|
|
||||||||
Insect |
School of Biological and Molecular Sciences, Gipsy Lane Campus, Oxford Brookes University, Oxford OX3 0BP, UK1
NERC Institute of Virology and Environmental Microbiology, Mansfield Road, Oxford OX1 3SR, UK2
Author for correspondence: Linda King. Fax +44 1865 483242. e-mail laking{at}brookes.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The genome of AcMNPV has been shown to contain a single chiA (Ayres et al., 1994
), encoding an enzyme that has been shown to possess an unusual endo- and exo-chitinolytic activity (Hawtin et al., 1995
; Thomas et al., 2000
). The chiA of AcMNPV is located upstream of lef-7, and in a back-to-back orientation with v-cath, with their respective promoters transcribing in opposing directions (Ayres et al., 1994
; Hawtin et al., 1995
; Slack et al., 1995
). Both chiA and v-cath are transcribed from late baculovirus promoters (TAAG). It has been postulated that the single chiA of AcMNPV may have originated via gene transfer from the bacterium Serratia marcescens, which inhabits the insect gut (Hawtin et al., 1995
). Although there is no phylogenetic evidence of such horizontal gene transfer (Kang et al., 1998
), the bacterial and viral chitinases share a high level of amino acid identity (60·5%) and the virus chiA has a G+C ratio that is more similar to that of the bacterium than to the rest of the AcMNPV genome (Hawtin et al., 1995
).
In a previous study we have shown that chitinase enters the secretory pathway of insect cells following cleavage of the amino-terminal signal peptide (Thomas et al., 1998
). Chitinase is then retained within the endoplasmic reticulum (ER) until terminal lysis, when it can be detected in the culture medium (Thomas et al., 1998
). Localization of chitinase within the ER was found to be consistent with the presence of a carboxy-terminal KDEL ER-retention motif (Thomas et al., 1998
). This motif is commonly found in proteins resident in the ER and consists of the tetrapeptide lysineaspartic acidglutamic acidleucine (Lewis & Pelham, 1992
). KDEL has been shown to function as an ER-retention motif in both animal and plant cells and acts as a signal to return proteins that have moved into the Golgi back to the ER, via the retrograde pathway (Lewis & Pelham, 1992
; Hawes et al., 1999
; Toyooka et al., 2000
). The motif has been identified as a conserved region in other baculovirus chitinases including those of Orgyia pseudotsugata (Op)NPV and Choristoneura fumiferana Cf(NPV), and as RDEL in BmNPV (Thomas et al., 1998
). The functional nature of these motifs in viral chitinases has yet to be elucidated although we have proposed that retention of chitinase in the ER may permit the virus to complete its replication cycle before cellular and tissue disintegration are induced.
In this study we have investigated the biological significance of the chitinase KDEL motif by producing a number of modified viruses in which the motif has been deleted or the amino acids substituted. The effects on the intracellular distribution of chitinase and its biological effect on insect larvae have been investigated.
| Methods |
|---|
|
|
|---|
Production of plasmid transfer vectors.
Further transfer vectors containing chiA with deletions or substitutions of the KDEL coding sequence were also produced. ChiA with a deletion of the coding sequence for KDEL was prepared using the following primers 5' ATAAGGATCCATGTTGTACAAATTGTTAAACG 3' (forward) and 5' TACAGGGATCCTTAAGGTTTAAACTGTCGTTTATCGC 3' (reverse) to produce pAcpolchiA
KDEL. ChiA containing a deletion of the sequence encoding KDEL plus a further five amino acid residues was produced using the primers 5' ATAAGGATCCATGTTGTACAAATTGTTAAACG 3' (forward) and 5' GGTTTGGATCCTTAGTTTATCGCGTTGAGCAAGTCG 3' (reverse) to produce pAcpolchiA
KDEL+5. Finally, a chiA containing a substitution of the KDEL coding sequence with four non-polar glycine residues was prepared using primers 5' ATAAGGATCCATGTTGTACAAATTGTTAAACG 3' (forward) and 5' TACAGGGATCCTTAGGAGGCGGGGGAGTTTATCGC 3' (reverse) to produce the transfer vector pAcpolhchiA
KDEL/4G. All transfer vectors were sequenced to confirm the integrity of the respective deletions or substitution of the KDEL motif.
Virus propagation and insect cell culture.
Recombinant viruses were routinely propagated in Spodoptera frugiperda (Sf9) cells maintained in Sf900II serum-free medium (King & Possee, 1992
). Plaque-assays containing viruses with the lacZ coding region were identified by addition of 2% X-Gal to the culture medium.
Generation of recombinant baculoviruses AcpolhchiA, AcpolhchiA
KDEL, AcpolhchiA
KDEL+5 and AcpolhchiA
KDEL/4G.
Recombinant polyhedrin-negative AcMNPV were produced that contained a normal or modified chiA under control of the strong, very late polyhedrin gene promoter. In all of the modified viruses, the natural chiA had been disrupted by insertional inactivation with lacZ (Thomas et al., 1998
). Sf9 cells (1x106) were co-transfected with pAcpolhchiA, pAcpolhchiA
KDEL, pAcpolhchiA
KDEL+5 or pAcpolhchiA
KDEL/4G (500 ng) and AcchiA-.lacZ virus DNA (Thomas et al., 1998
). Progeny virus was titrated by plaque-assay and plaques were picked after staining with X-Gal and neutral red to identify the polyhedrin-negative, lacZ-positive plaques and were subjected to plaque-purification to produce seed stocks of the recombinant viruses: AcpolhchiA, AcpolhchiA
KDEL, AcpolhchiA
KDEL+5 and AcpolhchiA
KDEL/4G. Recombinant viruses were characterized initially by examining virus-infected cells for the presence of chitinase by Western blot analysis and enzyme assay (described below). High-titre stocks of recombinant viruses were prepared in Sf9 cells as described in King & Possee (1992)
.
SDSPAGE and Western blotting.
Sf9 cells (1x106) were infected with either recombinant virus or AcMNPV at an m.o.i. of 5 p.f.u. per cell, or were mock-infected with culture medium. Cells were harvested at 48 h post-infection (p.i.), pelleted (3000 g) and the culture medium removed to a fresh tube. Cell pellets were washed three times in PBS and subjected to freezethaw lysis before analysis. SDSPAGE and Western blot analysis of cell pellets or cell culture medium were carried out as described previously (King & Possee, 1992
; Thomas et al., 1998
). Membranes were probed with primary anti-chitinase antiserum (1:10000), and a secondary anti-guinea pig IgG antibody conjugated to alkaline phosphatase (1:10000), before blots were developed with 5-bromo-4-chloro-3-indoyl phosphatase (BCIP) and nitro blue tetrazolium (NBT) as described by Thomas et al. (1998)
.
Enzyme assays.
Sf9 cells (1x106 cells/ml) were infected with virus at an m.o.i. of 5 p.f.u. per cell or were mock-infected and harvested at appropriate times p.i. Cells were pelleted and subjected to three rounds of freezethaw lysis before assaying for chitinase activity using the microtitre plate method of McCreath & Gooday (1992)
, as described by Thomas et al. (1998)
, permitting the levels of exo-chitinase, endo-chitinase and N-acetylglucosamidase activity to be determined. The release of a fluorescent aglycone as a result of enzymatic activity in the presence of 4-methylumbelliferylglycosides of N-acetylglucosamine oligosaccharides (4MU-[GlcNAc]14) was read on a Labsystems Fluoroskan II fluorimeter. The fluorescent aglycone is released in the presence of the following enzymatic activities: N-acetylglucosamidase (substrate 1, 4MU-GlcNAc), exo-chitinase (substrate 2, 4MU-[GlcNAc]2) and endo-chitinase (substrate 3, 4MU-[GlcNAc]3).
Virus-infected cells were assayed for cathepsin activity using a cysteine protease assay (Ohkawa et al., 1994
). Cells (3x107) were infected with virus at an m.o.i. of 10 p.f.u. per cell or were mock-infected and harvested at 40 h p.i. Prior to analysis cell lysates were subjected to three rounds of freezethaw and assayed as described by Hawtin et al. (1997)
.
Confocal microscopy.
Confocal laser scanning microscopy (CLSM) was used to examine the distribution of chitinase in virus-infected Sf9 cells. Sterile coverslips (13 mm) were seeded with cells and infected with recombinant virus (m.o.i.=5 p.f.u. per cell) or were mock-infected with medium. Cells were incubated at 28 °C and after harvesting were fixed with acetonemethanol (50:50) before immunostaining for chitinase with primary anti-chitinase antiserum (1:1000 dilution), and a secondary FITC-conjugated whole-molecule anti-guinea pig IgG antibody (Sigma) (1:64 dilution) as described by Thomas et al. (1998)
. Samples were mounted with Citifluor antifadant and examined on a Zeiss CLSM (Axiovert 100) using appropriate filter sets.
Virus infection of insect larvae.
Third instar Trichoplusia ni larvae (n=50) were infected with virus at a dose of 1x104 p.f.u., via micro-injection into the haemolymph at the final posterior proleg. Control larvae were inoculated with sterile PBS in place of virus inoculum. Larvae were subsequently housed in individual containers at 28 °C and were maintained on sterile semi-synthetic diet (Hunter et al., 1984
). Those larvae that died as a result of the micro-injection were discarded. Larvae were monitored at frequent intervals (68 h) for signs of virus infection and liquefaction.
| Results |
|---|
|
|
|---|
KDEL), a KDEL deletion with an additional deletion of five further amino acid residues (AcpolhchiA
KDEL+5), and a substitution of the KDEL motif with four non-polar glycine residues (AcpolhchiA
KDEL/4G) (Fig. 1
|
KDEL, AcpolhchiA
KDEL+5 and AcpolhchiA
KDEL/4G
KDEL-, AcpolhchiA
KDEL+5- and AcpolhchiA
KDEL/4G-infected cells that was not present in AcpolhchiA-, AcMNPV- or mock-infected cells (Fig. 2
KDEL-infected cells (Fig. 2
|
KDEL-infected Sf9 cells was carried out. Fig. 3
KDEL-infected cells (panel e). Estimated levels of chitinase synthesis in virus-infected cell pellets were comparable for all viruses. Upon examination of the culture medium, no specific band was identified in the AcMNPV-infected samples (Fig. 3
KDEL-infected cells from as early as 12 h p.i. (panel f). These results indicated that deletion of the chiA KDEL motif was sufficient to cause a partial redistribution of the intracellular localization of chitinase, resulting in some chitinase trafficking through the secretory pathway to the culture medium of infected cells. Visual examination of infected cells under the light microscope indicated that cell lysis could not account for the appearance of chitinase in the culture medium at the early time points of 1272 h p.i. (data not shown).
|
KDEL- and mock-infected cells
KDEL-infected cells using the assay of Ohkawa et al. (1994)
KDEL-infected cells were shown to be comparable to those found in AcMNPV-infected cells (Fig. 4
|
KDEL-infected Sf9 cells
Low levels of N-acetylglucosamidase activity were detected in both mock- and virus-infected cells, which remained constant throughout virus infection (Fig. 5
). The levels of N-acetylglucosamidase activity associated with AcpolhchiA
KDEL infection were similar to those found during infection with the control viruses AcMNPV and AcpolhchiA, but were lower than those of mock-infected cells (Fig. 5
). N-Acetylglucosamidase activity was detected from 0 h p.i., indicating that it was unlikely to be associated with virus infection and may be attributed to host cell enzymatic activity. In particular, virus-infected samples showed reduced levels of this activity from the onset of virus infection (0 h p.i.=1 h p.i. with viral inoculum), and this may have been a result of immediate early viral gene expression suppressing the levels of host cell enzyme activity.
|
KDEL (Fig. 5d
KDEL-infected cells (as demonstrated by Western blot) contained active enzyme, as the culture medium was found to produce a very high autofluorescence which masked any enzyme-induced fluorescence.
Localization of chitinase and modified chitinase in Sf9 cells infected with AcpolhchiA and AcpolhchiA
KDEL using CLSM
The localization of chitinase and modified chitinase in virus-infected cells was examined by CLSM. Virus-infected cells were harvested at 24, 48 and 72 h p.i. and immunostained with anti-chitinase polyclonal antibody and a secondary FITC-conjugated antibody as described in Methods and in Thomas et al. (1998)
. The distribution of chitinase staining in AcpolhchiA- and AcpolhchiA
KDEL-infected cells (Fig. 6a
f
) was perinuclear, which was not present in mock-infected cells (data not shown) as has been previously reported for AcMNPV-infected cells (Thomas et al., 1998
). Chitinase staining was observed from 24 h p.i. (panel a); increasing in intensity until 72 h p.i. (panel c) A more intense level of chitinase staining was observed in AcpolhchiA-infected cells (panels ac) than in cells infected with AcpolhchiA
KDEL (panels df). The heavily stained perinuclear area associated with AcpolhchiA-infected cells exhibited highly distended regions of ER, with vacuolar-like areas containing high levels of chitinase; these distended regions were markedly less apparent during AcpolhchiA
KDEL infection (Fig. 6
, compare panels b and e). The lower level of chitinase staining associated with AcpolhchiA
KDEL-infected cells was consistent with the movement of chitinase from the ER into the secretory pathway of the cell, which was in agreement with the deletion of KDEL from the chiA of AcpolhchiA
KDEL.
|
KDEL infection upon survival and liquefaction of T. ni larvae
KDEL exhibited a similar phenotype to larvae infected with AcMNPV. A whitening of the larval cuticle was observed from 4 days p.i., followed by characteristic liquefaction from 58 days p.i. No signs of virus infection or subsequent liquefaction were observed in mock-infected larvae. Healthy larvae typically pupated from 8 days p.i.
Furthermore, the efficacy of the recombinant viruses was compared to AcMNPV- and mock-infected larvae. Fifty individual larvae (third instar) were infected with AcpolhchiA, AcpolhchiA
KDEL or AcMNPV, or were mock-infected as previously described. The number of individual larvae which succumbed to virus infection and liquefied was recorded (Fig. 7
). A significant difference in the number of larvae which had succumbed to virus infection was observed from 5 days p.i. When virus-infected and mock-infected individuals were compared, a significant difference (F=265·3; P<0·001) in the number of larval deaths was observed using a single factor analysis of variance (ANOVA). At this time-point the virus AcpolhchiA
KDEL had killed a significantly greater number of larvae (60%) than either AcMNPV infection (30%) or AcpolhchiA infection (24%). At 7 days p.i., the number of dead larvae was shown to be significantly higher for AcpolhchiA
KDEL-infected individuals (60%) than AcpolhchiA-(40%) or AcMNPV- (40%) infected larvae (F=137·6; P<0·001). Larval death and liquefaction was observed to occur at a greater frequency in AcpolhchiA
KDEL-infected individuals from 5 days p.i., with all infected larvae liquefying by 7 days p.i. Therefore, larval death and liquefaction in AcpolhchiA
KDEL-infected larvae occurred up to 24 h earlier than for AcpolhchiA-infected larvae, and killed a significantly greater number of individuals than either AcpolhchiA or AcMNPV between 5 and 7 days p.i. (F=137·6; P<0·001) These data offered evidence that the virus AcpolhchiA
KDEL had a greater killing efficacy for T. ni larvae than either AcpolhchiA or wild-type AcMNPV.
|
| Discussion |
|---|
|
|
|---|
KDEL/4G) or by deletion (AcpolhchiA
KDEL, AcpolhchiA
KDEL+5), and the modified gene was placed under the control of the polh promoter at the polyhedrin gene locus in recombinant baculoviruses. This produced non-occluded recombinant virus expressing mutant chitinase from the polyhedrin locus. Accordingly, the virus AcpolhchiA was constructed which expressed an intact chiA from the polyhedrin promoter to act as a control virus. The effects of these carboxy-terminal mutations of chitinase upon the localization and biological activity of the enzyme were assessed as well as the in vivo efficacy of the viruses to T. ni.
Chitinase protein synthesis was detected in the intracellular fraction in all recombinant virus infections, but was not present in mock-infected samples. The accumulation of chitinase in the culture medium of cells infected with AcpolhchiA
KDEL/4G, AcpolhchiA
KDEL and AcpolhchiA
KDEL+5, at a time-point (48 h p.i.) prior to cellular lysis, indicated that modification of KDEL was sufficient to permit trafficking of the enzyme through the secretory pathway of virus-infected cells. Chitinase was not observed in the culture medium of AcpolhchiA-infected cells at 48 h p.i. A more detailed time-course of infection indicated that chitinase was only detectable in the culture medium of AcpolhchiA-infected cells at a time-point relating directly to cell lysis (7296 h p.i). The accumulation of chitinase in the culture medium of the AcpolhchiA
KDEL-infected cells was detected from 12 h p.i., and confirmed that deletion of KDEL was sufficient to permit chitinase to enter the secretory pathway from the ER, and to pass to the extracellular fraction of the infected cell.
The biological activity of chitinase was assessed by a microtitre plate assay (McCreath & Gooday, 1992
), which could differentiate between the exo- and endo-chitinolytic activities of the enzyme. The intracellular activity of exo- and endo-chitinase in cells infected with the control virus AcpolhchiA was higher than that associated with the modified virus AcpolhchiA
KDEL. We suggest that this is a result of the retention of the enzyme in the intracellular fraction of the infected cell, while the lower levels detected in AcpolhchiA
KDEL infection are a result of the secretion of chitinase to the extracellular fraction during infection. The higher levels of chitinolytic activity in AcpolhchiA-infected cells than AcMNPV are likely to be a result of the stronger polh promoter driving expression of chitinase in AcpolhchiA.
The distribution of chitinase observed in infected cells by CLSM indicated that the deletion of KDEL, and accumulation of chitinase in the culture medium of the cell, were sufficient to reduce the heavy ER-associated staining observed in AcpolhchiA infection. This was reflected in the more uniform perinuclear distribution of chitinase in AcpolhchiA
KDEL infection, with reduced areas of heavily stained and distended ER, and was consistent with the lower levels of intracellular chitinolytic activity associated with AcpolhchiA
KDEL infection.
The effects of the modified viruses with chiA under the control of the polh promoter were also examined in vivo in T. ni larvae. The phenotype of recombinant virus-infected larvae was shown to be similar to that associated with AcMNPV infection, with characteristic liquefaction observed at the terminal stage of virus infection. This indicated that the expression of chiA from the polh promoter and the modification of KDEL did not abrogate the liquefaction of infected larvae, and was in agreement with the retained dual enzymatic activity of exo- and endo-chitinase in the recombinants. The recombinant virus AcpolhchiA
KDEL was shown to cause a significantly greater number of the larval cohort examined to succumb to viral infection, and resulted in total larval liquefaction of infected individuals by 7 days p.i. This virus caused a lethal infection in a greater number of individuals than AcMNPV or AcpolhchiA, and induced larval death and liquefaction up to 24 h earlier than the control virus AcpolhchiA.
These data indicate that the modification of the AcMNPV chiA by manipulation of the carboxy-terminal KDEL motif is sufficient to alter the localization of the enzyme during baculovirus infection. Whilst the dual chitinolytic activity of the enzyme was not compromised, the distribution of chitinase in vitro was altered and the biological activity to T. ni larvae was enhanced. This offers evidence of the functional nature of the AcMNPV chiA KDEL motif as an ER-retention signal, and whilst the partial redistribution of chitinase as a result of a KDEL manipulation occurs, the potential effects both in vitro and in vivo warrant further investigation.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Dai, X., Hajos, J. P., Joosten, N. N., van Oers, M. M., IJkel, W. F. J., Zuidema, D., Pang, Y. & Vlak, J. M. (2000). Isolation of a Spodoptera exigua baculovirus recombinant with a 10·6 kbp deletion that retains biological activity. Journal of General Virology 81, 2545-2554.
Gomi, S., Majima, K. & Maeda, S. (1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. Journal of General Virology 80, 1323-1337.[Abstract]
Hawes, C. R., Brandizzi, F. & Andreeva, A. V. (1999). Endomembranes and vesicle trafficking. Current Opinion in Plant Biology 2, 454-461.[Medline]
Hawtin, R. E., Arnold, K., Ayres, M. D., Zanotto, P. M. D. A., Howard, S. C., Gooday, G. W., Chappell, L. H., Kitts, P. A., King, L. A. & Possee, R. D. (1995). Identification and preliminary characterization of a chitinase gene in the Autographa californica nuclear polyhedrosis virus genome. Virology 212, 673-685.[Medline]
Hawtin, R. E., Zarkowska, T., Arnold, K., Thomas, C. K., Gooday, G. W., King, L. A., Kuzio, J. A. & Possee, R. D. (1997). Liquefaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded chitinase and cathepsin genes. Virology 238, 243-253.[Medline]
Hunter, F. R., Crook, N. E. & Entwistle, P. F. (1984). Viruses as pathogens for the control of insects. In Microbial Methods for Environmental Biotechnology , pp. 323-347. Edited by J. M. Grainger & J. M. Lynch. New York & London:Academic Press.
Kang, W., Tristem, M., Maeda, S., Crook, N. E. & OReilly, D. R. (1998). Identification and characterization of the Cydia pomonella granulovirus cathepsin and chitinase genes. Journal of General Virology 79, 2283-2292.[Abstract]
King, L. A. & Possee, R. D. (1992). The Baculovirus Expression System. A Laboratory Guide. London: Chapman and Hall.
Kuzio, J., Pearson, M. N., Harwood, S. H., Funk, C. J., Evans, J. T., Slavicek, J. M. & Rohrmann, G. F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 17-34.[Medline]
Lewis, M. J. & Pelham, H. R. B. (1992). Ligand-induced redistribution of a human KDEL receptor from the Golgi complex to the endoplasmic reticulum. Cell 68, 353-364.[Medline]
McCreath, K. J & Gooday, G. W. (1992). A rapid and sensitive microassay for determination of chitinolytic activity. Journal of Microbiological Methods 14, pp 229237.
Ohkawa, T., Majima, K. & Maeda, S. (1994). A cysteine protease encoded by the baculovirus Bombyx mori nuclear polyhedrosis virus. Journal of Virology 68, 6619-6625.
Rawlings, N. D., Pearl, L. H. & Buttle, D. J. (1992). The baculovirus Autographa californica nuclear polyhedrosis virus genome includes a papain-like sequence. Biology and Chemistry 373, 1211-1215.
Slack, J. M., Kuzio, J. & Faulkner, P. (1995). Characterization of v-cath, a cathepsin L-like proteinase expressed by the baculovirus Autographa californica multiple nuclear polyhedrosis virus. Journal of General Virology 76, 1091-1098.
Thomas, C. J., Brown, H. L., Hawes, C. R., Lee, B. Y., Min, M. K., King, L. A. & Possee, R. D. (1998). Localization of a baculovirus-induced chitinase in the insect cell endoplasmic reticulum. Journal of Virology 72, 10207-10212.
Thomas, C. J., Gooday, G. W., King, L. A. & Possee, R. D. (2000). Mutagenesis of the active coding region of the Autographa californica nucleopolyhedrovirus chiA gene. Journal of General Virology 81, 1403-1411.
Toyooka, K., Okamoto, T. & Minamikawa, T. (2000). Mass transport of Proform of a KDEL-tailed cysteine proteinase (SH-EP) to protein storage vacuoles by endoplasmic reticulum-derived vesicle is involved in protein mobilisation in germinating seeds. Journal of Cell Biology 148, 453-464.
Received 15 August 2001;
accepted 9 November 2001.
This article has been cited by other articles:
![]() |
J. J. Hodgson, B. M. Arif, and P. J. Krell Autographa californica multiple nucleopolyhedrovirus and Choristoneura fumiferana multiple nucleopolyhedrovirus v-cath genes are expressed as pre-proenzymes J. Gen. Virol., April 1, 2009; 90(4): 995 - 1000. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Hodgson, B. M. Arif, and P. J. Krell Reprogramming the chiA expression profile of Autographa californica multiple nucleopolyhedrovirus J. Gen. Virol., September 1, 2007; 88(9): 2479 - 2487. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Young, R. M. Simpson, and V. K. Ward Characterization of an exochitinase from Epiphyas postvittana nucleopolyhedrovirus (family Baculoviridae) J. Gen. Virol., December 1, 2005; 86(12): 3253 - 3261. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Saville, A. L. Patmanidi, R. D. Possee, and L. A. King Deletion of the Autographa californica nucleopolyhedrovirus chitinase KDEL motif and in vitro and in vivo analysis of the modified virus J. Gen. Virol., April 1, 2004; 85(4): 821 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Merzendorfer and L. Zimoch Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases J. Exp. Biol., December 15, 2003; 206(24): 4393 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Hughes and R. Friedman Genome-Wide Survey for Genes Horizontally Transferred from Cellular Organisms to Baculoviruses Mol. Biol. Evol., June 1, 2003; 20(6): 979 - 987. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |