|
|
||||||||
Animal: RNA Viruses |
Department of Molecular and Cell Biology, Centro Nacional de Biotecnología, CSIC, Campus Universidad Autónoma, Cantoblanco, 28049 Madrid, Spain1
Federal Research Centre for Virus Diseases of Animals, Friedrich-Loeffler-Institutes, Insel Riems, Germany2
Fort Dodge Veterinaria, Girona, Spain3
Institute for Animal Science and Health, Lelystad, The Netherlands4
Author for correspondence: Luis Enjuanes. Fax +34 91 585 4915. e-mail L.Enjuanes{at}cnb.uam.es
| Abstract |
|---|
|
|
|---|
-glucuronidase (GUS) (28 µg per 106 cells) and the porcine respiratory and reproductive syndrome virus (PRRSV) ORF5 (12 µg per 106 cells) has been shown using a TGEV-derived minigenome. GUS expression levels increased about eightfold with the m.o.i. and were maintained for more than eight passages in cell culture. Nevertheless, instability of the GUS and ORF5 subgenomic mRNAs was observed from passages five and four, respectively. About a quarter of the cells in culture expressing the helper virus also produced the reporter gene as determined by studying GUS mRNA production by in situ hybridization or immunodetection to visualize the protein synthesized. Expression of GUS was detected in the lungs, but not in the gut, of swine immunized with the virus vector. Around a quarter of lung cells showing replication of the helper virus were also positive for the reporter gene. Interestingly, strong humoral immune responses to both GUS and PRRSV ORF5 were induced in swine with this virus vector. The large cloning capacity and the tissue specificity of the TGEV-derived minigenomes suggest that these virus vectors are very promising for vaccine development. | Introduction |
|---|
|
|
|---|
Coronaviruses have several advantages as vectors over other virus expression systems. They are single-stranded (ss) RNA viruses that essentially replicate within the cytoplasm without a DNA intermediary, making integration of the virus genome into a host cell chromosome unlikely (Lai & Cavanagh, 1997
). Coronaviruses have the largest RNA virus genome and, in principle, have room for the insertion of large foreign genes (Enjuanes et al., 2000a
; Masters, 1999
). Since they usually infect the mucosal surfaces, both respiratory and enteric, they may be used to target the antigen to the enteric and respiratory areas to induce a strong secretory immune response (Ballesteros et al., 1997
; Enjuanes & Van der Zeijst, 1995
; Kuo et al., 2000
; Leparc-Goffart et al., 1998
; Sánchez et al., 1999
).
Two types of expression systems have been developed based on coronavirus genomes (Enjuanes et al., 2001
; Liao et al., 1995
; Zhang et al., 1997
). One type, the helper-dependent expression system, requires two components, and the other requires a single genome that is modified either by targeted recombination (Masters, 1999
) or by engineering a cDNA encoding an infectious RNA (Almazán et al., 2000
; Thiel et al., 2001
; Yount et al., 2000
). The first attempt to use a coronavirus for heterologous gene expression was based on mouse hepatitis virus (MHV) by using a helper-dependent expression system (Liao et al., 1995
; Zhang et al., 1997
). Expression with MHV has been based on the use of either internal ribosome entry sites or transcription regulatory sequences (TRSs) present within the viral genes (Liao et al., 1995
; Lin & Lai, 1993
; Zhang et al., 1997
). More recently, helper-dependent expression systems based on infectious bronchitis virus (IBV) (Stirrups et al., 2000
), human coronavirus HCoV-229E (Thiel et al., 1998
) and bovine coronavirus (Krishnan et al., 1996
) have also been developed.
Helper-dependent expression systems have been designed based on TGEV-derived minigenomes (Alonso et al., 2002
; Izeta et al., 1999
). The expression of the reporter gene
-glucuronidase (GUS) under the control of optimized TRSs has been shown (Alonso et al., 2002
). An improvement introduced in these systems was a two step amplification system based on expression of the viral minigenome under the control of the cytomegalovirus (CMV) early promoter within the nucleus, coupled to a second amplification step of minigenome RNAs translocated to the cytoplasm by the viral polymerase (Izeta et al., 1999
), as previously described for other positive-stranded RNA genomes (Dubensky et al., 1996
).
In this report, the expression of GUS and the ORF5 involved in the protection against the porcine reproductive and respiratory syndrome virus (PRRSV), a virus with a high impact on animal health (Pirzadeh & Dea, 1998
; Plana-Durán et al., 1997a
, b
), has been studied both in tissue culture and in swine. The protein expression levels, the stability of the vector, the tissue distribution and the humoral immune response elicited against the heterologous gene have been analysed. It has been shown that the TGEV-derived virus vector achieved high foreign gene expression levels, which led to the induction of significant immune responses in swine. The stability of TGEV-derived minigenomes was highly dependent on the heterologous gene and was significantly increased over previous systems.
| Methods |
|---|
|
|
|---|
Cells and viruses.
Construction of cDNAs encoding RNA minigenomes.
The construction of DI-C-derived cDNA encoding RNA minigenome M39 was previously described (Izeta et al., 1999
). To increase minigenome RNA expression levels, the cDNAs were preceded by the CMV promoter (Dubensky et al., 1996
; Penzes et al., 1998
). The minigenome was flanked at the 3' end by the hepatitis delta virus ribozyme and the bovine growth hormone polyadenylation and termination sequences (Penzes et al., 1998
).
