|
|
||||||||
Animal: RNA Viruses |
Departments of Medical Microbiology1 and Biochemistry2, Nijmegen Center for Molecular Life Sciences, University Medical Center Nijmegen, PO Box 9101, 6500 HB Nijmegen, The Netherlands
Author for correspondence: Frank van Kuppeveld. Fax +31 24 3540216. e-mail f.vankuppeveld{at}ncmls.kun.nl
| Abstract |
|---|
|
|
|---|
-helix or the second hydrophobic domain of the 2B protein disturbed both the 2BC:2BC and the 2B:2B homomultimerization reactions. Disruption of either the cationic or the amphipathic character of the
-helix or deletion of the N-terminal 30 amino acids of the 2B protein, however, had no effect on the 2BC and 2B homomultimerization reactions. Heteromultimerization reactions were observed between proteins 2BC and 2B, and also between proteins 2BC and 2C, but not between the 2B and 2C proteins. The 2BC:2B and 2BC:2C heteromultimerization reactions were also mediated by hydrophobic determinants located in the amphipathic
-helix and the second hydrophobic domain. The nature of the interactions and their implications for the virus life-cycle are discussed. | Introduction |
|---|
|
|
|---|
Recently, the yeast two-hybrid system has been successfully applied to catalogue interactions between the P2 and P3 region nonstructural proteins of poliovirus (PV) (Cuconati et al., 1998
; Hope et al., 1997
; Xiang et al., 1998
). Using this approach, several homomultimerization and heteromultimerization reactions between the nonstructural proteins were observed. Among the interactions of the P2 region proteins were homomultimerization reactions of the 2B and 2BC proteins and heteromultimerization reactions between the 2B, 2C and 2BC proteins. These proteins are localized at the outer surface of the virus-induced membrane vesicles that accumulate in the cytoplasm of the infected cell and are the sites at which vRNA replication takes place (Bienz et al., 1994
). The 2BC protein is the viral protein responsible for the proliferation and accumulation of these membrane vesicles (Barco & Carrasco, 1995
; Bienz et al., 1983
; Cho et al., 1994
), possibly in conjunction with the 3A protein (Suhy et al., 2000
). A number of functions have been ascribed to the 2B and 2C proteins but the relevance of these functions for the virus life-cycle remains to be established. The 2B protein is a small protein that contains two hydrophobic domains, of which one is predicted to form an amphipathic
-helix (Fig. 1C
) (van Kuppeveld et al., 1996
). The 2B protein has been implicated in the modification of membrane permeability (Aldabe et al., 1996
; Doedens & Kirkegaard, 1995
; van Kuppeveld et al., 1997a
, c
), the inhibition of protein secretion (Doedens & Kirkegaard, 1995
; van Kuppeveld et al., 1997c
) and the disassembly of the Golgi complex (Sandoval & Carrasco, 1997
). The identification of 2B mutations that interfere with virus growth but do not disturb the ability of the 2B protein to inhibit protein secretion or increase membrane permeability argues for additional functions of the 2B protein or its precursor 2BC (van Kuppeveld et al., 1997c
). The 2C protein is a nucleoside triphosphatase that is endowed with RNA binding capacities (Mirzayan & Wimmer, 1994
; Rodriguez & Carrasco, 1993
, 1995
), and therefore may be the viral protein that mediates attachment of the vRNA to the membranous replication complex. Moreover, a role for the 2C protein in the initiation of negative-strand RNA synthesis has been proposed (Barton & Flanegan, 1997
).
|
| Methods |
|---|
|
|
|---|
Cells.
Plasmids.
The Checkmate Mammalian Two-Hybrid System (Promega) includes plasmids pACT, pBIND and pG5luc. The pACT and pBIND plasmids contain the herpes simplex virus (HSV) type 1 VP16 activation domain and the yeast GAL4 DNA binding domain, respectively, followed by a multiple cloning site (which is the same in both plasmids). In addition, the pBIND plasmid includes the Renilla luciferase gene driven by the SV40 early promoter and enhancer, which allows monitoring of the transfection efficiency. The pG5luc plasmid is a reporter plasmid containing five GAL4 binding sites upstream of a minimal TATA box that precedes the firefly luciferase gene.
The coding sequences of the CBV3 2BC, 2B and 2C proteins (wild-type or mutant) were amplified by PCR, using mutant pCB3/T7 plasmids (van Kuppeveld et al., 1995
, 1996
) as template, and introduced in the expression plasmid pBIND as described below. The nucleotide sequence of the pBIND inserts was verified by sequence analysis. The inserts were excised from the pBIND plasmids and directly cloned in the pACT plasmids (benefiting from the fact that both plasmids contain the same multiple cloning site).
The 2BC coding sequence was amplified with primers that introduced a BamHI site at the upstream end (forward primer p115-14; 5' gatgcaaggatccagggagtgaaggactatgtg 3') and a stop codon (underlined) plus a SalI site at the downstream end (reverse primer p115-3; 5' tttgatctctctgtatacgtcgacttactggaacagtgcctc 3'). The 2BC products were cloned into pBIND cut with BamHI and SalI. The 2B coding sequence was amplified by PCR with forward primer p115-14 and a reverse primer that introduced a stop codon (underlined) plus a SmaI site at the downstream end (p115-7; 5' aagccacccgggctattggcgttcagccatagg 3'). The 2B products were cloned into pBIND cut with BamHI and EcoRV. The 2C coding sequence was amplified by PCR with primers that introduced a BamHI site at the upstream end (forward primer p115-15: 5' atggctgggatccaaaacaatagctggcttaag 3') and reverse primer p115-3. The 2C product was cloned in pBIND cut with BamHI and SalI.
For the construction of pBIND-2BC
HR1and pBIND-2BC
HR2, we made use of pCB3/T7-2B
HR1 and pCB3/T7-2B
HR2 constructs, which contain in-frame deletions of 2B amino acids (aa) 3456 (HR1) or aa 6480 (HR2), respectively (F. J. M. van Kuppeveld and others, unpublished data). For the construction of pBIND-2BC
30N and pBIND-2B
30N constructs, forward primer p115-22 (5' gtcaaccggatccaagaatcactagtgggtcaa 3') was used.
Transfection.
COS cells were grown in 24-well tissue culture plates to 70% confluency. Cells were transfected with a total of 0·75 µg plasmid DNA (1:1:1 mix of the pBIND:pACT:pG5luc plasmids) using the FuGENE 6 transfection reagent according to the manufacturers instructions (Roche). For each transfection, 3 µl of FuGENE 6 reagent was added to 100 µl of serum-free medium and incubated for 5 min at room temperature. This mix was added dropwise to the 0·75 µg plasmid DNA preparation described above and incubated at room temperature for 15 min. After this incubation, the FuGENE 6 reagent/DNA mixture was added drop-wise to the cells. The cells were grown at 37 °C until further analysis.
Analysis of luciferase activities.
At 48 h post-transfection, cells were lysed and both the firefly luciferase and Renilla luciferase enzyme activities were measured from the same cell lysate sample using the Dual-Luciferase Reporter Assay System, according to the manufacturers instructions (Promega). Luciferase activities were measured in a Bio-Orbit 1251 luminometer. Measurement of the Renilla luciferase production revealed only small differences among different samples from the same experiment. Because these small differences merely reflected variations in the luciferase measurement, we did not normalize for transfection efficiency.
Western blot analysis.
Cell lysates were prepared at 48 h post-transfection. Proteins were separated by SDSPAGE, transferred to nitrocellulose membranes and immunodetected using a monoclonal antibody against the GAL4 DNA binding protein (Clontech). Proteins were visualized using a chemoluminescent detection system (Amersham Pharmacia Biotech).
| Results |
|---|
|
|
|---|
|
Fig. 2(A)
shows that a strong homomultimerization reaction was observed with the 2BC protein. The amount of firefly luciferase produced in COS cells by the VP162BC and GAL42BC fusion proteins was in all experiments about 10- to 20-fold higher than observed with the two control transfections. A weak interaction was observed between the VP162B and GAL42B fusion proteins. The amount of firefly luciferase produced by the VP162B and GAL42B fusion proteins was about 3- to 4-fold higher than observed with the two control transfections. No interaction was observed between the VP162C and GAL42C fusion proteins. Western blot analysis showed that transfected COS cells correctly expressed fusion products of the expected molecular mass (Fig. 2B
).
Heteromultimerization reactions of the 2B, 2C and 2BC proteins
To test for heteromultimerization reactions of the 2B, 2C and 2BC proteins, COS cells were transfected with all possible pair-wise combinations and assayed for protein:protein interactions (Fig. 3
). The VP162B fusion protein was found to interact with the GAL42BC fusion protein, but not with the GAL42C fusion protein (Fig. 3A
). The VP162C fusion protein also interacted with the GAL42BC fusion protein, but not with the GAL42B fusion protein (Fig. 3B
). The VP162BC fusion protein displayed strong interactions with both the GAL42B and the GAL42C fusion proteins (Fig. 3C
). The 2BC protein was also tested for interactions with the CBV3 3A protein, a small (89 aa) hydrophobic viral protein. No interaction was observed between the VP162BC fusion protein and the GAL43A fusion protein (Fig. 3C
), a fusion protein that was efficiently expressed (data not shown). Collectively, these results provide evidence for specific heteromultimerization reactions between proteins 2BC and 2B and between proteins 2BC and 2C, but not between proteins 2B and 2C.
|
Construction of mutant 2BC and 2B fusion proteins
To gain more insight into the molecular determinants involved in the homomultimerization and heteromultimerization reactions of the 2BC and 2B proteins, several pACT and pBIND plasmids driving expression of 2BC and 2B fusion proteins containing either in-frame deletions or point mutations in the 2B coding region were generated. In the deletion mutants, either the N-terminal 30 aa (30N), the amphipathic
-helix (i.e. the first hydrophobic region, HR1) or the second hydrophobic region (HR2) were deleted (Fig. 1A
).
The point mutants contained well-characterized amino acid substitutions or insertions in HR1 or HR2 (Fig. 1B
). The amphipathic
-helix mutants are designated HR1.2, HR1.7, HR1.9, HR1.11 and HR1.13. In mutant HR1.2, the three lysines in the hydrophilic part of the amphipathic
-helix are replaced with glutamic acid residues (mutation K[41,44,48]E). Mutants HR1.7 and HR1.9 contain insertions of leucine residues at 2B positions 41 or 48 (mutations ins[41]L and ins[48]L, respectively). These insertions lead to a dispersion of the charged residues and, as a consequence, a decrease in the amphipathic character of the
-helix, without disturbing the overall hydrophobicity of the domain (Fig. 1C
). Mutant HR1.11 contains a replacement of the three lysines in the hydrophilic part of the amphipathic
-helix with leucine residues (mutation K[41,44,48]L). Mutant HR1.13 contains a replacement of four hydrophobic residues in the hydrophobic part of the amphipathic
-helix with polar asparagine residues (mutation L[46]N/V[47]N/I[49]N/I[50]N). Viral RNAs carrying these HR1 mutations were all nonviable due to a primary defect of the 2B protein in vRNA replication (van Kuppeveld et al., 1996
; unpublished results).
The second series of hydrophobic domain mutants was designated HR2.3, HR2.6 and HR2.9 (Fig. 1B
). In mutant HR2.3, cysteine-75 and serine-77 are replaced with more hydrophobic methionine residues (mutation C[75]M/S[77]M). In mutants HR2.6 and HR2.9, the overall hydrophobic character of HR2 is diminished. In mutant HR2.6, isoleucine-64 and valine-66 are replaced with polar serine residues (mutation I[64]S/V[66]S). In mutant HR2.9, alanine-71 and isoleucine-73 are replaced with glutamic acid residues (mutation A[71]E/I[73]E). All of these HR2 mutations caused a primary defect in vRNA replication, rendering the viral RNA either quasi-infectious (mutation C[75]M/S[77]M) or nonviable (mutations I[64]S/V[66]S and A[71]E/I[73]E) (van Kuppeveld et al., 1995
).
Homomultimerization reactions of mutant 2BC fusion proteins
Analysis of the homomultimerization reactions of the 2BC deletion mutants showed that the N-terminal 30 aa are not required for this activity (Fig. 4A
). Deletion of either HR1 or HR2, however, abolished the homomultimerization reaction of the 2BC protein, suggesting that the integrity of each of these domains is required for the formation of 2BC homomultimers. All 2BC deletion mutants were efficiently expressed (Fig. 4E
), arguing that the lack of interaction of the 2BC
HR1 and 2BC
HR2 proteins is not due to impaired protein production or stability.
|
-helix point mutants (Fig. 4B
-helix is absolutely required for the ability of the 2BC protein to form homomultimers. Mutant HR1.13, however, was unable to form homomultimers, indicating that the hydrophobic character of the amphipathic
-helix is required for the homomultimerization reaction of the 2BC protein. Analysis of the homomultimerization reactions of the second series of hydrophobic domain mutants (Fig. 4C
-helix and the second hydrophobic domain of the 2B protein.
Homomultimerization reactions of mutant 2B fusion proteins
Analysis of the homomultimerization reactions of the 2B deletion mutants showed that the N-terminal 30 aa are not required for this activity (data not shown). Analysis of the homomultimerization reactions of 2B point mutants (Fig. 5A
, B
) showed that mutants HR1.2, HR1.7, HR1.9 and HR1.11 and HR2.3 had retained the ability to form homomultimers. Mutants HR1.13, HR2.6 and HR2.9, however, displayed a severe defect in the ability to homomultimerize. Similar results were obtained when the VP162B point mutants were tested with the wild-type GAL42B fusion protein (data not shown). All point mutants were correctly expressed (Fig. 5C
), indicating that the differences observed in the multimerization reactions are not due to impaired protein production or stability. Thus, the homomultimerization reaction of the 2B protein also depends on hydrophobic determinants in the amphipathic
-helix and the second hydrophobic domain.
|
50% relative to 2B wild-type) in forming heteromultimers with the 2BC protein. This finding is surprising because the 2BCHR2.3 protein showed a wild-type phenotype in the 2BC:2B heteromultimerization reaction (Fig. 6A
40% relative to 2B wild-type) in forming 2BC:2B heteromultimers, which is surprising because the 2BCHR2.6 protein was severely disabled in forming 2BC:2B heteromultimers (Fig. 6A
|
|
| Discussion |
|---|
|
|
|---|
Homomultimerization reactions of the 2BC, 2B and 2C proteins
Homomultimerization reactions were observed with the 2BC protein and, albeit weakly, with the 2B protein, but not with the 2C protein. Western blot analysis demonstrated the efficient expression of the 2C protein arguing that it is unlikely that the failure to detect a 2C:2C interaction was due to impaired protein synthesis or stability. The possibility that either the GAL42C or the VP162C fusion protein was misfolded or unable to be transported to the nucleus seems also unlikely because protein:protein interactions were observed with both the GAL42C fusion protein (in combination with VP162BC) and the VP162C fusion protein (in combination with GAL42BC). Taken together, these data strongly suggest that the 2C protein is unable to form homomultimers. Multimerization of the poliovirus 2C protein was suggested by Tolskaya et al. (1994)
on the basis of complementation experiments. It should be stated, however, that trans-rescue of a genetic defect merely provides evidence for the requirement of a functional version of the protein rather than that it provides proof for the requirement of homomultimerization.
Analysis of mutant proteins carrying deletions or well-defined point mutations in the 2B region revealed that both the 2BC:2BC and 2B:2B homomultimerization reactions were dependent on hydrophobic determinants located in both the cationic amphipathic
-helix (aa 3754) and the second hydrophobic domain (aa 6380) of protein 2B. Deletion of the amino-terminal 30 aa of the 2B protein, as well as mutations that interfered with the cationic or the amphipathic character of the predicted cationic amphipathic
-helix, which is well conserved among all enterovirus 2B proteins (van Kuppeveld et al., 1996
), did not interfere with the homomultimerization reactions of the 2BC and 2B proteins. The observations that (i) the 2BC and the 2B homomultimerization reactions are sensitive to the same mutations in the 2B region and (ii) the 2BC:2BC interaction was completely inhibited by specific point mutations in the 2B region, strongly suggest that the homomultimerization reactions of the 2BC proteins depend on an intermolecular 2B:2B interaction mediated by hydrophobic determinants located in the amphipathic
-helix and the second hydrophobic domain.
Do these results correlate with the yeast two-hybrid results obtained by Cuconati et al. (1998)
? These authors also observed homomultimerization reactions of the PV 2B and 2BC proteins, but not of the 2C protein. These authors, however, found that the 2BC:2BC interaction may be aided by, or is even dependent on, interaction of the 2C moieties and does not occur exclusively through 2B:2B or 2B:2C interactions. In this study, no evidence for an absolute dependence of the 2C protein was observed. As mentioned above, specific point mutations in the 2B region completely abolished the homomultimerization reaction of CBV3 protein 2BC. If there were a contribution of the 2C protein in the 2BC:2BC interaction, then a residual interaction should have been expected. Our observations, however, do not exclude the possibility that an efficient 2BC homomultimerization reaction is dependent on both the 2B and 2C moieties, whereby specific determinants in the 2B moiety catalyse the initiation of the 2BC:2BC multimerization reaction, whereas the 2C moiety serves to stabilize this intermolecular interaction. This possibility is in agreement with our observation that the homomultimerization reaction of the 2BC protein was much stronger than the homomultimerization reaction of the 2B protein, even though the 2B protein was expressed in much higher amounts than the 2BC protein. However, it should be emphasized that care should be taken in drawing conclusions from the level of reporter gene transcription, because this does not necessarily reflect the strength of the protein:protein interaction. Factors like fusion protein folding and the efficiency with which the interacting protein complex is transported to the nucleus (which may be different for the 2B and 2BC fusion proteins) may be of importance as well. Therefore, no conclusions can be drawn on the potential role of the 2C moiety in the 2BC homomultimerization reaction.
Heteromultimerization reactions of the 2BC, 2B and 2C proteins
In this study, heteromultimerization reactions were observed between the CBV3 2BC and 2B proteins, and between the 2BC and 2C proteins, but not between the 2B and 2C proteins. Analysis of the 2BC:2B interaction using 2BC point mutants showed that the heteromultimerization reaction was sensitive to the same mutations that disrupted the 2BC:2BC and 2B:2B homomultimerization reactions, indicating that the 2BC:2B interaction may be mediated by an interaction between the 2B moieties. However, analysis of the 2BC:2B heteromultimerization reaction using 2B point mutants identified a mutation (HR2·6, I[64]S/V[66]S) that only partially inhibited the formation of 2BC:2B heteromultimers but completely prevented the formation of 2BC:2BC and 2B:2B homomultimers. This finding indicates that the 2BC:2B interaction may not simply reflect a 2B:2B interaction. Possible explanations for this remarkable observation are addressed below.
The 2BC:2C interaction was sensitive to the same mutations that disrupted the 2BC:2BC and 2B:2B homomultimerization reactions. A possible interpretation for this finding is that the same 2B determinants in the 2BC protein that govern the interaction with another 2B moiety also mediate interaction with the 2C protein. Although this possibility cannot be excluded, it seems unlikely given the absence of a 2B:2C interaction. Moreover, it is difficult to envisage how a certain protein domain mediates specific interactions with two different polypeptides which have no homology in amino acid sequence. Alternative explanations should be considered. A possible explanation is that the folding of the 2BC protein gives rise to new protein interaction domains which are absent in the 2B and 2C polypeptides alone. Disruption of the 2BC protein structure, which may depend on specific hydrophobic determinants in the 2B moiety, may disrupt the formation or the exposure of the 2BC-specific interaction domains and thereby disturb the interaction with the 2C protein. Another alternative explanation is that higher order protein complexes are formed. VP162BC fusion proteins may form homomultimers that provide a scaffold for the interaction with the GAL42C fusion protein, which may interact either with determinants located in the 2B moiety, the 2C moiety or 2BC-specific interaction determinants. Mutations in the 2B moiety that disturb the 2BC homomultimerization reaction may thereby interfere with the 2BC:2C heteromultimerization reaction.
These alternative explanations may of course also be valid for the 2BC:2B heteromultimerization reaction. The 2B protein may interact with 2BC-specific domains, which may or may not depend on the formation of 2BC homomultimers. Disruption of either the 2BC protein structure or the ability to form homomultimers by mutations in the 2B moiety may thereby account for the disturbance of the interaction with the 2B protein. The possibility that the 2BC:2B heteromultimerization reaction is not simply provided by 2B:2B interaction is consistent with the differential results obtained with mutant HR2.6 (see above).
Further experiments are required to dissect the molecular determinants that underlie the heteromultimerization reactions between the 2B, 2C and 2BC proteins. An important step would be investigations to assay possible interactions between the 2B and 2C proteins. In the mammalian two-hybrid system, we found no evidence for a 2B:2C interaction. In contrast, Cuconati et al. (1998)
observed a strong PV 2B:2C interaction in the yeast system. These authors, however, found no evidence for a 2B:2C interaction in the GST pull-down assay. Further investigations are required to shed light on the reason for the discrepancies between the yeast and mammalian systems.
Implications for the virus life-cycle
Enteroviruses gradually modify the permeability of the ER membrane and the plasma membrane of the host cell (van Kuppeveld et al., 1997a
). The 2B protein has been identified as the membrane-active protein responsible for these modifications, and both the amphipathic
-helix and the second hydrophobic domain have been recognized as major determinants for its membrane-active function (Aldabe et al., 1996
; Barco & Carrasco, 1998
; Doedens & Kirkegaard, 1995
; van Kuppeveld et al., 1997a
, c
). The membrane alterations induced by protein 2B (or its precursor 2BC) are of major importance for creating the microenvironment required to replicate the vRNA, since mutations in the hydrophobic domains of the 2B protein cause early defects in vRNA replication (van Kuppeveld et al., 1995
, 1996
). The molecular mechanism by which the 2B protein modifies membrane permeability is as yet unknown. One possible mechanism that may explain the membrane-active function of the 2B protein is the formation of membrane-integral multimers of protein 2B (or 2BC), which may build aqueous pores by exposing the hydrophilic sides of the amphipathic
-helices towards each other. The finding that both the 2B protein and the 2BC protein formed homomultimers in the mammalian two-hybrid system lends support to this hypothesis. Each of the hydrophobic domains was found to be required for the 2B and 2BC homomultimerization reaction. This suggests that the formation of these membrane-integral pore structures may involve (sequence-specific) synergistic contacts between the two hydrophobic domains, rather than that they act as autonomous entities. This idea is consistent with previous observations that (i) mutations in each of the hydrophobic domains can interfere with the membrane-active function of the 2B protein (van Kuppeveld et al., 1997c
) and (ii) neither the amphipathic
-helix nor the second hydrophobic domain of the CBV3 2B protein can be functionally exchanged with its PV counterpart (van Kuppeveld et al., 1997b
). All mutations that disturb the homomultimerization reaction of the 2B protein (mutations I[64]S/V[66]S, A[71]E/I[73]E and L[46]N/V[47]N/I[49]N/I[50]N) abolish the membrane-active function of the 2B protein (A. S. de Jong and others, unpublished), providing evidence that there is a firm correlation between the ability of the 2B protein to form homomultimers and to permeabilize membranes. Consistent with our results, Cuconati et al. (1998)
also identified hydrophobic determinants (PV aa I[53] and I[54]) as being important for the formation of PV 2B homomultimers.
Further biochemical and genetic experimentation is required for a better understanding of the complex interplay of homomultimerization and heteromultimerization reactions that mediate regulation and execution of protein functions in the virus life-cycle.
| References |
|---|
|
|
|---|
Aldabe, A., Barco, A. & Carrasco, L. (1996). Membrane permeabilization by poliovirus proteins 2B and 2BC. Journal of Biological Chemistry 271, 23134-23137.
Barco, A. & Carrasco, L. (1995). A human virus protein, poliovirus protein 2BC, induces membrane proliferation and blocks the exocytic pathway in the yeast Saccharomyces cerevisiae. EMBO Journal 14, 3349-3364.[Medline]
Barco, A. & Carrasco, L. (1998). Identification of regions of poliovirus 2BC protein that are involved in cytotoxicity. Journal of Virology 72, 3560-3570.
Barton, D. J. & Flanegan, J. (1997). Synchronous replication of poliovirus RNA: initiation of negative-strand RNA synthesis requires the guanidine-inhibited activity of protein 2C. Journal of Virology 71, 8482-8489.[Abstract]
Bienz, K., Egger, D., Rasser, Y. & Bossart, W. (1983). Intracellular distribution of poliovirus proteins and the induction of virus-specific cytoplasmic structures. Virology 131, 39-48.[Medline]
Bienz, K., Egger, D. & Pfister, T. (1994). Characteristics of the poliovirus replication complex. Archives of Virology Supplement 9, 147157.
Cho, M. W., Teterina, N., Egger, D., Bienz, K. & Ehrenfeld, E. (1994). Membrane rearrangement and vesicle induction by recombinant poliovirus 2C and 2BC in human cells. Virology 202, 129-145.[Medline]
Cuconati, A., Xiang, W., Lasher, F., Pfister, T. & Wimmer, E. (1998). A protein linkage map of the P2 nonstructural proteins of poliovirus. Journal of Virology 72, 1297-1307.
Doedens, J. R. & Kirkegaard, K. (1995). Inhibition of cellular protein secretion by poliovirus proteins 2B and 3A. EMBO Journal 14, 894-907.[Medline]
Hope, D. A., Diamond, S. E. & Kirkegaard, K. (1997). Genetic dissection of interaction between poliovirus 3D polymerase and viral protein 3AB. Journal of Virology 71, 9490-9498.[Abstract]
Mirzayan, C. & Wimmer, E. (1994). Biochemical studies on poliovirus polypeptide 2C: evidence for ATPase activity. Virology 199, 176-187.[Medline]
Porter, A. (1993). Picornavirus nonstructural proteins: emerging roles in virus replication and inhibition of host cell functions. Journal of Virology 67, 6917-6921.
Rodriguez, P. L. & Carrasco, L. (1993). Poliovirus protein 2C has ATPase and GTPase activities. Journal of Biological Chemistry 268, 8105-8110.
Rodriguez, P. L. & Carrasco, L. (1995). Poliovirus protein 2C contains two regions involved in RNA binding activity. Journal of Biological Chemistry 270, 10105-10112.
Sandoval, I. & Carrasco, L. (1997). Poliovirus infection and expression of the poliovirus 2B provoke the disassembly of the Golgi complex, the organelle target for the anti-poliovirus drug Ro-090179. Journal of Virology 71, 4679-4693.[Abstract]
Suhy, D. A., Giddings, T. H.Jr & Kirkegaard, K. (2000). Remodeling the endoplasmic reticulum by poliovirus infection and by individual viral proteins: an autophagy-like origin for virus-induced vesicles. Journal of Virology 74, 8953-8965.
Tolskaya, E. A., Romanova, L. I., Kolesnikova, M. S., Gmyl, A. P., Gorbalenya, A. E. & Agol, V. I. (1994). Genetic studies on the poliovirus 2C protein, an NTPase. Journal of Molecular Biology 236, 1310-1323.[Medline]
van Kuppeveld, F. J. M., Galama, J. M. D., Zoll, J. & Melchers, W. J. G. (1995). Genetic analysis of a hydrophobic domain of coxsackie B3 virus protein 2B; a moderate degree of hydrophobicity is required for a cis-acting function in viral RNA synthesis. Journal of Virology 69, 7782-7790.[Abstract]
van Kuppeveld, F. J. M., Galama, J. M. D., Zoll, J., van den Hurk, P. J. J. C. & Melchers, W. J. G. (1996). Coxsackie B3 virus protein 2B contains a cationic amphipathic helix that is required for viral RNA replication. Journal of Virology 70, 3876-3886.[Abstract]
van Kuppeveld, F. J. M., Hoenderop, J. G. J., Smeets, R. L. L., Willems, P. H. G. M., Dijkman, H. B. P. M., Galama, J. M. D. & Melchers, W. J. G. (1997a). Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO Journal 16, 3519-3532.[Medline]
van Kuppeveld, F. J. M., van den Hurk, P. J. J. C., van der Vliet, W., Galama, J. M. D. & Melchers, W. J. G. (1997b). Chimeric coxsackie B3 virus genomes that express hybrid coxsackievirus-poliovirus 2B proteins: functional dissection of structural domains involved in RNA replication. Journal of General Virology 78, 1833-1840.[Abstract]
van Kuppeveld, F. J. M., Melchers, W. J. G., Kirkegaard, K. & Doedens, J. R. (1997c). Structure-function analysis of coxsackie B3 virus protein 2B. Virology 227, 111-118.[Medline]
Wimmer, E., Helen, C. U. T. & Cao, X. (1993). Genetics of poliovirus. Annual Review of Genetics 27, 353-436.[Medline]
Xiang, W., Cuconati, A., Hope, D., Kirkegaard, K. & Wimmer, E. (1998). Complete linkage map of poliovirus P3 proteins: interaction of polymerase 3Dpol with VPg and with genetic variants of 3AB. Journal of Virology 72, 6732-6741.
Received 29 October 2001;
accepted 4 December 2001.
This article has been cited by other articles:
![]() |
A. M. De Palma, W. Heggermont, K. Lanke, B. Coutard, M. Bergmann, A.-M. Monforte, B. Canard, E. De Clercq, A. Chimirri, G. Purstinger, et al. The Thiazolobenzimidazole TBZE-029 Inhibits Enterovirus Replication by Targeting a Short Region Immediately Downstream from Motif C in the Nonstructural Protein 2C J. Virol., May 15, 2008; 82(10): 4720 - 4730. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. de Jong, F. de Mattia, M. M. Van Dommelen, K. Lanke, W. J. G. Melchers, P. H. G. M. Willems, and F. J. M. van Kuppeveld Functional Analysis of Picornavirus 2B Proteins: Effects on Calcium Homeostasis and Intracellular Protein Trafficking J. Virol., April 1, 2008; 82(7): 3782 - 3790. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yin, Y. Liu, E. Wimmer, and A. V. Paul Complete protein linkage map between the P2 and P3 non-structural proteins of poliovirus J. Gen. Virol., August 1, 2007; 88(8): 2259 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Wessels, D. Duijsings, K. H. W. Lanke, W. J. G. Melchers, C. L. Jackson, and F. J. M. van Kuppeveld Molecular Determinants of the Interaction between Coxsackievirus Protein 3A and Guanine Nucleotide Exchange Factor GBF1 J. Virol., May 15, 2007; 81(10): 5238 - 5245. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Moffat, C. Knox, G. Howell, S. J. Clark, H. Yang, G. J. Belsham, M. Ryan, and T. Wileman Inhibition of the Secretory Pathway by Foot-and-Mouth Disease Virus 2BC Protein Is Reproduced by Coexpression of 2B with 2C, and the Site of Inhibition Is Determined by the Subcellular Location of 2C J. Virol., February 1, 2007; 81(3): 1129 - 1139. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Wessels, R. A. Notebaart, D. Duijsings, K. Lanke, B. Vergeer, W. J. G. Melchers, and F. J. M. van Kuppeveld Structure-Function Analysis of the Coxsackievirus Protein 3A: IDENTIFICATION OF RESIDUES IMPORTANT FOR DIMERIZATION, VIRAL RNA REPLICATION, AND TRANSPORT INHIBITION J. Biol. Chem., September 22, 2006; 281(38): 28232 - 28243. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Teterina, E. Levenson, M. S. Rinaudo, D. Egger, K. Bienz, A. E. Gorbalenya, and E. Ehrenfeld Evidence for functional protein interactions required for poliovirus RNA replication. J. Virol., June 1, 2006; 80(11): 5327 - 5337. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. de Jong, H.-J. Visch, F. de Mattia, M. M. van Dommelen, H. G. Swarts, T. Luyten, G. Callewaert, W. J. Melchers, P. H. Willems, and F. J. van Kuppeveld The Coxsackievirus 2B Protein Increases Efflux of Ions from the Endoplasmic Reticulum and Golgi, thereby Inhibiting Protein Trafficking through the Golgi J. Biol. Chem., May 19, 2006; 281(20): 14144 - 14150. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zell, S. Seitz, A. Henke, T. Munder, and P. Wutzler Linkage map of protein-protein interactions of Porcine teschovirus J. Gen. Virol., October 1, 2005; 86(10): 2763 - 2768. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Harris and V. R. Racaniello Amino Acid Changes in Proteins 2B and 3A Mediate Rhinovirus Type 39 Growth in Mouse Cells J. Virol., May 1, 2005; 79(9): 5363 - 5373. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Wessels, D. Duijsings, R. A. Notebaart, W. J. G. Melchers, and F. J. M. van Kuppeveld A Proline-Rich Region in the Coxsackievirus 3A Protein Is Required for the Protein To Inhibit Endoplasmic Reticulum-to-Golgi Transport J. Virol., April 15, 2005; 79(8): 5163 - 5173. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. de Jong, W. J. G. Melchers, D. H. R. F. Glaudemans, P. H. G. M. Willems, and F. J. M. van Kuppeveld Mutational Analysis of Different Regions in the Coxsackievirus 2B Protein: REQUIREMENTS FOR HOMO-MULTIMERIZATION, MEMBRANE PERMEABILIZATION, SUBCELLULAR LOCALIZATION, AND VIRUS REPLICATION J. Biol. Chem., May 7, 2004; 279(19): 19924 - 19935. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Campanella, A. S. de Jong, K. W. H. Lanke, W. J. G. Melchers, P. H. G. M. Willems, P. Pinton, R. Rizzuto, and F. J. M. van Kuppeveld The Coxsackievirus 2B Protein Suppresses Apoptotic Host Cell Responses by Manipulating Intracellular Ca2+ Homeostasis J. Biol. Chem., April 30, 2004; 279(18): 18440 - 18450. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hartlieb, J. Modrof, E. Muhlberger, H.-D. Klenk, and S. Becker Oligomerization of Ebola Virus VP30 Is Essential for Viral Transcription and Can Be Inhibited by a Synthetic Peptide J. Biol. Chem., October 24, 2003; 278(43): 41830 - 41836. [Abstract] [Full Text] [PDF] |
||||