|
|
||||||||
Animal: RNA Viruses |
Department of Virology1 and Department of Pathology2, Haartman Institute and HUCH Laboratory Diagnostics, and Institute of Biotechnology3, PO Box 21, Haartmaninkatu 3, FIN-00014 University of Helsinki, Finland
Author for correspondence: Xiao-Dong Li. Fax +358 9 191 26491. e-mail Xiaodong.Li{at}Helsinki.Fi
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Unlike other members of the family Bunyaviridae, which require arthropod vectors, hantaviruses are persistently maintained in the different species of rodents with which they have co-evolved (Schmaljohn et al., 1985
; Schmaljohn, 1996
; Plyusnin et al., 1996
). Rodent carriers remain symptomless, whereas in man, hantaviruses cause two severe diseases, haemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary syndrome (HPS) (Khan et al., 1996
; Lee, 1996
; Kanerva et al., 1998
). Puumala virus (PUUV) is the causative agent of nephropathia epidemica, which, in general, is a milder form of HFRS (Brummer-Korvenkontio et al., 1980
; Kanerva et al., 1998
).
Apart from endothelial cells, monocyte/macrophages are considered to be the major targets of hantaviruses and presumably spread the virus via circulation to other parts of the body (Temonen et al., 1995
). The prototype hantavirus, Hantaan virus (HTNV), has also been found in the B- and T-cells of HFRS patients. In particular, lung endothelium and kidney tubular cells are involved in HPS and HFRS, respectively. In addition, viral antigens have been detected in the brain, liver and heart and, to a lesser extent, in other organs or glands (Kanerva et al., 1998
; Meyer & Schmaljohn, 2000
). Although hantaviruses have a wide cell susceptibility, their growth is surprisingly slow even in the experimentally preferred Vero E6 cells, as well as in primary human kidney cells (Temonen et al., 1993
). Hantaviruses do not cause any pronounced cytopathic effect; yet a more recent study (Kang et al., 1999
) demonstrated that HTNV-infected Vero E6 cells slowly undergo apoptosis: the detailed mechanism of virus-induced apoptosis is still unclear.
There is as yet limited information on the biological functions of the hantavirus gene products to explain the molecular mechanisms that trigger and control the presumed pathogenesis of HFRS and HPS in the infected tissues, in which, for example, elevated levels of T-cell inflammatory cytokines, such as TNF-
and -
or IFN-
, are considered to be important markers of pathogenesis (Peters et al., 1999
). We thought that direct interactions of hantavirus gene products with host cell proteins could be central for both HFRS and HPS. The search for cellular proteins that interact with the nucleocapsid protein (N) of PUUV (PUUV-N) in particular was thus of interest to us. The N protein is the major structural component of hantaviruses, it is abundant in infected tissues and is a major target of the immune response (Vapalahti et al., 1995
; Van Epps et al., 1999
; de Carvalho Nicacio et al., 2001
).
We performed yeast two-hybrid screening with a HeLa cDNA library and identified the protein Daxx, well known as a Fas death-domain adaptor protein, which transduces death signals through the Jun N-terminal kinase (JNK) pathway (Yang et al., 1997
). To our knowledge, PUUV-N is the first viral protein proposed to interact with Daxx. In this report, we describe the interaction between Daxx and PUUV-N, as confirmed by GST pull-down assay, co-immunoprecipitation and co-localization studies.
| Methods |
|---|
|
|
|---|
Cell cultures and antibodies.
ke Lundkvist, Swedish Institute for Infectious Disease Control), was characterized previously (Lundkvist & Niklasson, 1992
Virus infection.
The prototype of PUUV Sotkamo strain, adapted previously to Vero E6 cells, was used in this study. PUUV was produced in Vero E6 cells and its titre was determined as described (Kanerva et al., 1996
). All processes of handling live virus were performed in a laboratory of biosafety level 3. For infection, an equal amount of virus (0·01 f.f.u. per cell) was added to each well of a 24-well plate in which Vero E6 monolayer cells had been transfected with pEBB-HA-mDaxx overnight. After absorption for 1 h at 37 °C, the virus inoculum was removed and replaced with complete medium. After 14 days, cells were fixed for immunofluorescence study.
Plasmid constructions and transfections.
The coding sequence of PUUV-N was obtained from the S segment of PUUV Sotkamo strain by RTPCR, as described previously (Vapalahti et al., 1992
), and then subcloned into the yeast and bacterial expression vector pGEX-4T (Pharmacia Biotech), as well as mammalian expression vector pAHC (Tiainen et al., 1999
), with appropriate restriction enzymes. In brief, pGEX-4T-1-E11, used for the production of GSTE11 fusion proteins, pAHC-E11, used in co-immunoprecipitation assays, and pVP16-E11, used in the mammalian two-hybrid assay, were constructed by subcloning with EcoRI and XhoI restriction enzymes. The E11-encoding sequence from pJG-E11 was obtained from library screening. Two deletion mutants of PUUV-N in bait plasmids (pEG202-PUUV-N2 and pEG202-PUUV-N3) were made using PCR cloning techniques. The template was pcDNA3-PUUV-N and the forward primer used for both reactions was 5' TCCCCCGGGGGGTACCATGAGTGACTTGACAGAT 3'. The reverse primer for producing the amino-terminal 338 residues of PUUV-N (named PUUV-N2) was 5' GGGGCTCGAGTTATATTGAAAAAAAGGC 3' and for the amino-terminal 214 residues (named PUUV-N3) was 5' GGGCTCGAGTTAGTTACGAACCTGGATCTG 3'. The coding region of the S segment of PUUV from pGEM-3Z-PUUV-S was subcloned into either pcDNA3 to produce pcDNA3-PUUV-N, which was used in immunoprecipitation assays, or pM vector to produce pM-PUUV-N, which was used in the mammalian two-hybrid system. The deletion mutant encoding the carboxyl-terminal 57 residues of PUUV-N in pM (named pM-PUUV-N4) was generated by direct subcloning with appropriate restriction enzymes. pEBB-HA-mDaxx, haemagglutinin-tagged murine Daxx, was kindly provided by Dr David Baltimore (California Institute of Technology). Interactions in yeast were characterized by
-galactosidase assays, according to the manufacturers instructions (Clontech). The FuGENE 6 Transfection reagent (Boehringer Mannheim) was used to transfect eukaryotic expression vectors into 293-T cells, according to the manufacturers instructions.
Yeast two-hybrid system.
Yeast two-hybrid assays were carried out according to the instructions of Clontech. A HeLa cDNA library in pJG4-5 (Clontech) was used for screening the interacting partners of PUUV-N in the bait plasmid pEG202 in yeast strain EGY48.
Mammalian two-hybrid system.
The reporter plasmid pG5luc (Promega) was co-transfected in combination with pM and pVP16 (both plasmids from Clontech) constructs, described above, into HeLa cells grown on 6-well plates. After 48 h, cell lysates were prepared and luciferase activity was determined following the instructions provided by Promega.
GST pull-down assay.
The procedures for expressing GST fusion proteins were done by following the manual from the manufacturer (Pharmacia Biotech). In short, Escherichia coli strain DH5
was transformed with pGEX-4T-1-E11, grown in L broth containing 100 µg/ml ampicillin and induced for protein expression in 0·1 mM of IPTG at room temperature for 4 h. Bacterial cells were harvested, washed twice in cold PBS by centrifugation at 5000 r.p.m. and disrupted by sonication in lysis buffer (PBS with 1% Triton-X-100). Appropriate volumes of glutathioneSepharose 4B beads were added to the supernatants and beads with bound recombinant proteins were used directly for in vitro-binding assays. Baculovirus-expressed PUUV-N was prepared as described previously (Vapalahti et al., 1996
). For in vitro-binding assays, different dilutions of recombinant PUUV-N were incubated with a constant volume of GST- and GSTE11-bound beads, respectively. Incubations were carried out for 2 h at 4 °C in E1A modified buffer (50 mM HEPES, pH 7·6, 50 mM NaCl, 10% glycerol, 0·1% NP-40 and 5 mM EDTA). The beads were then washed four times in the same buffer before SDSPAGE. Polyacrylamide gels were subjected to both Coomassie blue staining and immunoblotting, in which complex formation between E11 and PUUV-N was monitored using the anti-PUUV-N mAb, 3H9.
Pepscan assay.
The carboxyl-terminal 243 amino acids of Daxx were synthesized as 18-mer overlapping peptides with a three-residue shift on a cellulose membrane by an Abimed Autospot Robot ASP 222. For interaction studies, the membrane was blocked overnight at 4 °C with 3% BSA in TBST (10 mM Tris, pH 7·4, 150 mM NaCl and 0·05% Tween-20) and subsequently incubated with baculovirus-expressed PUUV-N at a concentration 0·6 µg/ml in TBST for 1 h at room temperature. Unbound PUUV-N was removed by washing three times with TBST. Bound PUUV-N was transferred electrophoretically to a nitrocellulose membrane and detected by a rabbit polyclonal antibody against PUUV-N. The secondary antibody was horseradish peroxidase-conjugated rabbit antibody (DAKO); this allowed detection to be carried out using enhanced chemiluminescence reagents (ECL) (Amersham).
Co-immunoprecipitation from human cell lysates.
293-T cells were co-transfected with proper combinations of the different plasmid constructs, including pAHC (the empty vector), pcDNA3-PUUV-N and pAHC-E11 (2 µg each). After 48 h in culture at 37 °C, cells were collected and lysed on ice in lysis buffer [20 mM TrisHCl, pH 7·5, 150 mM NaCl, 1% NP-40, 5 mM EDTA and cocktail of protease inhibitors (Boehringer Mannheim)]. The cell lysates were sonicated briefly in a water bath sonicator and centrifuged at 10000 g for 30 min at 4 °C. The supernatants were transferred to new tubes and 5 µl anti-Daxx polyclonal antibody was added to each tube. The mixture was then incubated with soft rotation at 4 °C for 2 h. The incubation was continued for a further 1 h after the addition of 10 µl protein G Sepharose. Finally, the beads were pelleted and washed three times with cold lysis buffer without protease inhibitors. Subsequently, 20 µl SDSPAGE sample buffer was added directly to the tubes and the mixture boiled at 95 °C for 5 min. The bound protein was separated by 10% SDSPAGE and analysed in immunoblotting with the anti-PUUV-N mAb, 3H9. The secondary antibody was horseradish peroxidase-conjugated polyclonal antibodies against mouse (DAKO) and the immunoblots were developed with ECL.
Indirect immunofluorescence.
HeLa cells were grown on coverslips in 24-well plates and then co-transfected with the relevant plasmids. After 36 h, cells were fixed with 3·2% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with 0·1% Triton-X-100 in PBS. Nuclei were stained with Hoechst 33342 and the cells were washed again with PBS. Transfected proteins were visualized using the anti-PUUV-N mAb and the rabbit polyclonal antibody against Daxx. Secondary antibodies were FITC-conjugated donkey anti-mouse IgG (DAKO) and Texas red-conjugated rabbit anti-mouse IgG (Jackson ImmunoResearch Laboratories). The patterns of UV (Hoechst staining of DNA) and immunostaining were monitored by Zeiss Axioplan 2 and Axiophot 2 microscopy with a Hamamatu CCD digital camera.
| Results |
|---|
|
|
|---|
-galactosidase assays, both SUMO-1 and Daxx clones gave positive signals with full-length PUUV-N (Table 1
|
|
339433) and 219 residues (PUUV-N3;
214433), respectively, were made (Fig. 1
To provide direct evidence for the carboxyl-terminal interaction of PUUV-N and Daxx, the construct PUUV-N4 (Fig. 1
), encoding 57 carboxyl-terminal residues of PUUV-N, was created. The mammalian two-hybrid assay results show that this very short carboxyl-terminal region of PUUV-N is sufficient for Daxx interaction, since the luciferase activity of the fragment (pM-PUUV-N-N4+pVP16-E11) was well above vector background and twofold higher than the corresponding activity with full-length PUUV-N (pM-PUUV-N+pVP16-E11) (Fig. 2
). Interestingly, this region of the N protein is free of antigenic activity but seems to be crucial for NN self-interaction (Kaukinen et al., 2001
).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The apoptotic function of Daxx appears to be directed either by nuclear Daxx as a transcriptional regulator (Torii et al., 1999
; Zhong et al., 2000a
) or by cytoplasmic Daxx as a Fas receptor-associated protein that mediates the activation of JNK and programmed cell death by Fas (H. Li et al., 2000
; Zhong et al., 2000b
; Perlman et al., 2001
). Some similarity, both in the primary and secondary structure (data not shown), was observed between the Daxx-interacting domains of PUUV-N and ETS-1-pointed domain region, which has been reported to interact with Daxx (R. Li et al., 2000
). The possible significance of this relatively distant homology is also that the PUUV-N and Daxx interaction could be important for host defence. HTNV infection of Vero E6 cells leads gradually to apoptosis and has been linked with post-translational degradation of Bcl-2 (Kang et al., 1999
). Furthermore, Bcl-2 is transcriptionally regulated by p51-ETS-1 and p42-ETS-1 (R. Li et al., 2000
). It is therefore possible that hantaviruses may interfere with the apoptotic pathway at the post-translational level and could use Daxx as a mediator.
In the nucleus, Daxx is bound to chromatin or to the nuclear bodies called ND10 or PODs (Everett et al., 1999
; Ishov et al., 1999
). In the absence of sumoylated PML, Daxx is located in the condensed chromatin or centromeres and is recruited under cell cycle-dependent regulation to PODs together with the ubiquitin-like protein SUMO-1 (Ishov et al., 1999
; Maul et al., 2000
; Zhong et al., 2000a
). It has been shown that the transcription factors of DNA viruses can cause disruption of nuclear PODs, which, in the case of herpes simplex virus immediate early Vmw110 protein, is mediated by proteosome-type degradation of the SUMO-1-modified POD proteins PML and SP100 (Everett et al., 1998
). The responsiveness of POD structures and their dynamic counterparts, centromeres, to virus infections and other stress factors is functionally relevant for viruses. POD proteins can be either antiviral or they may assist virus replication, transcription and assembly (Chelbi-Alix et al., 1998
; Bell et al., 2000
). Recently, it was reported that PUUV-N could be found at perinuclear membranes in infected Vero E6 cells (Ravkov & Compans, 2001
). We observed that overexpression of Daxx leads to the accumulation of PUUV-N in the nuclei. Our co-localization data implicate that hantaviruses have the potential to interfere with POD structures through interaction with Daxx. It is tempting to speculate that the interaction of PUUV-N with Daxx may be transient and takes place either in the cytoplasm or in the nucleus, for example, prior to nucleocapsid assembly and/or under stimulation of stress factors like apoptotic stimuli, Fas ligands or TNF-
.
Two recent reports propose that translocation of Daxx to the cytoplasm is mediated by its association with the apoptosis signal regulating kinase 1, Ask1 (Charette et al., 2001
; Ko et al., 2001
). Daxx contains two predicted NLSs (Pluta et al., 1998
). One of the Daxx NLSs was found to bind to PUUV-N in pepscan assays. Additionally, another lysine-rich region was found also to interact with PUUV-N. It has been reported that cytosolic proteins interacting with NLS-containing proteins act as receptors for nuclear import (Adam & Gerace, 1991
). Our present findings indicate that PUUV-N may be involved in nuclear events through interactions with NLS-containing proteins such as Daxx. The detailed mechanisms on how Daxx would regulate PUUV-N translocation and what the role of PUUV-N is in the nucleus deserve further studies. It is also of interest to us whether the TNF-
-responsive Ask-1 activation would lead to a cytoplasmic interaction of hantavirus N and Daxx proteins.
Unravelling proteinprotein interactions can provide new insight into both the replication and pathogenesis of hantaviruses. The main focus of our future studies is, on the one hand, on the nuclear association of PUUV-N and, on the other hand, on the effects that Daxx, Fas and TNF-
may have on hantavirus infection and pathogenesis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bell, P., Brazas, R., Ganem, D. & Maul, G. G. (2000). Hepatitis delta virus replication generates complexes of large hepatitis delta antigen and antigenomic RNA that affiliate with and alter nuclear domain 10. Journal of Virology 74, 5329-5336.
Brummer-Korvenkontio, M., Vaheri, A., Hovi, T., von Bonsdorff, C. H., Vuorimies, J., Manni, T., Penttinen, K., Oker-Blom, N. & Lähdevirta, J. (1980). Nephropathia epidemica: detection of antigen in bank voles and serologic diagnosis of human infection. Journal of Infectious Diseases 141, 131-134.[Medline]
Chang, H. Y., Nishitoh, H., Yang, X., Ichijo, H. & Baltimore, D. (1998). Activation of apoptosis signal-regulating kinase 1 (ASK1) by the adapter protein Daxx. Science 281, 1860-1863.
Chang, H. Y., Yang, X. & Baltimore, D. (1999). Dissecting Fas signalling with an altered-specificity death-domain mutant: requirement of FADD binding for apoptosis but not Jun N-terminal kinase activation. Proceedings of the National Academy of Sciences, USA 96, 1252-1256.
Charette, S. J., Lambert, H. & Landry, J. (2001). A kinase-independent function of Ask1 in caspase-independent cell death. Journal of Biological Chemistry 276, 36071-36074.
Chelbi-Alix, M. K., Quignon, F., Pelicano, L., Koken, M. H. & de The, H. (1998). Resistance to virus infection conferred by the interferon-induced promyelocytic leukemia protein. Journal of Virology 72, 1043-1051.
de Carvalho Nicacio, C., Sällberg, M., Hultgren, C. & Lundkvist,
. (2001). T-helper and humoral responses to Puumala hantavirus nucleocapsid protein: identification of T-helper epitopes in a mouse model. Journal of General Virology 82, 129-138.
Everett, R. D., Freemont, P., Saitoh, H., Dasso, M., Orr, A., Kathoria, M. & Parkinson, J. (1998). The disruption of ND10 during herpes simplex virus infection correlates with the Vmw110- and proteosome-dependent loss of several PML isoforms. Journal of Virology 72, 6581-6591.
Everett, R. D., Earnshaw, W. C., Pluta, A. F., Sternsdorf, T., Ainsztein, A. M., Carmena, M., Ruchaud, S., Hsu, W. L. & Orr, A. (1999). A dynamic connection between centromeres and ND10 proteins. Journal of Cell Science 112, 3443-3454.[Abstract]
Hollenbach, A. D., Sublett, J. E., McPherson, C. J. & Grosveld, G. (1999). The Pax3-FKHR oncoprotein is unresponsive to the Pax3-associated repressor hDaxx. EMBO Journal 18, 3702-3711.[Medline]
Ishov, A. M., Sotnikov, A. G., Negorev, D., Vladimirova, O. V., Neff, N., Kamitani, T., Yeh, E. T., Strauss, J. F.III & Maul, G. G. (1999). PML is critical for ND10 formation and recruits the PML-interacting protein Daxx to this nuclear structure when modified by SUMO-1. Journal of Cell Biology 147, 221-234.
Jonsson, C. B. & Schmaljohn, C. S. (2001). Replication of hantaviruses. Current Topics in Microbiology and Immunology 256, 15-32.[Medline]
Kanerva, M., Melen, K., Vaheri, A. & Julkunen, I. (1996). Inhibition of Puumala and Tula hantaviruses in Vero cells by MxA protein. Virology 224, 55-62.[Medline]
Kanerva, M., Mustonen, J. & Vaheri, A. (1998). Pathogenesis of Puumala and other hantavirus infections. Reviews in Medical Virology 8, 67-86.[Medline]
Kang, J. I., Park, S. H., Lee, P. W. & Ahn, B. Y. (1999). Apoptosis is induced by hantaviruses in cultured cells. Virology 264, 99-105.[Medline]
Kaukinen, P., Koistinen, V., Vapalahti, O., Vaheri, A. & Plyusnin, A. (2001). Interaction between molecules of hantavirus nucleocapsid protein. Journal of General Virology 82, 1845-1853.
Khan, A. S., Ksiazek, T. G. & Peters, C. J. (1996). Hantavirus pulmonary syndrome. Lancet 347, 739-741.[Medline]
Ko, Y. G., Kang, Y. S., Park, H., Seol, W., Kim, J., Kim, T., Park, H. S., Choi, E. J. & Kim, S. (2001). Apoptosis signal-regulating kinase 1 controls the proapoptotic function of the death-associated protein (Daxx) in the cytoplasm. Journal of Biological Chemistry 276, 39103-39106.
Lee, H. W. (1996). Epidemiology and pathogenesis of hemorrhagic fever with renal syndrom. In The Bunyaviridae , pp. 253-267. Edited by R. M. Elliott. New York:Plenum Press.
Li, H., Leo, C., Zhu, J., Wu, X., ONeil, J., Park, E. J. & Chen, J. D. (2000). Sequestration and inhibition of Daxx-mediated transcriptional repression by PML. Molecular and Cellular Biology 5, 1784-1796.
Li, R., Pei, H., Watson, D. K. & Papas, T. S. (2000). EAP1/Daxx interacts with ETS1 and represses transcriptional activation of ETS1 target genes. Oncogene 19, 745-753.[Medline]
Lundkvist, A. & Niklasson, B. (1992). Bank vole monoclonal antibodies against Puumala virus envelope glycoproteins: identification of epitopes involved in neutralization. Archives of Virology 126, 93-105.[Medline]
Maul, G. G., Negorev, D., Bell, P. & Ishov, A. M. (2000). Properties and assembly mechanisms of ND10, PML bodies, or PODs. Journal of Structural Biology 129, 278-287.[Medline]
Meyer, B. J. & Schmaljohn, C. S. (2000). Persistent hantavirus infections: characteristics and mechanisms. Trends in Microbiology 8, 61-67.[Medline]
Perlman, R., Schieman, W. P., Brooks, M. W., Lodish, H. F. & Weinberg, R. A. (2001). TGF-
-induced apoptosis is mediated by the adapter protein Daxx that facilitates JNK activation. Nature Cell Biology 8, 708-714.
Peters, C. J., Simpson, G. L. & Levy, H. (1999). Spectrum of hantavirus infection: haemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome. Annual Review of Medicine 50, 531-545.[Medline]
Pluta, A. F., Earnshaw, W. C. & Goldberg, I. G. (1998). Interphase-specific association of intrinsic centromere protein CENP-C with HDaxx, a death domain-binding protein implicated in Fas-mediated cell death. Journal of Cell Science 111, 2029-2041.[Abstract]
Plyusnin, A., Vapalahti, O. & Vaheri, A. (1996). Hantaviruses: genome structure, expression and evolution. Journal of General Virology 77, 2677-2687.
Ravkov, E. V. & Compans, R. W. (2001). Hantavirus nucleocapsid protein is expressed as a membrane-associated protein in the perinuclear region. Journal of Virology 75, 1808-1815.
Schmaljohn, C. S. (1996). Molecular biology of hantaviruses. In The Bunyaviridae , pp. 63-90. Edited by R. M. Elliott. New York:Plenum Press.
Schmaljohn, C. S., Hasty, S. E., Dalrymple, J. M., LeDuc, J. W., Lee, H. W., von Bonsdorff, C. H., Brummer-Korvenkontio, M., Vaheri, A., Tsai, T. F., Regnery, H. L. and others (1985). Antigenic and genetic properties of viruses linked to hemorrhagic fever with renal syndrome. Science 227, 10411044.
Temonen, M., Vapalahti, O., Holthöfer, H., Brummer-Korvenkontio, M., Vaheri, A. & Lankinen, H. (1993). Susceptibility of human cells to Puumala virus infection. Journal of General of Virology 74, 515-518.
Temonen, M., Lankinen, H., Vapalahti, O., Ronni, T., Julkunen, I. & Vaheri, A. (1995). Effect of interferon-
and cell differentiation on Puumala virus infection in human monocyte/macrophages. Virology 206, 8-15.[Medline]
Tiainen, M., Ylikorkala, A. & Mäkelä, T. P. (1999). Growth suppression by Lkb1 is mediated by a G1 cell cycle arrest. Proceedings of the National Academy of Sciences, USA 96, 9248-9251.
Torii, S., Egan, D. A., Evans, R. A. & Reed, J. C. (1999). Human Daxx regulates Fas-induced apoptosis from nuclear PML oncogenic domains (PODs). EMBO Journal 18, 6037-6049.[Medline]
Van Epps, H. L., Schmaljohn, C. S. & Ennis, F. A. (1999). Human memory cytotoxic T-lymphocyte (CTL) responses to Hantaan virus infection: identification of virus-specific and cross-reactive CD8+ CTL epitopes on nucleocapsid protein. Journal of Virology 73, 5301-5308.
Vapalahti, O., Kallio-Kokko, H., Salonen, E. M., Brummer-Korvenkontio, M. & Vaheri, A. (1992). Cloning and sequencing of Puumala virus Sotkamo strain S and M RNA segments: evidence for strain variation in hantaviruses and expression of the nucleocapsid protein. Journal of General Virology 73, 829-838.
Vapalahti, O., Kallio-Kokko, H., Närvänen, A., Julkunen, I., Lundkvist,
., Plyusnin, A., Lehväslaiho, H., Brummer-Korvenkontio, M., Vaheri, A. & Lankinen, H. (1995). Human B-cell epitopes of Puumala virus nucleocapsid protein, the major antigen in early serological response. Journal of Medical Virology 46, 293-303.[Medline]
Vapalahti, O., Lundkvist,
., Kallio-Kokko, H., Paukku, K., Julkunen, I., Lankinen, H. & Vaheri, A. (1996). Antigenic properties and diagnostic potential of Puumala virus nucleocapsid protein expressed in insect cells. Journal of Clinical Microbiology 34, 119-125.[Abstract]
Yanagihara, R. & Silverman, D. J. (1990). Experimental infection of human vascular endothelial cells by pathogenic and nonpathogenic hantaviruses. Archives of Virology 111, 281-286.[Medline]
Yang, X., Khosravi-Far, R., Chang, H. Y. & Baltimore, D. (1997). Daxx, a novel Fas-binding protein that activates JNK and apoptosis. Cell 89, 1067-1076.[Medline]
Zhong, S., Salomoni, P. & Pandolfi, P. P. (2000a). The transcriptional role of PML and the nuclear body. Nature Cell Biology 5, 85-90.
Zhong, S., Salomoni, P., Ronchetti, S., Guo, A., Ruggero, D. & Pandolfi, P. P. (2000b). Promyelocytic leukemia protein (PML) and Daxx participate in a novel nuclear pathway for apoptosis. Journal of Experimental Medicine 191, 631-640.
Received 11 September 2001;
accepted 21 December 2001.
This article has been cited by other articles:
![]() |
R. T. Saffert and R. F. Kalejta Human Cytomegalovirus Gene Expression Is Silenced by Daxx-Mediated Intrinsic Immune Defense in Model Latent Infections Established In Vitro J. Virol., September 1, 2007; 81(17): 9109 - 9120. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. N. Ramanathan, D.-H. Chung, S. J. Plane, E. Sztul, Y.-k. Chu, M. C. Guttieri, M. McDowell, G. Ali, and C. B. Jonsson Dynein-Dependent Transport of the Hantaan Virus Nucleocapsid Protein to the Endoplasmic Reticulum-Golgi Intermediate Compartment J. Virol., August 15, 2007; 81(16): 8634 - 8647. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Wahl-Jensen, J. Chapman, L. Asher, R. Fisher, M. Zimmerman, T. Larsen, and J. W. Hooper Temporal Analysis of Andes Virus and Sin Nombre Virus Infections of Syrian Hamsters J. Virol., July 15, 2007; 81(14): 7449 - 7462. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Gaddy and D. S. Lyles Oncolytic Vesicular Stomatitis Virus Induces Apoptosis via Signaling through PKR, Fas, and Daxx J. Virol., March 15, 2007; 81(6): 2792 - 2804. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Brizard, C. Carapito, F. Delalande, A. Van Dorsselaer, and C. Brugidou Proteome Analysis of Plant-Virus Interactome: Comprehensive Data for Virus Multiplication Inside Their Hosts Mol. Cell. Proteomics, December 1, 2006; 5(12): 2279 - 2297. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alminaite, V. Halttunen, V. Kumar, A. Vaheri, L. Holm, and A. Plyusnin Oligomerization of hantavirus nucleocapsid protein: analysis of the N-terminal coiled-coil domain. J. Virol., September 1, 2006; 80(18): 9073 - 9081. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Muranyi, U. Bahr, M. Zeier, and F. J. van der Woude Hantavirus Infection J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3669 - 3679. [Full Text] [PDF] |
||||
![]() |
X. Ding, F. Xu, H. Chen, R. B. Tesh, and S.-Y. Xiao Apoptosis of Hepatocytes Caused by Punta Toro Virus (Bunyaviridae: Phlebovirus) and Its Implication for Phlebovirus Pathogenesis Am. J. Pathol., October 1, 2005; 167(4): 1043 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kaukinen, V. Kumar, K. Tulimaki, P. Engelhardt, A. Vaheri, and A. Plyusnin Oligomerization of Hantavirus N Protein: C-Terminal {alpha}-Helices Interact To Form a Shared Hydrophobic Space J. Virol., December 15, 2004; 78(24): 13669 - 13677. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-D. Li, S. Kukkonen, O. Vapalahti, A. Plyusnin, H. Lankinen, and A. Vaheri Tula hantavirus infection of Vero E6 cells induces apoptosis involving caspase 8 activation J. Gen. Virol., November 1, 2004; 85(11): 3261 - 3268. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-Y. Chen and J. D. Chen Daxx Silencing Sensitizes Cells to Multiple Apoptotic Pathways Mol. Cell. Biol., October 15, 2003; 23(20): 7108 - 7121. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kaukinen, A. Vaheri, and A. Plyusnin Mapping of the Regions Involved in Homotypic Interactions of Tula Hantavirus N Protein J. Virol., October 15, 2003; 77(20): 10910 - 10916. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Markotic, L. Hensley, T. Geisbert, K. Spik, and C. Schmaljohn Hantaviruses induce cytopathic effects and apoptosis in continuous human embryonic kidney cells J. Gen. Virol., August 1, 2003; 84(8): 2197 - 2202. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||