To evaluate expression levels using the minigenomes, E. coli K12 GUS was used as a reporter gene (Jefferson et al., 1986
; Schlaman et al., 1994
). The GUS gene was amplified by PCR from plasmid pGUS1 (Plant Genetic Systems) using a forward 40-mer oligonucleotide (5' GCGGCCGCAGGCCTGTCGACGACCATGGTCCGTCCTGTAG 3') which included NotI, StuI and SalI restriction endonuclease sites (bold nucleotides). The GUS initiation codon is underlined. Nucleotides shown in italics were included to fit the consensus motif of the ribosome scanning model (Kozak, 1991a
, b
). The reverse primer was 41 nt long (5' GGTACCGCGCGCCTGGGCTAGCGCGATCATAGGCGTCTCGC 3') and included KpnI, BssHII and NheI restriction sites (bold nucleotides). PRRSV Olot91 strain ORF5 (nt 17632365 of sequence deposited in EMBL, accession no. X92942) was amplified by PCR from plasmid pMTL25-PRRSV-ORF5 using a forward 33-mer oligonucleotide (5' GGTCGACGACCATGAGATGTTCTCACAAATTGG 3') and a 29-mer reverse primer (5' GGCTAGCCTAGGCTTCCCATTGCTCAGCC 3') that included the restriction endonuclease sites SalI and NheI (bold nucleotides), respectively. The consensus motif of the ribosome scanning model is shown in italics and the translation initiation codon is underlined.
The expression cassettes encoding the GUS gene and the PRRSV ORF5 were cloned at position 3337 from the 5' end of minigenome M39 as described by Alonso et al. (2002)
, generating minigenomes M39-GUS and M39-ORF5, respectively. To ensure that the expected plasmids were generated, the constructs were sequenced at the cloning junctions using an Applied Biosystems 373 DNA sequencer.
Rescue of minigenomes encoding the expression cassettes.
ST cells grown to 50% confluence in 35 mm dishes were transfected with 10 µg of plasmid DNA encoding CMV-driven minigenomes and 15 µl of Lipofectin reagent in Optimem medium (Gibco-BRL), according to the manufacturers instructions. The transfected cells were infected with TGEV PUR46-MAD (m.o.i. 5) at 4 h post-transfection. Supernatants obtained from these cultures at 2224 h post-infection (p.i.) were used to infect fresh ST cell monolayers. The indicated number of passages were performed to amplify the helper virus and minigenome-derived RNAs.
RNA analysis by Northern blotting.
Total intracellular RNA was extracted at 16 h p.i. from DNA-transfected and helper virus-infected ST cells at different passages using the Ultraspec RNA isolation system (Biotecx), following the manufacturers instructions. RNAs were separated in denaturing 1% agarose, 2·2 M formaldehyde gels. Following electrophoresis, RNAs were irradiated for 0·2 min using a UVP cross-linker (CL-1000) and blotted onto nylon membranes (Duralon-UV, Stratagene) using a Vacugene pump (Pharmacia). The nylon membranes were irradiated with two pulses of 70 mJ/cm2 and hybridized with [
-32P]dATP-labelled ssDNA probes following standard procedures (Sambrook et al., 1989
). The 3' UTR-specific ssDNA probe was complementary to nt 2830028544 of the TGEV PUR46-MAD strain genome (Penzes et al., 2001
). The GUS- and ORF5-specific probes were complementary to the first 296 and 276 nt of these genes, respectively. The membrane was exposed to an X-OMAT Kodak Scientific Imaging film for 8 h at -70 °C.
Western blot and immunoprecipitation analysis.
GUS expression in cells transfected with cDNA encoding a minigenome and infected with helper virus was analysed at passage four by Western blot as described previously (Alonso et al., 2002
). Purified GUS protein (Sigma) was used as a positive control. A GUS-specific polyclonal rabbit antibody (5 Prime-3 Prime) diluted 1:200 in TBS buffer (TrisHCl 20 mM pH 7·5, NaCl 500 mM) was used as the primary antibody to detect GUS protein. Rabbit-specific goat-antibody conjugated to peroxidase, diluted 1:8000 in TTBS buffer (TBS with Tween-20, 0·1%), was used as secondary antibody.
Immunoprecipitation of PRRSV ORF5 was performed as described (Torres et al., 1995
). Briefly, ST cell monolayers grown in 35 mm dishes were infected with a mixture containing the helper virus (TGEV PUR46-MAD) and the minigenome encoding PRRSV ORF5 (M39-ORF5). MA-104 cell monolayers grown in 35 mm dishes infected with PRRSV were used as a positive control. After 1 h of virus adsorption at 37 °C, fresh medium was added and cells were incubated for 4 h at 37 °C. Cells were washed with starvation medium methionine- and cysteine-free, overlaid with this medium containing 2% foetal calf serum, and incubated for 1 h at 37 °C. The medium was then replaced by in vitro labelling mix containing 60 µCi of L-[35S]methionine/cysteine (Amersham Pharmacia Biotech) and incubated for 13 h at 37 °C. The cells were detached from the dish with a rubber policeman, washed with PBS by centrifugation at 3000 r.p.m. for 15 min at 4 °C and lysed in RIPA buffer (Torres et al., 1995
). Antisera used for preclearing and for immunoprecipitation were bound to protein ASepharose beads by overnight incubation at 4 °C. Cell extracts were precleaned by incubation with a preimmune rabbit antiserum bound to protein ASepharose beads for 3 h at 4 °C. Supernatants were next immunoprecipitated by overnight incubation at 4 °C with a rabbit antiserum specific for PRRSV Olot91 strain ORF5, obtained by immunization with an ORF5-derived synthetic 18 amino acid peptide (NH2-142-TNFIVDDRGRIHRWKSPI-159-COOH), bound to protein ASepharose beads. After four washes in RIPA buffer containing 0·2% SDS, the pelleted beads were resuspended in SDS sample buffer containing 2·5%
-mercaptoethanol, boiled for 3 min and centrifuged at low speed to sediment the beads. The immunoprecipitated proteins were resolved in an SDS/520% polyacrylamide gel. The gel was fixed (10% acetic acid, 35% ethanol) before incubation with 14% (w/w) sodium salicylate (Merck) for 30 min at room temperature and finally dried at 80 °C for 1 h and exposed to an X-OMAT Kodak Scientific Imaging film.
ELISA.
Antibodies generated against GUS and PRRSV ORF5 were detected by ELISA as described (Ausubel, 1987
). ELISA was performed using as antigen purified TGEV (0·2 µg per well), partially purified PRRSV (1:100 dilution of partially purified PRRSV with 3·2x104 TCID50/ml), purified GUS protein (Sigma, 0·5 µg per well) or the KLH-conjugated ORF5 peptide (0·5 µg per well). ORF5 peptide was conjugated to KLH using the Imject Immunogen EDC conjugation kit with mcKLH (Pierce) following the manufacturers instructions. To perform the ELISA, antigens were bound to 96-well microplates as previously described (Correa et al., 1988
), saturated with 5% BSA in PBS for 2 h at 37 °C and incubated with the serum sample diluted 1:4 in PBS0·1% BSA for 3 h at room temperature. Microplates were washed six times with 0·1% BSA and 0·1% Tween-20 in PBS and sequentially incubated with peroxidase-conjugated protein A diluted 1:2000 in PBS with 0·1% BSA. Microplates were washed six times before incubation with the peroxidase substrate phenylenediamine dihydrochloride (Sigma FAST) for 15 min at room temperature. Reactions were stopped with 1·5 M H2SO4, and the absorbance was read at 492 nm.
GUS chemiluminescent detection in cell extracts.
GUS expression in cell extracts was detected by a chemiluminescent assay (GUS-Light kit, Tropix), according to the manufacturers instructions (Bronstein et al., 1994
). Cells transfected with GUS-encoding minigenome, or mock-transfected, were infected with helper virus (m.o.i. 5). The amount of protein expressed 2224 h p.i. was estimated using standard calibration curves generated with purified GUS (Sigma) and the bicinchoninic acid protein assay (BCA, Pierce), resulting in 106 relative luminometric units per 0·35 ng of GUS.
Analysis of TGEV-infected newborn swine.
Conventionally raised, 2-day-old, colostrum-deprived piglets, serologically negative for TGEV were inoculated with a mixture containing 108 p.f.u. of helper virus (TGEV PUR46-MAD) and the minigenome M39-GUS by both oronasal and enteric tract (using a gastric tube) routes. Three replicate experiments were performed and clinical signs were recorded during the experiments. Five piglets were sacrificed on each of the 3 days following inoculation, subjected to necropsy, and lungs, jejunum and ileum were collected. Two mock-infected piglets were also sacrificed each day.
For histopathological examination, lung tissue samples (four different locations) and samples from small and large intestine (five different locations) were either snap-frozen and stored at -70 °C until further use to prepare cryostat sections or immediately fixed in 4% neutral-buffered formalin and processed for paraffin-embedding, sectioning and haematoxylin and eosin staining.
For virus isolation, frozen tissue was thawed and homogenized on ice in PBS (1 ml/g tissue) with an Ultra-Turrax. After 12 min centrifugation at 3000 r.p.m., the supernatant was diluted 1:5 in PBS with antibiotics and left at 4 °C for 1 h. After spinning for 15 min at 12000 r.p.m., the supernatant was diluted serially in Dulbeccos modified Eagle medium with 2% foetal calf serum, including antibiotics and 40 µg/ml of DEAE-dextran. Virus was titrated on ST cell monolayers.
For immunofluorescence staining, cryostat sections of intestine and lungs were fixed with acetone (-20 °C) for 10 min and incubated for 1 h at 37 °C with FITC-labelled anti-TGEV hyperimmune serum, diluted 1:10 in 0·2 M TrisHCl, pH 8·6 and mixed at a ratio of 3:1 with 0·005% Evans blue solution. Sections were sealed in glycerol buffer containing 25 mg/ml of 1,4-diazabicyclo(2,2,2)octane (DABCO).
For GUS histochemistry, cryostat sections of intestine and lungs were fixed for 45 min using the fixation buffer provided with the
-glucuronidase reporter gene kit (Sigma), according to the manufacturers recommendations. Sections were washed repeatedly with 10 mM sodium phosphate pH 7·0 and 0·2 mM EDTA and incubated overnight at 37 °C in the staining solution containing both potassium ferri- and ferrocyanide.
In situ hybridization (ISH).
For preparation of non-radioactive riboprobes, in vitro transcription using the digoxigenin RNA labelling technique was performed as described (Zurbriggen et al., 1998
) with probes complementary to the 3' end of TGEV PUR46-MAD and to the GUS gene (see above). PCR-amplified DNA was cloned into the pGEM-T-Easy plasmid vector (Promega). In vitro transcription was performed with the RiboMAX system to yield digoxigenin-11-dUTP (Roche Molecular Biochemicals) riboprobes using sense (from SP6 promoter) and antisense (from T7 promoter) riboprimers. After shortening the probes to a length of about 150 bases they were stored in diethyl-pyrocarbonate-treated water at -70 °C until further use. For ISH, tissue culture chamber slides and cryostat sections were fixed with 4% paraformaldehyde in PBS. For permeabilization and proteolytic digestion, proteinase K was applied to cells (0·10·5 µg/ml) and tissues (15 µg/ml). Hybridization was performed overnight at 50 °C using 12 ng/µl of the probes. To digest any unbound probe, the sections were treated with RNase T1 and DNase-free RNase (Roche). For immunological probe detection, the sections were incubated for 2 h with an alkaline phosphatase-conjugated anti-digoxigenin antibody diluted 1:500 (Roche). Nitro blue tetrazolium and 5-bromo-4-chloro-4-indolylphosphate were used as substrates for colour reaction. Overnight development of the dark blue signal was stopped in TE buffer (pH 8·0).
Morphometric analysis of ISH signals on ST cells and lung.
Morphometric analysis and quantification of TGEV-RNA- and GUS-RNA-positive cells in tissue culture and lung tissues were performed using the KS300 image analysis system (Zeiss). Calibration and threshold determination for the staining were done once for each section using the objective 20x. For each probe, three hybridization assays were performed in tissue culture and for each animal four locations of lung tissue were investigated and 20 randomly selected neighbouring, non-overlapping fields were measured. The evaluated parameter was TGEV-RNA- or GUS-RNA-positive area (µm2), expressed as a percentage of the total area of cells or tissue examined.
Immunizations.
Groups of 1-week-old swine (derived from crossing Belgium Landrace and Large White swine) were immunized by the oronasal and intragastric routes. Piglets were obtained from sows seronegative for TGEV and PRRSV, as determined by radioimmunoassay (Sánchez et al., 1999
) and inmunoperoxidase monolayer assay (Harlow & Lane, 1988
). One-week-old animals were immunized three times at days 7, 14 and 21 after birth, by administering each time three doses: orally (5·0x108 p.f.u. per pig), intranasally (5·0x108 p.f.u. per pig) and intragastrically (1·5x109 p.f.u. per pig) of the helper virus (TGEV PUR46-MAD) and the minigenome M39-GUS or M39-ORF5. Piglets inoculated with the same minigenome were taken together and housed in isolation chambers located in a P3-level containment facility at 1820 °C. Serum was collected 7 days after the last immunization.
| Results |
|---|
|
|
|---|
|
|
|
|
M39-ORF5) was more abundant than the full-length minigenome. Interestingly, bands with the size expected for the subgenomic mRNA encoding ORF5 (sgmRNA) and for the deleted minigenome (
sgmRNA) were also detected. The identity of these bands was assessed by RNA extraction, amplification by RTPCR and sequence analysis (data not shown). The relative abundance of the sgmRNAs was about 50-fold lower than that of the corresponding minigenomes.
|
-D-glucuronid), which resulted in a Prussian blue staining of cells with GUS enzymatic activity. At 18 h p.i. TGEV antigen was demonstrated in large amounts in the cytoplasm of about 40% of ST cells (Fig. 6C
|
|
|
Pathology and histopathology in swine administered with the helper virus and the minigenomes expressing GUS
The replication of TGEV in swine is highest in colostrum-deprived newborn piglets. This is particularly the case with attenuated viruses like the TGEV PUR46-MAD strain used in these studies. In contrast, 2-day-old conventional (non-colostrum deprived) piglets breast-fed by sows seronegative for TGEV, or for porcine respiratory coronavirus, inoculated with the attenuated strain PUR46-MAD show very mild or no obvious diarrhoea and are completely recovered by day 8 p.i. (Sánchez et al., 1999
).
To potentiate minigenome replication by the helper virus, colostrum-deprived newborn piglets were infected 2 days after birth. At necropsy 2 days after infection, piglets had the lungs slightly to moderately collapsed and showed consolidation and signs of bronchopneumonia especially in the cranioventral lobes. By histopathology, the lungs showed multifocal neonatal atelectasia, massive accumulation of granulocytes in the alveoli, thickened alveolar septa with slight hyperplasia of type II pneumocytes, and focal necrosis of the alveolar epithelium. Only a slight hyperaemia of small intestine vessels was occasionally seen. In the jejunum there was a slight to marked diffuse atrophy of villi together with fusion of shortened villi. Exfoliation and necrosis of surface epithelial cells, flattening of enterocytes and capillary thrombi at the tips of villi were also observed. Submucosal areas were infiltrated with granulocytes, lymphocytes and plasma cells (data not shown).
Immune response to GUS and PRRSV ORF5 elicited by the helper-dependent expression system in swine
Groups of 1-week-old conventional swine were immunized at days 7, 14 and 21 after birth with the helper virus plus the minigenome expressing GUS or ORF5 by the intranasal, oral and intragastric routes. Animals were bled 7 days after the last immunization and the sera were evaluated by ELISA for the presence of antibodies to GUS or to a partially purified PRRSV, depending on the antigen used.
Immunization with the TGEV-derived vector expressing either GUS or PRRSV ORF5 elicited a significant immune response both to the helper virus and to GUS (Fig. 9A
1 and 2) or to the helper virus and ORF5 (Fig. 9B
1, 2 and 3). The antibody levels to the helper virus (TGEV) were higher than to the heterologous gene in both cases. The response to GUS and the PRRSV ORF5 was also studied by immunizing 4-week-old newborn swine and was weaker than in 1-week-old animals (results not shown).
|
| Discussion |
|---|
|
|
|---|
The helper-dependent expression system showed a limited stability of the minigenome RNA during passage in cell culture. Insertion of the PRRSV ORF5 and GUS genes in the M39 minigenome led to the appearance of new minigenomes that could easily be detected at passages four and five, respectively. In contrast, the sgmRNAs were detected in low amounts with the probes used in these experiments. Increase of the probe size from 300 nt to around 103 nt clearly revealed the presence of the sgmRNAs (Alonso et al., 2002
). In both cases, protein expression levels were maintained for at least eight passages. The stability of the TGEV-derived minigenomes was higher than that of the MHV-based helper dependent expression system in which the expression of the foreign gene is lost within the first three passages, probably because of the lack of a packaging signal within the MHV minigenomes (Lai & Cavanagh, 1997
; Liao et al., 1995
; Lin & Lai, 1993
; Zhang et al., 1997
).
The stability of the expression systems is also conditioned by the type of polymerases involved in minigenome amplification and mRNA transcription (Agapov et al., 1998
). The expression system described in this report, based on TGEV-derived minigenomes expressed under the control of the CMV promoter, uses the eukaryotic RNA polymerase II to express the minigenome, a process that takes place with an estimated error frequency of 5x10-6 (de Mercoyrol et al., 1992
), which is lower than the mutant accumulation frequency of 10-4 to 10-5 during the in vitro expression of minigenome RNAs with T7 DNA-dependent RNA-polymerase (Boyer et al., 1992
; Sooknanan et al., 1994
). In addition, the eukaryotic RNA polymerase II has additional mechanisms to ensure even more accurate transcription (Thomas et al., 1998
). After transfection of the in vitro-produced RNA, synthesis of mRNA by the viral RNA-dependent RNA-polymerase should have an accumulation of mutations with a relatively higher frequency of 10-3 to 10-4 (de Mercoyrol et al., 1992
; Ward et al., 1988
). Overall, an improvement in expression stability should be observed by using expression systems initiated by DNA transfection, such as those described in this report.
Using minigenomes derived from TGEV, expression was highly dependent on the nature of the heterologous gene used. Luciferase expression with TGEV minigenomes was reduced to background levels and was lost after the fourth passage (data not shown). In contrast, the expression of GUS was higher (up to 8 µg per 106 cells) and was observed for at least eight passages in this and in a previous work (Alonso et al., 2002
). Similar results were observed using IBV minigenomes (Stirrups et al., 2000
).
The theoretical size of the insert accepted by the TGEV-derived minigenomes is about 24 kb, since the size of the full-length TGEV genome is 28·5 kb and the M39 has around 4 kb. This cloning capacity would be the highest among virus vectors with an RNA genome.
By studying the expression of GUS reporter gene in ST cells infected with an m.o.i. of 5, it was observed that when 47% of the cells expressed virus vector RNA or protein, more than one-quarter of them expressed the GUS RNA or protein. The presence of cells negative for TGEV RNA was unexpected, since the m.o.i. was 5. It is, in principle, possible that TGEV replication is dependent on the cell cycle, since cells were not synchronized.
Using TGEV-derived minigenomes, GUS was expressed in lungs but not in the enteric tract, probably because the titres of the helper virus in lungs were 40- to 103-fold higher than in the gut, and in the gut the minigenome and the helper virus were not present within the same cell. The helper virus and GUS RNAs were detected in more than 4·3% and 1·5% of the cells, respectively. Interestingly, this reduced number of cells expressing GUS (or even a lower one, since the immunized piglets were conventional animals, i.e. non-colostrum-deprived and, consequently, less susceptible to the virus than the colostrum-deprived ones in which we determined the number of infected cells) was sufficient to elicit an immune response to GUS. This immune response was stronger against the helper virus (TGEV) than against the heterologous antigens, particularly GUS, probably because the virus is a polymeric antigen that is a better immunogen than the GUS. A similar situation probably results after expression of the PRRSV ORF5. The relatively strong immune response to the ORF5 is very promising, since this antigen is one of the major inducers of protection against PRRSV (Pirzadeh & Dea, 1998
; Plana-Durán et al., 1997a
, b
). Interestingly, the PRRSV ORF5 18-mer peptide selected was highly immunogenic as described for the homologous peptide from the Lelystad strain of PRRSV (Meulenberg et al., 1995
).
In order to study the replication of the helper virus with the minigenome, colostrum-deprived newborn animals were used to potentiate the infection by the attenuated helper virus. This resulted in an increased pathogenicity both in the lungs and in the enteric tract. These side effects should be reduced to a minimum in conventional (non-colostrum-deprived) piglets since, even when they are infected at 2 days after birth, very mild or no diarrhoea was induced after infection with the PUR46-MAD strain of TGEV (Sánchez et al., 1999
). These side effects are even less when older animals are infected with attenuated TGEV, such as the piglets used for the immunization that were 1-week-old. In this case, we have shown an efficient immune response to both GUS and PRRSV ORF5 in the absence of clinical symptoms. The potential side effects caused by the helper virus could be further prevented by using the PTV strain of the same Purdue cluster of TGEV (Sánchez et al., 1992
), since this strain is respiratory and fully attenuated (Sánchez et al., 1999
) and has been shown to efficiently rescue TGEV-derived minigenomes (J. M. Sánchez-Morgado, I. Sola, J. Castilla & L. Enjuanes, unpublished results).
Overall, these results showed that foreign genes were efficiently expressed in tissue culture by using TGEV-derived minigenomes. Furthermore, the expression was specifically targeted to tissues such as lung in swine, leading to the induction of an immune response against an antigen such as the PRRSV ORF5 involved in the protection against relevant virus infections of livestock.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Almazán, F., González, J. M., Pénzes, Z., Izeta, A., Calvo, E., Plana-Durán, J. & Enjuanes, L. (2000). Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proceeding of the National Academy of Sciences, USA 97, 5516-5521.
Alonso, S., Izeta, A., Sola, I. & Enjuanes, L. (2002). Transcription regulatory sequences and mRNA expression levels in transmissible gastroenteritis coronavirus. Journal of Virology, 76, 12931308.
Ausubel, F. M. (1987). Current Protocols in Molecular Biology. New York: John Wiley & Sons.
Ballesteros, M. L., Sánchez, C. M. & Enjuanes, L. (1997). Two amino acid changes at the N-terminus of transmissible gastroenteritis coronavirus spike protein result in the loss of enteric tropism. Virology 227, 378-388.[Medline]
Boyer, J. C., Bebenek, K. & Kunkel, T. A. (1992). Unequal human immunodeficiency virus type 1 reverse transcriptase error rates with RNA and DNA templates. Proceeding of the National Academy of Sciences, USA 89, 6919-6923.
Bronstein, I., Fortin, J. J., Voyta, J. C., Juo, R.-R., Edwards, B., Olenses, C. E. M., Lijam, N. & Kricka, L. J. (1994). Chemiluminescent reporter gene assays: sensitive detection of the GUS and SEAP gene products. BioTechniques 17, 172-177.[Medline]
Caul, E. O. & Egglestone, S. I. (1982). Coronavirus in humans. In Virus Infections of the Gastrointestinal Tract , pp. 179-193. Edited by D. A. J. Tyrrell & A. Z. Kapikian. New York:Marcel Dekker.
Correa, I., Jiménez, G., Suñé, C., Bullido, M. J. & Enjuanes, E. (1988). Antigenic structure of the E2 glycoprotein from transmissible gastroenteritis coronavirus. Virus Research 10, 77-94.[Medline]
de Mercoyrol, L., Corda, Y., Job, C. & Job, D. (1992). Accuracy of wheat-germ RNA polymerase II. General enzymatic properties and effect of template conformational transition from right-handed B-DNA to left-handed Z-DNA. European Journal of Biochemistry 206, 49-58.[Medline]
Denison, M. R. (1999). The common cold. Rhinoviruses and coronaviruses. In Viral Infections of the Respiratory Tract , pp. 253-280. Edited by R. Dolin & P. F. Wright. New York:Marcel Dekker.
Dubensky, T. W., Driver, D. A., Polo, J. M., Belli, B. A., Latham, E. M., Ibanez, C. E., Chada, S., Brumm, D., Banks, T. A., Mento, S. J., Jolly, D. J. & Chang, S. M. W. (1996). Sindbis virus DNA-based expression vectors: utility for in vitro and in vivo gene transfer. Journal of Virology 70, 508-519.[Abstract]
Enjuanes, L. & Van der Zeijst, B. A. M. (1995). Molecular basis of transmissible gastroenteritis coronavirus epidemiology. In In The Coronaviridae , pp. 337-376. Edited by S. G. Siddell. New York:Plenum Press.
Enjuanes, L., Brian, D., Cavanagh, D., Holmes, K., Lai, M. M. C., Laude, H., Masters, P., Rottier, P., Siddell, S. G., Spaan, W. J. M., Taguchi, F. & Talbot, P. (2000a). Coronaviridae. In Virus Taxonomy. Classification and Nomenclature of Viruses , pp. 835-849. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carsten, M. K. Estes, S. M. Lemon, D. J. McGeoch, J. Maniloff, M. A. Mayo, C. R. Pringle & R. B. Wickner. New York:Academic Press.
Enjuanes, L., Spaan, W., Snijder, E. & Cavanagh, D. (2000b). Nidovirales. In In Virus taxonomy. Classification and Nomenclature of Viruses , pp. 827-834. Edited by M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carsten, M. K. Estes, S. M. Lemon, D. J. McGeoch, J. Maniloff, M. A. Mayo, C. R. Pringle & R. B. Wickner. New York:Academic Press.
Enjuanes, L., Sola, I., Almazán, F., Ortego, J., Izeta, A., González, J. M., Alonso, S., Sánchez-Morgado, J. M., Escors, D., Calvo, E., Riquelme, C. & Sánchez, C. M. (2001). Coronavirus derived expression systems. Journal of Biotechnology 88, 183-204.[Medline]
Harlow, E. & Lane, D. (1988). Antibodies: A Laboratory Manual, pp. 726. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Izeta, A., Smerdou, C., Alonso, S., Penzes, Z., Méndez, A., Plana-Durán, J. & Enjuanes, L. (1999). Replication and packaging of transmissible gastroenteritis coronavirus-derived synthetic minigenomes. Journal of Virology 73, 1535-1545.
Jefferson, R. A., Burgess, S. M. & Hirsh, D. (1986).
-Glucuronidase from Escherichia coli as a gene-fusion marker. Proceeding of the National Academy of Sciences, USA 83, 8447-8451.
Jiménez, G., Correa, I., Melgosa, M. P., Bullido, M. J. & Enjuanes, L. (1986). Critical epitopes in transmissible gastroenteritis virus neutralization. Journal of Virology 60, 131-139.
Kozak, M. (1991a). An analysis of vertebrate mRNA sequences: intimations of translational control. Journal of Cell Biology 115, 887-903.
Kozak, M. (1991b). Structural features in eukaryotic mRNAs that modulate the initiation of translation. Journal of Biological Chemistry 266, 19867-19870.
Krishnan, R., Chang, R. Y. & Brian, D. A. (1996). Tandem placement of a coronavirus promoter results in enhanced mRNA synthesis from the downstream-most initiation site. Virology 218, 400-405.[Medline]
Kuo, L., Godeke, G.-J., Raamsman, M. J. B., Masters, P. S. & Rottier, P. J. M. (2000). Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: crossing the host cell species barrier. Journal of Virology 74, 1393-1406.
Lai, M. M. C. & Cavanagh, D. (1997). The molecular biology of coronaviruses. Advances in Virus Research 48, 1-100.
Leparc-Goffart, I., Hingley, S. T., Chua, M. M., Phillips, J., Lavi, E. & Weiss, S. R. (1998). Targeted recombination within the spike gene of murine coronavirus mouse hepatitis virus A59: Q159 is a determinant of hepatotropism. Journal of Virology 72, 9628-9636.
Liao, C. L., Zhang, X. & Lai, M. M. C. (1995). Coronavirus defective-interfering RNA as an expression vector: the generation of a pseudorecombinant mouse hepatitis virus expressing hemagglutininesterase. Virology 208, 319-327.[Medline]
Lin, Y. J. & Lai, M. M. C. (1993). Deletion mapping of a mouse hepatitis virus defective interfering RNA reveals the requirement of an internal and discontinuous sequence for replication. Journal of Virology 67, 6110-6118.
McClurkin, A. W. & Norman, J. O. (1966). Studies on transmissible gastroenteritis of swine. II. Selected characteristics of a cytopathogenic virus common to five isolates from transmissible gastroenteritis. Canadian Journal of Comparative Medicine and Veterinary Science 30, 190-198.[Medline]
Masters, P. S. (1999). Reverse genetics of the largest RNA viruses. Advances in Virus Research 53, 245-264.[Medline]
Meulenberg, J. J. M., den Besten, A. P., de Kluyver, E. P., Moormann, R. J. M., Schaaper, W. M. M. & Wensvoort, G. (1995). Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206, 155-163.[Medline]
Meulenberg, J. J. M., Bos-de-Ruijter, J. N. A., Wenswoort, G. & Moormann, R. J. M. (1998). An infectious cDNA clone of porcine reproductive and respiratory syndrome virus. Advances in Experimental Medicine and Biology 440, 199-206.[Medline]
Penzes, Z., González, J. M., Izeta, A., Muntion, M. & Enjuanes, L. (1998). Progress towards the construction of a transmissible gastroenteritis coronavirus self-replicating RNA using a two-layer expression system. Advances in Experimental Medicine and Biology 440, 319-327.[Medline]
Penzes, Z., González, J. M., Calvo, E., Izeta, A., Smerdou, C., Mendez, A., Sánchez, C. M., Sola, I., Almazán, F. & Enjuanes, L. (2001). Complete genome sequence of transmissible gastroenteritis coronavirus PUR46-MAD clone and evolution of the Purdue virus cluster. Virus Genes 23, 105-118.[Medline]
Pirzadeh, B. & Dea, S. (1998). Immune response in pigs vaccinated with plasmid DNA encoding ORF5 of porcine reproductive and respiratory syndrome virus. Journal of General Virology 79, 989-999.[Abstract]
Plana-Durán, J., Vayreda, M., Vilarrasa, M., Bastons, J., Rosell, M., Martínez, R., SanGabriel, M. A., Pujols, A., Badiola, J., Ramos, J. L. & Domingo, M. (1992). Porcine epidemic abortion and respiratory syndrome (mystery swine disease). Isolation in Spain of the causative agent and experimental reproduction of the disease. Veterinary Microbiology 33, 203-211.[Medline]
Plana-Durán, J., Bastons, M., Urniza, A., Vayreda, M., Vila, X. & Mañe, H. (1997a). Efficacy of an inactivated vaccine for prevention of reproductive failure induced by porcine reproductive and respiratory syndrome virus. Veterinary Microbiology 55, 361-370.[Medline]
Plana-Durán, J., Climent, I., Sarraseca, J., Urniza, A., Cortes, E., Vela, C. & Casal, J. I. (1997b). Baculovirus expression of proteins of porcine reproductive and respiratory syndrome virus strain Olot/91. Involvement of ORF3 and ORF5 protein in protection. Virus Genes 14, 19-29.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sánchez, C. M., Jiménez, G., Laviada, M. D., Correa, I., Suñé, C., Bullido, M. J., Gebauer, F., Smerdou, C., Callebaut, P., Escribano, J. M. & Enjuanes, L. (1990). Antigenic homology among coronaviruses related to transmissible gastroenteritis virus. Virology 174, 410-417.[Medline]
Sánchez, C. M., Gebauer, F., Suñé, C., Méndez, A., Dopazo, J. & Enjuanes, L. (1992). Genetic evolution and tropism of transmissible gastroenteritis coronaviruses. Virology 190, 92-105.[Medline]
Sánchez, C. M., Izeta, A., Sánchez-Morgado, J. M., Alonso, S., Sola, I., Balasch, M., Plana-Durán, J. & Enjuanes, L. (1999). Targeted recombination demonstrates that the spike gene of transmissible gastroenteritis coronavirus is a determinant of its enteric tropism and virulence. Journal of Virology 73, 7607-7618.
Schlaman, H. R. M., Risseeuw, E., Franke-van Dijk, M. E. I. & Hooykaas, P. J. J. (1994). Nucleotide sequence corrections of the uidA open reading frame encoding
-glucuronidase. Gene 138, 259-260.[Medline]
Siddell, S. G. (1995). The Coronaviridae. In The Viruses , pp. 418. Edited by H. Fraenkel-Conrat & R. R. Wagner. New York:Plenum Press.
Sooknanan, R., Howes, M., Read, L. & Malek, L. T. (1994). Fidelity of nucleic acid amplification with avian myeloblastosis virus reverse transcriptase and T7 RNA polymerase. BioTechniques 17, 1077-1085.[Medline]
Stirrups, K., Shaw, K., Evans, S., Dalton, K., Casais, R., Cavanagh, D. & Britton, P. (2000). Expression of reporter genes from the defective RNA CD-61 of the coronavirus infectious bronchitis virus. Journal of General Virology 81, 1687-1698.
Thiel, V., Siddell, S. G. & Herold, J. (1998). Replication and transcription of HCV 229E replicons. Advances in Experimental Medicine and Biology 440, 109-114.[Medline]
Thiel, V., Herold, J., Schelle, B. & Siddell, S. G. (2001). Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus. Journal of General Virology 82, 1273-1281.
Thomas, M. J., Platas, A. A. & Hawley, D. K. (1998). Transcriptional fidelity and proofreading by RNA polymerase II. Cell 93, 627-637.[Medline]
Torres, J. M., Sánchez, C. M., Suñé, C., Smerdou, C., Prevec, L., Graham, F. & Enjuanes, L. (1995). Induction of antibodies protecting against transmissible gastroenteritis coronavirus (TGEV) by recombinant adenovirus expressing TGEV spike protein. Virology 213, 503-516.[Medline]
Ward, C. D., Stokes, M. A. M. & Flanagan, J. B. (1988). Direct measurement of the poliovirus RNA polymerase error frequency in vitro. Journal of Virology 62, 558-562.
Yount, B., Curtis, K. M. & Baric, R. S. (2000). Strategy for systematic assembly of large RNA and DNA genomes: the transmissible gastroenteritis virus model. Journal of Virology 74, 10600-10611.
Zhang, X., Hinton, D. R., Cua, D. J., Stohlman, S. A. & Lai, M. M. C. (1997). Expression of interferon-
by a coronavirus defective-interfering RNA vector and its effect on viral replication, spread, and pathogenicity. Virology 233, 327-338.[Medline]
Zurbriggen, A., Schmid, I., Graber, H. U. & Vandevelde, M. (1998). Oligodendroglial pathology in canine distemper. Acta Neuropathologica 95, 71-77.[Medline]
Received 19 July 2001;
accepted 26 November 2001.
This article has been cited by other articles:
![]() |
E. van den Born, C. C. Posthuma, K. Knoops, and E. J. Snijder An infectious recombinant equine arteritis virus expressing green fluorescent protein from its replicase gene J. Gen. Virol., April 1, 2007; 88(4): 1196 - 1205. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, O. Yamada, T. Sakamoto, H. Yoshida, H. Araki, and K. Shimotohno Exploiting cis-Acting Replication Elements To Direct Hepatitis C Virus-Dependent Transgene Expression J. Virol., May 15, 2005; 79(10): 5923 - 5932. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Dove, D. Cavanagh, and P. Britton Presence of an Encephalomyocarditis Virus Internal Ribosome Entry Site Sequence in Avian Infectious Bronchitis Virus Defective RNAs Abolishes Rescue by Helper Virus J. Virol., March 15, 2004; 78(6): 2711 - 2721. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Thiel, N. Karl, B. Schelle, P. Disterer, I. Klagge, and S. G. Siddell Multigene RNA Vector Based on Coronavirus Transcription J. Virol., September 15, 2003; 77(18): 9790 - 9798. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hackney, D. Cavanagh, P. Kaiser, and P. Britton In Vitro and In Ovo Expression of Chicken Gamma Interferon by a Defective RNA of Avian Coronavirus Infectious Bronchitis Virus J. Virol., May 15, 2003; 77(10): 5694 - 5702. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sola, S. Alonso, S. Zuniga, M. Balasch, J. Plana-Duran, and L. Enjuanes Engineering the Transmissible Gastroenteritis Virus Genome as an Expression Vector Inducing Lactogenic Immunity J. Virol., April 1, 2003; 77(7): 4357 - 4369. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |