). Expression of target genes by coinfection with replication-deficient viral vectors. Journal of General Virology 79, 1879-1888.[Abstract]
Yoshida, Y. & Hamada, H. (1997). Adenovirus-mediated inducible gene expression through tetracycline-controllable transactivator with nuclear localization signal. Biochemical and Biophysical Research Communications 230, 426-430.[Medline]
Received 28 August 2001;
accepted 23 October 2001.
This article has been cited by other articles:
![]() |
C. J. McCormick, O. Salim, P. R. Lambden, and I. N. Clarke Translation Termination Reinitiation between Open Reading Frame 1 (ORF1) and ORF2 Enables Capsid Expression in a Bovine Norovirus without the Need for Production of Viral Subgenomic RNA J. Virol., September 1, 2008; 82(17): 8917 - 8921. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kitajima and H. Takaku Induction of Antitumor Acquired Immunity by Baculovirus Autographa californica Multiple Nuclear Polyhedrosis Virus Infection in Mice Clin. Vaccine Immunol., February 1, 2008; 15(2): 376 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Ward, C. J. McCormick, I. N. Clarke, O. Salim, C. E. Wobus, L. B. Thackray, H. W. Virgin IV, and P. R. Lambden Recovery of infectious murine norovirus using pol II-driven expression of full-length cDNA PNAS, June 26, 2007; 104(26): 11050 - 11055. [Abstract] [Full Text] [PDF] |
||||
![]() |
|