J Gen Virol Tips for Better Browsing
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, J.-a.
Right arrow Articles by Studdert, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, J.-a.
Right arrow Articles by Studdert, M. J.
Agricola
Right arrow Articles by Huang, J.-a.
Right arrow Articles by Studdert, M. J.
Journal of General Virology (2002), 83, 525-531.
© 2002 Society for General Microbiology


Animal: DNA Viruses

Polymorphism of open reading frame 71 of equine herpesvirus-4 (EHV-4) and EHV-1

Jin-an Huang1, Nino Ficorilli1, Carol A. Hartley1, George P. Allen2 and Michael J. Studdert1

Centre for Equine Virology, School of Veterinary Science, The University of Melbourne, Parkville, Victoria 3010, Australia1
Gluck Equine Research Centre, University of Kentucky, Lexington, Kentucky 40546, USA2

Author for correspondence: Jin-an Huang. Fax +61 383 447 374. e-mail j.huang{at}vet.unimelb.edu.au


   Abstract
TOP
Abstract
Main text
References
 
Open reading frame (ORF) 71 genes of both equine herpesvirus-1 (EHV-1) and EHV-4 encode a unique glycoprotein, which has been described to vary in molecular mass from 200 to 450 kDa. Using PCR and nucleotide sequence analysis, it was shown that the ORF 71 genes of EHV-1 and EHV-4 are polymorphic due to a variable number of reiterated sequences in two regions, designated regions A and B. Region A was threonine-rich and was located near the N terminus. Region B comprised a 38 amino acid repeat near the C terminus that expanded following cell culture adaptation. Western blot analysis of viruses showed that EHV-4 gp2 was modified by glycosylation and that variation in region A resulted in the marked differences in the molecular mass of EHV-4 gp2.


   Main text
TOP
Abstract
Main text
References
 
Equine herpesvirus-1 (EHV-1) and EHV-4 are the major virus causes of abortion and respiratory infection in horses (Allen & Bryans, 1986Down ; Crabb & Studdert, 1995Down ). The complete sequences of the genomes of both EHV-1 and EHV-4 have been determined and most of the open reading frames (ORFs) have been identified (Telford et al., 1992Down , 1998Down ). However, the functions of many proteins of EHV-1 and EHV-4 encoded by the identified ORFs have yet to be elucidated. Indeed, the presence of various copies of repeat sequences in some of the ORFs, changes through cell culture adaptation, and post-translational modifications have complicated the assignment of proteins to their cognate ORFs (Allen et al., 1983Down ; Hubert et al., 1996Down ; Kirisawa et al., 1994Down ; Wellington et al., 1996aDown ).

One of the glycoproteins of EHV-1, described originally as gp2 or gp300 (Allen & Yeargan, 1987Down ; Whittaker et al., 1990Down ), was confirmed, after considerable debate and uncertainty, to be encoded by ORF 71 (Sun et al., 1994Down ; Wellington et al., 1996aDown ; Whittaker et al., 1992Down ). ORF 71 is only found in EHV-1, EHV-4 and asinine herpesvirus-3 (Crabb & Studdert, 1990Down ). The gp2 proteins of both EHV-1 and EHV-4 are rich in serine and threonine residues (Telford et al., 1992Down , 1998Down ) and several studies have shown that EHV-1 gp2 is heavily glycosylated, mostly with O-linked carbohydrates (Sun et al., 1994Down ; Whittaker et al., 1990Down ). EHV-1 gp2 was also shown to be proteolytically cleaved into two peptides and the region of O-linked carbohydrates was located in the serine- and threonine-rich N-terminal peptide (Wellington et al., 1996aDown , bDown ). ORF 71 is not essential for virus growth in cell culture and EHV-1 ORF 71 deletion mutants produced smaller plaques (Sun & Brown, 1994Down ; Sun et al., 1996Down ). Attenuation of EHV-1 through passages in cell cultures of non-equine origin was correlated with significant changes in the sizes of ORFs 1, 24 and 71 but no detailed analyses of the molecular basis for these changes were reported (Kirisawa et al., 1994Down ). Mouse model studies of an EHV-1 mutant with an ORF 71 deletion demonstrated that the gene was required for the full expression of virulence (Marshall et al., 1997Down ), although a subsequent study showed that the same EHV-1 mutant failed to protect the pregnant mice (Fitzmaurice et al., 1997Down ). EHV-1 and EHV-4 gp2 have been observed to vary remarkably in molecular mass from 200 to 450 kDa (Whittaker et al., 1990Down ; Zheng et al., 1995Down ) but no explanation has been offered for the observed differences and the function of the gene remains unknown.

In this study, we report that the ORF 71 sequences of both EHV-1 and EHV-4 are highly heterogeneous due to changes in two regions, designated regions A and B. Variable amounts of glycosylation within region A are proposed as the basis for the significant variation in the molecular mass of gp2 between strains.

The EHV-1 and EHV-4 isolates used in this study and their passage numbers are listed in Table 1Down. Plaque purification and virus purification were as described before (Crabb & Studdert, 1990Down ; Studdert & Blackney, 1979Down ).


View this table:
[in this window]
[in a new window]
 
Table 1. EHV used in this study

 
Four and six plaque isolates from EHV-4.405/76 at passage 2 (EHV-4.405/76.pa2) and 80 (EHV-4.405/76.pa80), respectively, were selected randomly and subjected to three rounds of plaque purification. The complete EHV-4.405/76 ORF 71 sequence was amplified from EHV-4.405/76 infected cell lysates by PCR using two primers based on EHV-4.NS80567 (Telford et al., 1998Down ). Gel analysis showed that the complete ORF 71 PCR products of plaque-purified viruses from EHV-4.405/76.pa2 were consistent but viruses plaque-purified from EHV-4.405/76.pa80 varied in size (data not shown).

The PCR products of ORF 71 of EHV-4.405/76.pa2 and EHV-4.405/76.pa80 were used directly for sequencing to obtain consensus sequences and the PCR products of viruses plaque-purified from EHV-4.405/76 were cloned into pUC18 and then sequenced following the ABI Big Dye Terminator sequencing protocol. The nucleotide sequences of ORF 71 from the four viruses plaque-purified from EHV-4.405/76.pa2 showed no variation and completely agreed with the consensus sequence of EHV-4.405/76.pa2. Among the ORF 71 sequences from the six plaque isolates from EHV-4.405/76.pa80, three were identical to each other and to the consensus sequence of EHV-4.405/76.pa80, whereas the others varied in length. Alignment of the deduced amino acid sequences revealed that the ORF 71 sequence is highly conserved except for two regions that contain reiterated sequences (Fig. 1ADown). Region A, located within the HindIII–EcoRI restriction sites near the 5' end of ORF 71, involved about 500 nucleotides encoding two types of amino acid repeats, TAATT and TADT, with the latter being more variable in copy number. Region B is located near the 3' end of the gene and involved copies of a 114 bp direct nucleotide repeat encoding 38 amino acids. Five out of the six plaque isolates derived from EHV-4.405/76.pa80 had three copies of the 38 amino acid repeat (Fig. 1ADown). When searched against sequences in GenBank, the region B repeat had no significant matches other than with EHV-4. The differences in gp2 between EHV-4.405/76 viruses and EHV-4.NS80567 (Telford et al., 1998Down ) were also confined to the two regions (Fig. 1ADown).



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 1. Comparison of deduced gp2 amino acid sequences of EHV-4 and EHV-1. Shaded regions indicate conserved sequences. The number of amino acids in the conserved regions is indicated. The two regions containing repetitive sequences, designated regions A and B, are indicated. The repeat sequences are in brackets and the number of repeat units is shown. When the number of repeat units is 0, the repeat sequence is absent. ND, Not determined. (A) Alignment of the deduced gp2 amino acid sequences of plaque-purified viruses and selected EHV-4 isolates. The sequences for EHV-4.405/76.pa2 and EHV-4.405/76.pa80 as shown were determined by directly sequencing the PCR products and, therefore, may represent only the dominant sequence in the virus pool. Plaques were derived from EHV-4.405/76.pa80 by three rounds of plaque purification. Sequences for plaque 4 and plaque 6 isolates were identical to plaque 3 and, thus, are not shown. One of the repeat units only contained TTEST (a) and one of the TTESTTAATT repeat units (b) was linearly permutated to TAATTTTEST. (B) Alignment of the deduced gp2 amino acid sequences of selected EHV-1 isolates. EHV-4.NS80567 and EHV-1.Ab4 genomic sequences were obtained from earlier publications (Telford et al., 1992Down , 1998Down ) and the primers used to amplify the full ORF 71 sequence of EHV-4.405/76 and EHV-1.438/77 were based on these genomic sequences. The primers used to amplify the ORF 71 sequences were 5' GAGGCAGCTactagtGACTTGAGTACGTTGCTTAACACCTGTC 3' (EHV-1 forward), 5' AGAGTGgagctcGAGTTAATATACAGACGCTCG 3' (EHV-1 reverse), 5' GGCAGCTactagtGACTTGAGTACGTTGCATAATACATGTC 3' (EHV-4 forward) and 5' AGAGTGgagctcCTTCTACACACGCTACCACG 3' (EHV-4 reverse), where lowercase letters represent the restriction sites for subsequent cloning.

 
Based on the above sequence information, PCR primers flanking the two variable regions of EHV-4.405/76 were designed and used to analyse directly EHV-4 present in nasal swabs and EHV-4 at various passages. As shown in Fig. 2(A)Down, region A differed significantly in size between strains and passages, whereas the size of region B was generally conserved among the nasal swab viruses and viruses at low passage number (Fig. 2BDown). EHV-4.405/76.pa80 and five of the six plaque-purified viruses from EHV-4.405/76.pa80 were the only viruses that showed a larger PCR product of region B, which was indicative of three copies of the 114 bp nucleotide repeat (Fig. 2BDown).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 2. PCR and Western blot analysis of EHV-4 isolates. (A) PCR amplification of region A of ORF 71 from primary nasal swabs and EHV-4 isolates after a variable number of passages in cell culture. (B) PCR amplification of region B of ORF 71 from the same set of EHV-4 isolates for region A. Plaques were derived from EHV-4.405/76.pa80 by three rounds of plaque purification. Primers used for PCR were 5' CTACATCAACCTCGGTGTCCG 3' (EHV-4 region A forward), 5' GCCTTAGTTGGTTTCTCCGTG 3' (EHV-4 region A reverse), 5' GTGCGACCAGATAGGTTAACG 3' (EHV-4 region B forward) and 5' GGTGCACGAGGTGAGATCAG 3' (EHV-4 region B reverse). The PCR program ran for 35 cycles under the following conditions: 30 s at 94 °C, 20 s at 56 °C and 1 min at 72 °C, with the exception of the first cycle in which the denaturation step was carried out at 95 °C for 3 min. (C) Western blot of EHV-1 and EHV-4 virus-infected EFK cell lysates probed with mAb 1G12. Virus-infected EFK cell lysates were concentrated 10-fold and viral proteins were separated in a 7·5% polyacrylamide gel under reducing conditions until the largest pre-stained marker (175 kDa) ran off the gel. M, Pre-stained protein ladder (Gibco); pl, plaque derived from EHV-4.405/76.pa70; pa, passage. The ORF 71 sequence of EHV-4.405/76 at passage 3 (EHV-4.405/76.pa3) was determined to be identical to that of EHV-4.405.pa2 (data not shown). (D) Deglycosylation study of gp2 of EHV-1 and EHV-4. Ficoll gradient-purified viruses or EHV-4 gp2 immunoprecipitated from purified viruses with mAb 1G12 were boiled for 5 min in deglycosylation buffer containing 100 mM sodium acetate pH 6·0, 0·5% SDS, 1 mM EDTA and 1 mM PMSF and chilled on ice before the addition of n-octyl glucoside to 1%. Deglycosylation was performed as follows: treatment with 5 mU neuraminidase (N, Clostridium perfringens) (Sigma) alone at 37 °C for 1 h (lanes 1, 9 and 10); treatment with neuraminidase followed by treatment with 2 U recombinant N-glycosidase F (NF) (Roche) at 37 °C for 4 h to remove N-linked carbohydrate (lanes 2, 7, 8, 12 and 13); treatment with neuraminidase and N-glycosidase F followed by treatment with 1 mU O-glycosidase (O, Diplococcus pneumoniae) (Roche) at 37 °C for 4 h (lanes 3, 5 and 6). Deglycosylation samples were analysed by Western blot under reducing conditions with mAb 1G12. The BenchMark pre-stained protein ladder (Invitrogen) was used to indicate molecular mass. Bands at ~50 kDa in lanes 5, 6, 12 and 13 were those of mAb 1G12. Lanes 11, 12 and 13 were from a separate blot. Lanes 5 and 12 were loaded with equal concentrations of protein, as were lanes 6 and 13.

 
The PCR products of regions A and B of some EHV-4 strains were used directly for sequencing. Sequence alignment of different isolates demonstrated that region A was highly variable in the copy number of the reiterations (Fig. 1AUp). In addition to the repeats present in EHV-4.405/76, another type of amino acid repeat, TTESTTAATT, was also found in region A of some EHV-4 strains. Sequences determined for two isolates before and after cell culture adaptation showed that one contained no changes in either region A or region B, whereas the other had a larger region A after adaptation to equine foetal kidney (EFK) cell culture (Fig. 1AUp). Sequence comparison of region A of EHV-4 isolates indicated that the presence or absence of the TTESTTAATT repeat is not affected by cell culture adaptation and that the effect of passages in cell culture on the copy number of the repeat elements in region A is unpredictable (Fig. 1AUp). The copy number of the different repeat elements within region A also appears to be not inter-related and regions A and B are clearly independent of each other in terms of the copy number of the repeats (Fig. 1AUp). Based on the PCR result (Fig. 2BUp), it would be unlikely that region B of the EHV-4 strains at low passages would contain extra copies of the 114 nucleotide repeat, suggesting that the copy number of the repeat sequence in region B resulted from cell culture adaptation.

The study was extended to investigate polymorphism of ORF 71 of EHV-1 isolates. Like that of EHV-4, region A of EHV-1 strains at low passages was also polymorphic (data not shown). When the sequences of region A of selected EHV-1 strains were determined and aligned, it was found that region A of EHV-1 strains contained different copies of a TAATT and SSATTATT sequence (Fig. 1BUp). Sequences from four randomly picked ORF 71 clones of EHV-1.438/77 at passage 12 and three clones of an EHV-1.438/77 glycoprotein G (gG) deletion mutant were identical (Fig. 1BUp). The sequence of gp2 of EHV-1.438/77 and EHV-1.Ab4p (Telford et al., 1992Down ) differed only in the number of repeat sequences in region A (Fig. 1BUp). In contrast, EHV-4.405/76 appeared to be far more variable between passages, probably because EHV-4.405/76 was passaged more times, both in a variety of cell lines and at different temperatures. However, the fact that region A differed between strains isolated directly from horses suggested that variation in region A can occur naturally.

Western blotting analysis under reducing conditions revealed that monoclonal antibody (mAb) 1G12 (Allen & Yeargan, 1987Down ) recognized a band above 175 kDa for each of the EHV isolates used in the assay (Fig. 2CUp). This is much larger than their calculated molecular mass of amino acids alone (<90 kDa). The bands appeared to vary significantly in molecular mass between EHV-1 and EHV-4 and between viruses derived from EHV-4.405/76 in the order of E H V - 1>E H V - 4.405/76.pl1.>E H V - 4.405/76.pa3>E H V-4.405/76.pl5{cong}EHV-4.405/76.pl4 (Fig. 2CUp).

O-Glycosidase treatment of purified EHV-4 gp2 resulted in notable reduction of the molecular mass of EHV-4 (and EHV-1) gp2, supporting the findings by other researchers that the protein was modified by O-glycosylation (Sun et al., 1994Down ; Wellington et al., 1996a; Whittaker et al., 1990Down ); however, the completely deglycosylated gp2 was not detected by mAb 1G12 (Fig. 2DUp) or by polyclonal anti-EHV-4 sera (data not shown). O-Glycosidase treatment was effective only after gp2 was treated with N-glycosidase F (data not shown), which removes N-linked carbohydrates, supporting the earlier report that N-linked carbohydrates were present (Sun et al., 1994Down ). However, N-glycosidase F treatment did not seem to have an obvious impact on the molecular mass of EHV-4 gp2 (Fig. 2DUp), suggesting that N-linked carbohydrates were a minor component in EHV-4 gp2 and, therefore, unlikely to be a major contributing factor to the molecular mass differences observed for EHV-4 gp2. Attempts to radiolabel EHV-4 gp2 metabolically with [35S]methionine/cysteine for the identification of the completely deglycosylated gp2 were unsuccessful, probably because the C terminus, where almost all of the cysteines and methionines are located, was cleaved off, as is the case for EHV-1 gp2 (Wellington et al., 1996bDown ).

The region for O-linked glycosylation for EHV-1 gp2 was determined to be in N-terminal peptide where region A is located (Wellington et al., 1996aDown ). Examination of gp2 sequences of EHV-1 and EHV-4 revealed 5 and 12 seemingly conserved N-linked glycosylation motifs, respectively, that are all located outside the two regions of reiterated sequences. The gp2 sequence differences between plaque 1 and plaque 4 isolates of EHV-4.405/76 are confined to region A only (Fig. 1AUp) and the difference in the calculated molecular mass is about 4·5 kDa, without the addition of modifying components such as carbohydrate. The actual difference in molecular mass between plaque 1 and plaque 4 isolates is significantly more than 4·5 kDa (Fig. 2CUp), suggesting that the additional copies of the repeat elements in plaque 1 isolates are modified most likely by O-linked glycosylation. The observed differences in gp2 between other EHV-4.405/76 viruses can be explained similarly. The EHV-4.405/76 plaque 3 and plaque 5 isolates showed no obvious difference in the actual molecular mass of the protein (Fig. 2CUp), suggesting that the repeat in region B does not impact significantly on the actual molecular mass of gp2.

The threonine and serine residues in region A of both EHV-1 and EHV-4 are clustered together; thus, if these residues are used for O-linked glycosylation, it is unlikely that each one of these residues is utilized. To avoid steric hindrance, it is more likely that other intervening amino acids, such as alanine and aspartic acid, serve as separators between O-linked glycosylation sites.

ORF 71 has been shown to be non-essential for EHV-1 growth in cell culture but deletion of the gene was found to impact significantly on virus adsorption, penetration and virus egress and resulted in smaller plaques (Sun & Brown, 1994Down ; Sun et al., 1996Down ). Further studies are required to elucidate the importance of expansion and contraction of repeat sequences in region A and the modification of the repeats in immune evasion and pathogenicity of EHV-1 and EHV-4. It will also be interesting to compare the ORF 71 sequence of the cell culture-attenuated EHV-1 isolates (Flowers & O’Callaghan, 1992Down ; Kirisawa et al., 1994Down ) to investigate if the changes are confined to the two defined regions.


   Acknowledgments
 
Funding was provided from a Special Virology Fund and Racing Victoria. We thank Cynthia Brown for technical help.


   Footnotes
 
The GenBank accession numbers of the sequences reported in this paper are listed in Table 1. Only a single sequence was submitted to GenBank when the sequences of two or more viruses were identical.


   References
TOP
Abstract
Main text
References
 
Allen, G. P. & Bryans, J. T. (1986). Molecular epizootiology, pathogenesis, and prophylaxis of equine herpesvirus-1 infections. Progress in Veterinary Microbiology and Immunology 2, 78-144.[Medline]

Allen, G. P. & Yeargan, M. R. (1987). Use of lambda gt11 and monoclonal antibodies to map the genes for the six major glycoproteins of equine herpesvirus 1. Journal of Virology 61, 2454-2461.[Abstract/Free Full Text]

Allen, G. P., Yeargan, M. R. & Bryans, J. T. (1983). Alterations in the equine herpesvirus 1 genome after in vitro and in vivo virus passage. Infection and Immunity 40, 436-439.[Abstract/Free Full Text]

Crabb, B. S. & Studdert, M. J. (1990). Comparative studies of the proteins of equine herpesviruses 4 and 1 and asinine herpesvirus 3: antibody response of the natural hosts. Journal of General Virology 71, 2033-2041.[Abstract/Free Full Text]

Crabb, B. S. & Studdert, M. J. (1995). Equine herpesviruses 4 (equine rhinopneumonitis virus) and 1 (equine abortion virus). Advances in Virus Research 45, 153-190.[Medline]

Fitzmaurice, T., Walker, C., Kukreja, A., Sun, Y., Brown, S. M. & Field, H. J. (1997). The pathogenesis of ED71, a defined deletion mutant of equine herpesvirus-1, in a murine intranasal infection model for equine abortion. Journal of General Virology 78, 2167-2169.[Abstract]

Flowers, C. C. & O’Callaghan, D. J. (1992). The equine herpesvirus type 1 (EHV-1) homolog of herpes simplex virus type 1 US9 and the nature of a major deletion within the unique short segment of the EHV-1 KyA strain genome. Virology 190, 307-315.[Medline]

Hubert, P. H., Birkenmaier, S., Rziha, H. J. & Osterrieder, N. (1996). Alterations in the equine herpesvirus type-1 (EHV-1) strain RacH during attenuation. Zentralblatt fuer Veterinaermedizin Reihe B 43, 1-14.

Kirisawa, R., Ui, S., Takahashi, A., Kawakami, Y. & Iwai, H. (1994). Comparison of the genomes of attenuated equine herpesvirus-1 strains with their parent virulent strain. Virology 200, 651-660.[Medline]

Marshall, K. R., Sun, Y., Brown, S. M. & Field, H. J. (1997). An equine herpesvirus-1 gene 71 deletant is attenuated and elicits a protective immune response in mice. Virology 231, 20-27.[Medline]

Studdert, M. J. & Blackney, M. H. (1979). Equine herpesviruses: on the differentiation of respiratory from foetal strains of type 1. Australian Veterinary Journal 55, 488-492.[Medline]

Studdert, M. J., Fitzpatrick, D. R., Horner, G. W., Westbury, H. A. & Gleeson, L. J. (1984). Molecular epidemiology and pathogenesis of some equine herpesvirus type 1 (equine abortion virus) and type 4 (equine rhinopneumonitis virus) isolates. Australian Veterinary Journal 61, 345-348.[Medline]

Studdert, M. J., Crabb, B. S. & Ficorilli, N. (1992). The molecular epidemiology of equine herpesvirus 1 (equine abortion virus) in Australasia 1975 to 1989. Australian Veterinary Journal 69, 104-111.[Medline]

Sun, Y. & Brown, S. M. (1994). The open reading frames 1, 2, 71, and 75 are nonessential for the replication of equine herpesvirus type 1 in vitro. Virology 199, 448-452.[Medline]

Sun, Y., MacLean, A. R., Dargan, D. & Brown, S. M. (1994). Identification and characterization of the protein product of gene 71 in equine herpesvirus 1. Journal of General Virology 75, 3117-3126.[Abstract/Free Full Text]

Sun, Y., MacLean, A. R., Aitken, J. D. & Brown, S. M. (1996). The role of the gene 71 product in the life cycle of equine herpesvirus 1. Journal of General Virology 77, 493-500.[Abstract/Free Full Text]

Telford, E. A. R., Watson, M. S., McBride, K. & Davison, A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189, 304-316.[Medline]

Telford, E. A. R., Watson, M. S., Perry, J., Cullinane, A. A. & Davison, A. J. (1998). The DNA sequence of equine herpesvirus-4. Journal of General Virology 79, 1197-1203.[Abstract]

Wellington, J. E., Allen, G. P., Gooley, A. A., Love, D. N., Packer, N. H., Yan, J. X. & Whalley, J. M. (1996a). The highly O-glycosylated glycoprotein gp2 of equine herpesvirus 1 is encoded by gene 71. Journal of Virology 70, 8195-8198.[Abstract]

Wellington, J. E., Gooley, A. A., Love, D. N. & Whalley, J. M. (1996b). N-terminal sequence analysis of equine herpesvirus 1 glycoproteins D and B and evidence for internal cleavage of the gene 71 product. Journal of General Virology 77, 75-82.[Abstract/Free Full Text]

Whittaker, G. R., Wheldon, L. A., Giles, L. E., Stocks, J.-M., Halliburton, I. W., Killington, R. A. & Meredith, D. M. (1990). Characterization of the high Mr glycoprotein (gP300) of equine herpesvirus type 1 as a novel glycoprotein with extensive O-linked carbohydrate. Journal of General Virology 71, 2407-2416.[Abstract/Free Full Text]

Whittaker, G. R., Bonass, W. A., Elton, D. M., Halliburton, I. W., Killington, R. A. & Meredith, D. M. (1992). Glycoprotein 300 is encoded by gene 28 of equine herpesvirus type 1: a new family of herpesvirus membrane proteins? Journal of General Virology 73, 2933-2940.[Abstract/Free Full Text]

Zheng, M., Love, D. N. & Sabine, M. (1995). High molecular weight polypeptide bands specific for equine herpesvirus 4. Veterinary Microbiology 46, 203-211.[Medline]

Received 12 July 2001; accepted 23 November 2001.


This article has been cited by other articles:


Home page
J. Virol.Home page
O. Simon, T. Williams, A. C. Asensio, S. Ros, A. Gaya, P. Caballero, and R. D. Possee
Sf29 Gene of Spodoptera frugiperda Multiple Nucleopolyhedrovirus Is a Viral Factor That Determines the Number of Virions in Occlusion Bodies
J. Virol., August 15, 2008; 82(16): 7897 - 7904.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. Nugent, I. Birch-Machin, K. C. Smith, J. A. Mumford, Z. Swann, J. R. Newton, R. J. Bowden, G. P. Allen, and N. Davis-Poynter
Analysis of Equid Herpesvirus 1 Strain Variation Reveals a Point Mutation of the DNA Polymerase Strongly Associated with Neuropathogenic versus Nonneuropathogenic Disease Outbreaks.
J. Virol., April 1, 2006; 80(8): 4047 - 4060.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. M. Smith, S. M. Kahan, C. B. Rorex, J. von Einem, N. Osterrieder, and D. J. O'Callaghan
Expression of the Full-Length Form of gp2 of Equine Herpesvirus 1 (EHV-1) Completely Restores Respiratory Virulence to the Attenuated EHV-1 Strain KyA in CBA Mice
J. Virol., April 15, 2005; 79(8): 5105 - 5115.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, J.-a.
Right arrow Articles by Studdert, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, J.-a.
Right arrow Articles by Studdert, M. J.
Agricola
Right arrow Articles by Huang, J.-a.
Right arrow Articles by Studdert, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS