|
|
||||||||
Insect |
Department of Biological Sciences and Tropical Marine Science Institute, National University of Singapore, Singapore1192601
Key Laboratory of Marine Biotechnology, The Third Institute of Oceanography, State Oceanic Administration, Xiamen 361005, The Peoples Republic of China2
Author for correspondence: Choy L. Hew. Fax +65 7792486. e-mail dbshead{at}nus.edu.sg
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In 1997, the WSSV genomic DNA was successfully purified from Penaeus japonicus in our laboratory (Yang et al., 1997
), and the genomic DNA and cDNA libraries were constructed. The virus contains a 305 kb double-stranded circular DNA (Yang et al., 2001
). Studies on WSSV genes and their regulation will be helpful for the diagnosis and control of the virus infection. However, in contrast with the insect baculoviruses, some of the best-studied viruses, only a few genes from WSSV have been reported (van Hulten et al., 2000a
, b
, c
; Tsai et al., 2000a
, b
; Zhang et al., 2000
, 2001
).
By analysis and comparison of the WSSV genomic DNA and cDNA libraries, an open reading frame (ORF; termed the p22 gene) that probably encodes a structural protein was identified. This study is aimed at characterizing the gene.
| Methods |
|---|
|
|
|---|
Sequencing and computer analysis of the p22 gene.
Expression and purification of the p22 gene in E. coli.
The p22 gene was cloned and expressed in pGEX-4T-2-pLysS as a fusion protein with glutathione S-transferase (GST) (Pharmacia Biotech). The p22 gene was amplified using the synthesized forward primer 5' CACGGATCCATGGAATTTGGCAACCT 3', with a BamHI site (italic), and the reverse primer 5' AGACCCGGGTTACTTCTTCTTGATTT 3', with a SmaI site (italic). The amplified DNA and plasmid vector pGEX-4T-2 were digested with BamHI+SmaI. After purification and ligation of DNA fragments, the p22 gene was inserted into the pGEX-4T-2 vector downstream of GST. The resulting plasmid was named pGEX22. The competent cells of E. coli pLysS were transformed by pGEX22, and colonies containing transformants were screened by PCR. pGEX22 was confirmed by digestion with BamHI+SmaI and DNA sequencing. The following treatments were conducted for the expression of the p22 gene:
A, pGEX22-pLysS (containing the p22 gene) induced;
B, pGEX22-pLysS (containing the p22 gene) non-induced;
C, pGEX-4T-2-pLysS (the vector only as a control) induced;
D, pGEX-4T-2-pLysS (the vector only as a control) non-induced.
After incubation at 37 °C overnight, pGEX22-pLysS and pGEX-4T-2-pLysS were inoculated into new media at the ratio 1:100. When the OD600 was 0·6, the bacteria were induced with the lactose analogue IPTG and grew for an additional 6 h at 37 °C. The induced and non-induced bacteria were analysed by SDSPAGE.
The recombinant pGEX22-pLysS was incubated and induced in 1000 ml LB media. The induced bacterium was spun down (4000 g) at 4 °C, suspended in ice-cold PBS (containing 1% Triton X-100, 1 mM PMSF, 4 mM benzamidine, 10 µg leupeptin and 10 µg aprotinin) and sonicated for 30 s on ice. The sonicate was mixed with glutathioneagarose beads (Sigma) and incubated at 4 °C for 2 h. The beads were washed with ice-cold PBS and incubated in reducing buffer (50 mM TrisHCl, 10 mM reduced glutathione, pH 8·0) at room temperature for 10 min. After centrifugation at 1000 g for 5 min, the supernatant was collected and detected by SDSPAGE.
Preparation of antibody.
The purified GSTP22 fusion protein was used as antigen to immunize mice by intradermal injection once every 2 weeks over an 8-week period. Antigen (5 µg) was mixed with an equal volume of Freunds complete adjuvant (Sigma) for the first injection. Subsequent injections were conducted using 5 µg of antigen mixed with an equal volume of Freunds incomplete adjuvant (Sigma). Four days after the last injection, mice were exsanguinated, and antisera collected. The titres of the antisera were 1:20000 as determined by ELISA. ELISA was performed essentially as described by Harlow & Lane (1988)
. The immunoglobulin (IgG) fraction was purified by protein ASepharose (Bio-Rad) (Sambrook et al., 1989
) and stored at -70 °C. The optimal dilution of purified IgG, after serial dilutions, was 1:1000, as determined by ELISA. Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG was obtained from Sigma. Antigen was replaced by PBS in negative control assays.
Transcriptional analysis of p22 gene
Shrimp infection with WSSV.
The infected tissue from P. monodon shrimp with a pathologically confirmed infection was homogenized in TN buffer (20 mM TrisHCl and 400 mM NaCl, pH 7·4) at 0·1 g/ml. After centrifugation at 2000 g for 10 min, the supernatant was diluted to 1:100 with 0·9% NaCl and filtered (0·22 µm filter). 0·2 ml of the filtrate was injected intramuscularly into each healthy shrimp (determined by PCR) in the lateral area of the fourth abdominal segment. At various times post-infection, four specimens were selected at random and their haemolymph was collected. The collected haemolymph samples were immediately frozen and stored at -70 °C.
RTPCR.
Total RNA was isolated from WSSV-infected shrimp haemolymph according to the manufacturers instructions (Macherey-Nagel). Then RTPCR was performed with primers 5' AGACCCGGGTTACTTCTTCTTGATTT 3' and 5' AGACCCGGGTTACTTCTTCTTGATTT 3' using a TITANIUM One-step RTPCR kit (Clontech Laboratories). The RTPCR cycles were as follows: 1 h at 50 °C; 5 min at 94 °C; 30 s at 94 °C, 30 s at 65 °C, 1 min at 68 °C, 30 cycles; 2 min at 68 °C.
Western blot.
The infected shrimp haemolymph samples (dilution 1:10) from various times were analysed in a 12% SDSPAGE gel. Proteins were visualized using Coomassie brilliant blue staining. The proteins were transferred onto a nitrocellulose membrane (Bio-Rad) in electroblotting buffer (25 mM Tris, 190 mM glycine, 20% methanol) for 3 h. The membrane was immersed in blocking buffer (3% BSA, 20 mM Tris, 0·9% NaCl, 0·1% Tween 20, pH 7·2) at 4 °C overnight followed by incubation with a polyclonal mouse anti-GSTP22 IgG or mouse anti-GST IgG for 3 h. Subsequently, HRP-conjugated goat anti-mouse IgG (Sigma) was used and detection was performed with substrate solution (4-chloro-1-naphthol, Sigma).
Shrimp WSSV and immuno-electron microscopy
Intact WSSV.
The infected tissue from P. monodon shrimp was homogenized and centrifuged as described above and the supernatant was injected (1:100 dilution in 0·9% NaCl) intramuscularly into healthy crayfish (Cambarus clarkii) from Singapore in the lateral area of the fourth abdominal segment. Four days later, haemolymph freshly extracted from infected crayfish was layered on the top of the 1040% (w/v) continuous sodium bromide gradient and centrifuged at 110000 g using an RP40-T rotor in the Prespin Ultracentrifuge (Shimadzu model MSE-75) for 2 h at 4 °C. Virus bands were collected by side puncture, diluted 1:10 in TNE buffer (50 mM TrisHCl, 100 mM NaCl and 1 mM EDTA, pH 7·4) and pelleted at 119000 g for 1 h at 4 °C. The resulting pellets were resuspended in TNE. Virus samples were examined under a transmission electron microscope (JEOL 100 cxII, Japan) for purity (Huang et al., 2001
).
Nucleocapsid of WSSV.
WSSV virus particles were treated with 0·51·0% Triton X-100 for 30 min at room temperature, and then centrifuged at 119000 g using an SW 41-Ti rotor (Beckman Coulter). The pellet was resuspended in 0·1xTNE buffer and centrifuged at 119000 g. After several repeats to completely remove Triton X-100, the resulting WSSV nucleocapsids were resuspended in TNE. Samples were examined under a transmission electron microscope (JEOL 100 cxII, Japan).
Immuno-electron microscopy.
The purified WSSV virion suspension and nucleocapsids were mounted on carbon-coated nickel grids (200 mesh), respectively and incubated for 1 h at room temperature. After washing with PBS, the grids were blocked with 3% BSA for 1 h. The grids were rinsed with PBS and incubated in mouse anti-GSTP22 IgG or mouse anti-GST IgG or pre-immune serum of mouse for 1 h at room temperature followed by washing with PBS. Then 15 nm gold-labelled anti-mouse IgG raised in goat (Sigma) was added to the grids and incubated for 1 h at room temperature. After negative staining with 2% phosphotungstic acid, the specimens were examined under a transmission electron microscope.
| Results |
|---|
|
|
|---|
|
Expression and purification of the p22 gene
The p22 gene was cloned into a pGEX-4T-2 vector and expressed as a GST fusion protein. After induction with IPTG at 37 °C, induced and non-induced pGEX22-pLysS (containing the p22 gene) and pGEX-4T-2-pLysS (the vector only) were analysed by SDSPAGE (Fig. 2
). A band (about 52 kDa) corresponding to the GSTP22 fusion protein (GST 26 kDa+P22 26 kDa) was observed in the induced pGEX22-pLysS (Fig. 2
, lane 3). No protein was found at the same position in the induced and non-induced pGEX-4T-2-pLysS (Fig. 2
, lanes 4 and 5). This showed that the p22 gene was expressed. The induced recombinant pGEX22-pLysS was purified using affinity chromatography. A purified fusion protein, GSTP22, was obtained (Fig. 2
, lane 6).
|
|
Transmission electron microscopy studies
Intact WSSV and nucleocapsids were purified from the haemolymph of WSSV-infected crayfish. As a negative control, haemolymph was also taken from healthy crayfish. Under transmission electron microscopy, many enveloped and rod-shaped virions were found in the infected samples (Fig. 4A
), and no virus particles were found in the healthy crayfish samples. After the removal of the envelope, the nucleocapsid was obtained (Fig. 4B
). The purified WSSV virions and nucleocapsids were incubated with anti-GSTP22 IgG or anti-GST IgG or pre-immune serum of mouse, respectively, followed by incubation with the gold-labelled secondary antibody on the carbon-coated nickel grids. After hybridization, the gold particles could be clearly found on the envelopes of WSSV virions labelled with the anti-GSTP22 IgG (Fig. 4C
), but no gold particle was found on the non-enveloped nucleocapsid with the same antibody (Fig. 4D
). As controls, no gold particles could be observed on the envelope of WSSV or the nucleocapsid labelled with anti-GST IgG or pre-immune serum of mouse. This showed that the P22 protein was distributed in the envelopes of WSSV virions.
|
| Discussion |
|---|
|
|
|---|
The p22 gene was obtained by screening a cDNA library of WSSV isolated from P. japonicus in China, whereas the vp26 gene was found in the Thailand WSSV isolate from P. monodon (van Hulten et al., 2000b
). In spite of the different geographical locations and species from which the isolates were obtained, the comparison of protein and DNA sequences showed that p22 and vp26 were 100% identical. Earlier studies also showed that there was little genetic variation among WSSV isolates (Lo et al., 1999
). However, it is too soon to conclude that all WSSV geographical isolates are genetically similar, and further genetic studies are needed.
Generally, structural protein genes in the viral genomes are late genes, but some structural protein genes of insect baculoviruses can be transcribed in the early stage post-infection. Temporal analysis of the p22 gene transcript by RTPCR showed that it was a late gene from WSSV, and the gene transcripts accumulated in the course of infection (Fig. 3
). However, the conserved motif (ATAAG) presented in the late genes of insect baculoviruses could not be found in the DNA sequence corresponding to the p22 gene. This suggested that WSSV was different from the baculoviruses.
The P22 protein was one of the envelope proteins from WSSV. It could be selected to further study, in particular, its relatedness to structural proteins of other viruses, including baculoviruses. It could also be used to reveal the infectioun process of WSSV in shrimp by hybridization in situ and to study if the P22 protein has an effect on WSSV infection. Antibody against P22 protein might serve as a specific diagnostic reagent to detect WSSV infection in shrimp.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Chang, P. S., Lo, C. F., Wang, Y. C. & Kou, G. H. (1996). Identification of white spot syndrome associated baculovirus (WSBV) target organs in the shrimp Penaeus monodon by in situ hybridization. Diseases of Aquatic Organisms 27, 131-139.
Chen, X. F., Chen, P. & Wu, D. H. (1997). Study on a new bacilliform virus in cultured shrimps. Science in China Series C 27, 415-420.
Chou, H. Y., Huang, C. Y., Wang, C. H., Chiang, H. C. & Lo, C. F. (1995). Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan. Diseases of Aquatic Organisms 23, 165-173.
Durand, S., Lightner, D. V., Redman, R. M. & Bonami, J. R. (1997). Ultrastructure and morphogenesis of white spot syndrome baculovirus (WSSV). Diseases of Aquatic Organisms 29, 205-211.
Flegel, T. W. (1997). Major viral diseases of the black tiger prawn (Penaeus monodon) in Thailand. World Journal of Microbiology and Biotechnology 13, 433-442.
Harlow, E. & Lane, D. (1988). Antibodies: A Laboratory Manual, pp. 553612. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Huang, C., Zhang, L., Zhang, J., Xiao, L., Wu, Q., Chen, D. & Li, J. (2001). Purification and characterization of white spot syndrome virus (WSSV) produced in an alternate host: crayfish, Cambarus clakii. Virus Research 76, 115-125.[Medline]
Inouye, K., Yamano, K. & Ikeda, N. (1996). The penaeid rod-shaped virus (PRDV) which caused penaeid acute viremia (PAV). Fish Pathology 31, 39-45.
Kozak, M. (1987). An analysis of 5' noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research 15, 8125-8132.
Lo, C. F., Hsu, H. C., Tsai, M. F., Ho, C. H., Peng, S. E., Kou, G. H. & Lightner, D. V. (1999). Specific genomic fragment analysis of different geographical clinical samples of shrimp white spot syndrome virus. Diseases of Aquatic Organisms 35, 175-185.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Tapay, L. M., Lu, Y., Gose, R. B., Nadala, E. C. B., Brock, J. A. & Loh, P. C. (1997). Development of an in vitro quantal assay in primary cell cultures for a non-occluded baculo-like virus of penaeid shrimp. Journal of Virological Methods 64, 37-41.[Medline]
Tsai, M. F., Lo, C. F., van Hulten, M. C., Tzeng, H. F., Chou, C. M., Huang, C. J., Wang, C. H., Lin, J. Y., Vlak, J. M. & Kou, G. H. (2000a). Transcriptional analysis of the ribonucleotide reductase genes of shrimp white spot syndrome virus. Virology 277, 92-99.[Medline]
Tsai, M. F., Yu, H. T., Tzeng, H. F., Leu, J. H., Chou, C. M., Huang, C. J., Wang, C. H., Lin, J. Y., Kou, G. H. & Lo, C. F. (2000b). Identification and characterization of a shrimp white spot syndrome virus (WSSV) gene that encodes a novel chimeric polypeptide of cellular-type thymidine kinase and thymidylate kinase. Virology 277, 100-110.[Medline]
van Hulten, M. C. W., Tsai, M.-F., Schipper, C. A., Lo, C.-F., Kou, G.-H. & Vlak, J. M. (2000a). Analysis of a genomic segment of white spot syndrome virus of shrimp containing ribonucleotide reductase genes and repeat regions. Journal of General Virology 81, 307-316.
van Hulten, M. C., Westenberg, M., Goodall, S. D. & Vlak, J. M. (2000b). Identification of two major protein genes of white spot syndrome virus of shrimp. Virology 266, 227-236.[Medline]
van Hulten, M. C. W., Goldbach, R. W. & Vlak, J. M. (2000c). Three functionally diverged major structural proteins of white spot syndrome virus evolved by gene duplication. Journal of General Virology 81, 2525-2529.
Wang, C. H., Lo, C. F., Leu, J. H., Chou, C. M., Yeh, P. Y., Chou, H. Y., Tung, M. C., Chang, C. F., Su, M. S. & Kou, G. H. (1995). Purification and genomic analysis of baculovirus associated with white spot syndrome (WSBV) of Penaeus monodon. Diseases of Aquatic Organisms 23, 239-242.
Wongteerasupaya, C., Vickers, J. E., Sriurairatana, S., Nash, G. L., Akarajamorn, A., Boonsaeng, V., Panyim, S., Tassanakajon, A., Withyachumnarnkul, B. & Flegel, T. W. (1995). A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Diseases of Aquatic Organisms 21, 69-77.
Yang, F., Wang, W., Chen, R. Z. & Xu, X. (1997). A simple and efficient method for purification of prawn baculovirus DNA. Journal of Virological Methods 67, 1-4.[Medline]
Yang, F., He, J., Lin, X., Li, Q., Pan, D., Zhang, X. & Xu, X. (2001). Complete genome sequence of the shrimp white spot bacilliform virus. Journal of Virology 75, 11811-11820.
Zhang, X., Xu, X. & Yang, F. (2000). The minicistron from a gene of prawn white spot bacilliform virus (WSBV) and its expression. Acta Oceanologica Sinica 19, 117-124.
Zhang, X., Xu, X. & Yang, F. (2001). The structure and function of a gene encoding a basic peptide from white spot syndrome virus. Virus Research 79, 137-144.[Medline]
Received 15 August 2001;
accepted 1 November 2001.
This article has been cited by other articles:
![]() |
Z. Li, Q. Lin, J. Chen, J. L. Wu, T. K. Lim, S. S. Loh, X. Tang, and C.-L. Hew Shotgun Identification of the Structural Proteome of Shrimp White Spot Syndrome Virus and iTRAQ Differentiation of Envelope and Nucleocapsid Subproteomes Mol. Cell. Proteomics, September 1, 2007; 6(9): 1609 - 1620. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tang, J. Wu, J. Sivaraman, and C. L. Hew Crystal Structures of Major Envelope Proteins VP26 and VP28 from White Spot Syndrome Virus Shed Light on Their Evolutionary Relationship J. Virol., June 15, 2007; 81(12): 6709 - 6717. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xie and F. Yang White spot syndrome virus VP24 interacts with VP28 and is involved in virus infection J. Gen. Virol., July 1, 2006; 87(7): 1903 - 1908. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Li, S. Lin, and F. Yang Characterization of an envelope protein (VP110) of White spot syndrome virus J. Gen. Virol., July 1, 2006; 87(7): 1909 - 1915. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Tsai, H.-C. Wang, J.-H. Leu, A. H.-J. Wang, Y. Zhuang, P. J. Walker, G.-H. Kou, and C.-F. Lo Identification of the Nucleocapsid, Tegument, and Envelope Proteins of the Shrimp White Spot Syndrome Virus Virion J. Virol., March 15, 2006; 80(6): 3021 - 3029. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Huang, Y. Xie, J. Zhang, and Z. Shi A novel envelope protein involved in White spot syndrome virus infection J. Gen. Virol., May 1, 2005; 86(5): 1357 - 1361. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Leu, J.-M. Tsai, H.-C. Wang, A. H.-J. Wang, C.-H. Wang, G.-H. Kou, and C.-F. Lo The Unique Stacked Rings in the Nucleocapsid of the White Spot Syndrome Virus Virion Are Formed by the Major Structural Protein VP664, the Largest Viral Structural Protein Ever Found J. Virol., January 1, 2005; 79(1): 140 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Tsai, H.-C. Wang, J.-H. Leu, H.-H. Hsiao, A. H.-J. Wang, G.-H. Kou, and C.-F. Lo Genomic and Proteomic Analysis of Thirty-Nine Structural Proteins of Shrimp White Spot Syndrome Virus J. Virol., October 15, 2004; 78(20): 11360 - 11370. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Li, D. Pan, J.-h. Zhang, and F. Yang Identification of the thymidylate synthase within the genome of white spot syndrome virus J. Gen. Virol., July 1, 2004; 85(7): 2035 - 2044. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yi, J. Qian, Z. Wang, and Y. Qi A phage-displayed peptide can inhibit infection by white spot syndrome virus of shrimp J. Gen. Virol., September 1, 2003; 84(9): 2545 - 2553. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Marks, M. Mennens, J. M. Vlak, and M. C. W. van Hulten Transcriptional analysis of the white spot syndrome virus major virion protein genes J. Gen. Virol., June 1, 2003; 84(6): 1517 - 1523. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huang, X. Zhang, Q. Lin, X. Xu, and ChoyL. Hew Characterization of a novel envelope protein (VP281) of shrimp white spot syndrome virus by mass spectrometry J. Gen. Virol., October 1, 2002; 83(10): 2385 - 2392. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Huang, X. Zhang, Q. Lin, X. Xu, Z. Hu, and C.-L. Hew Proteomic Analysis of Shrimp White Spot Syndrome Viral Proteins and Characterization of a Novel Envelope Protein VP466 Mol. Cell. Proteomics, March 1, 2002; 1(3): 223 - 231. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |