|
|
||||||||
Animal: DNA Viruses |
Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK1
Author for correspondence: Geoffrey L. Smith. Present address: The WrightFleming Institute, Faculty of Medicine, Imperial College, St Marys Campus, Norfolk Place, London W2 1PG, UK. Fax +44 207 594 3973. e-mail glsmith{at}ic.ac.uk
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
The right end of the VV genome encodes many proteins that affect virus virulence or act as immunomodulators. For instance, VV protein B7R is an intracellular protein that is retained in the endoplasmic reticulum and affects virus virulence (Price et al., 2000
), VV B8R is a secreted protein that binds interferon-
(Alcamí & Smith, 1995
), B13R is an intracellular inhibitor of caspase 1 and apoptosis (Kettle et al., 1997
), and VV B15R is a secreted protein that binds interleukin-1
(Alcamí & Smith, 1992
). To continue our characterization of genes from this region that encode proteins with hydrophobic amino acid sequences suggesting membrane-association or secretion, we have studied the B9R gene.
VV WR gene B9R is predicted to encode a 77 amino acid primary translation product of 8·8 kDa (Smith et al., 1991
) that is conserved in VV strains Copenhagen and Tian Tan (there is a single amino acid substitution, Q21R, between WR and Copenhagen), and is 5 amino acids shorter in strain MVA due to deletion of amino acids 6165. The WR protein has a hydrophobic N terminus, which is predicted to function as a signal peptide (Howard et al., 1991
). B9R has amino acid similarity to the N-terminal region of larger proteins in leporipoxviruses (Shope fibroma virus, myxoma virus and rabbit fibroma virus) (Upton et al., 1987
), two strains of capripoxvirus (Gershon & Black, 1989
) and cowpox virus GRI-90 (Shchelkunov et al., 1998
), but in variola virus strains Harvey-1947 (Aguado et al., 1992
), Bangladesh-1975 (Massung et al., 1994
) and India-1970 (Shchelkunov et al., 1994
) the gene is disrupted into smaller fragments. The related 240 amino acid protein from myxoma virus (called M-T4) is located in the endoplasmic reticulum and affects virus virulence (Barry et al., 1997
).
To identify the B9R protein in VV-infected cells, amino acids 2077 (excluding the hydrophobic N terminus) were expressed in E. coli as a glutathione S-transferase fusion protein, purified and used to immunize New Zealand White rabbits as described for protein B7R (Price et al., 2000
). An Ig fraction was obtained from the serum and was affinity purified on a B9RGST affinity column. This antibody was used in immunoblotting. Fig. 1a
shows that a 6 kDa protein was synthesized in cells infected with a virus containing the B9R ORF but not in cells infected with a B9R deletion mutant (v
B9R) (see below) or mock-infected cells. The protein was not detected in the supernatant of infected cells, suggesting that only low levels, if any, of the B9R protein are released from cells (data not shown). This demonstrated that the protein was a 6 kDa intracellular protein.
|
The presence of an N-terminal hydrophobic signal peptide suggested that the protein might be associated with membranes. Attempts to analyse this within infected cells were unsuccessful and therefore we used in vitro transcription and translation in the presence or absence of microsomal membranes. Plasmid pSTH1 (Howard, 1991
) was digested with HpaI and a 356 bp fragment containing the B9R ORF and downstream sequences was cloned into plasmid pGEM-4Z at the SmaI site downstream of the SP6 RNA polymerase promoter, forming plasmid pNP4. After transcription and translation (Price et al., 2000
), B9R proteins were immunoprecipitated with anti-B9R Ig and analysed by SDSPAGE and autoradiography (Fig. 1c![]()
). A protein of approximately 8 kDa was detected when the mRNA was translated in the absence of membranes (lanes 46), but in the presence of membranes (lanes 13) an additional slightly smaller protein (6 kDa) was detected. To determine if either of these proteins was associated with membranes, the translation products were fractionated by centrifugation into soluble (S) and pelleted (P) fractions, the latter containing the microsomes. Only the smaller protein was associated with membranes. This analysis did not determine whether the smaller protein was inserted into the vesicle lumen or whether it was an integral membrane protein. However, we suggest the former is more probable because the reduction in size of the translation product associated with membranes is consistent with the protein being cleaved proteolytically to remove the N-terminal signal peptide.
The role of the B9R protein in the virus life-cycle was investigated by the construction of a deletion mutant that lacked amino acids 129 (v
B9R). The remaining part of the gene was retained as it overlapped the putative promoter region of gene B10R; however, amino acids 3077 would not be expressed because of the lack of an in-frame methionine codon (Smith et al., 1991
). The deletion virus was constructed by transient dominant selection using established methods (Falkner & Moss, 1990
). The transfer plasmid (pNP7) was constructed by PCR amplification of the flanking regions of the B9R gene using pSTH1 DNA as template and oligonucleotides 5' CCC-GAATTCGTGTGCGTGACAGCACAGGGAGCC 3' (EcoRI site underlined) and 5' CTATTTTCAATCCCCCTTGAAAATGGTTAGAG 3' for the upstream flanking region and 5' CCATTTTCAAGGGGGATTGAAAATAGGG 3' and 5' CCC-GGATCCCGGTAACGGATAGACCTCCGGC 3' (BamHI site underlined) for the downstream flanking region. The fragments were amplified separately, and joined together by splicing by overlap extension (Horton et al., 1989
) into a single fragment that was digested with EcoRI and BamHI and ligated into pSJH7 (Hughes et al., 1991
). This plasmid contains the E. coli xanthine guanine phosphoribosyltransferase (Ecogpt) gene under the control of the VV 7.5K promoter. pNP7 was transfected into cells infected with VV strain WR and a mycophenolic acid-resistant intermediate virus isolate was plaque-purified on BS-C-1 cells in the presence of mycophenolic acid, xanthine and hypoxanthine (Falkner & Moss, 1988
). This was then plaque-purified on HeLa D980R cells in the presence of 6-thioguanine (Isaacs et al., 1990
; Kerr & Smith, 1991
) to resolve the intermediate virus into deletion mutant (v
B9R) and plaque-purified wild-type virus (vB9R). A revertant virus was constructed by reinsertion of the B9R gene at its natural locus. A 908 bp EcoRV fragment containing the entire B9R gene and flanking sequences was excised from plasmid pSTH1 and cloned into pSJH7 at the SmaI site forming pNP8. This plasmid was transfected into cells infected with v
B9R and a revertant virus was isolated by transient dominant selection (as above) and called vB9R-rev.
The genomic structure of the recombinant viruses was analysed by Southern blotting and PCR. Virus DNA was extracted from purified intracellular mature virus and was digested with HpaI, separated by electrophoresis on an agarose gel and blotted onto nitrocellulose membranes. The membranes were probed with a fluorescein-labelled 908 bp DNA fragment representing the 231 bp B9R ORF and 416 and 261 bp upstream and downstream, respectively. This probe detected a 360 bp fragment (representing the wild-type B9R allele) with WT and vB9R-rev, but a 270 bp fragment with v
B9R (data not shown). This probe also detected other DNA fragments, which flank the B9R locus, in all viruses. PCR analysis with oligonucleotide primers that flanked the B9R gene also showed the presence of the 90 bp deletion in v
B9R compared to WT and revertant viruses (data not shown). Furthermore, additional PCR analysis showed that the genes flanking B9R were unaltered. Collectively, these data indicated that the viruses had the predicted genome structures.
The isolation of the deletion mutant indicated that the B9R gene was non-essential for virus replication in cell culture. However, to investigate if the growth of the mutant virus was altered, the plaque size was compared with wild-type and revertant viruses in cell culture. The plaque size of v
B9R on RK13 cells was unaltered compared to control viruses (Fig. 2a
) and similar data were obtained for TK-143 and BS-C-1 cells (data not shown). Next, the yields of infectious virus were determined in growth curve analysis after low m.o.i. (0·01 p.f.u. per cell) (Fig. 2b
). These data showed that the yield of deletion mutant was unaltered compared to controls and similar data were obtained after high m.o.i. (10 p.f.u. per cell) (data not shown).
|
|
| Acknowledgments |
|---|
| Footnotes |
|---|
c Present address: National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20852, USA. ![]()
| References |
|---|
|
|
|---|
Alcamí, A. & Smith, G. L. (1992). A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection. Cell 71, 153-167.[Medline]
Alcamí, A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633-4639.[Abstract]
Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365-396.[Medline]
Barry, M., Hnatiuk, S., Mossman, K., Lee, S. F., Boshkov, L. & McFadden, G. (1997). The myxoma virus M-T4 gene encodes a novel RDEL-containing protein that is retained within the endoplasmic reticulum and is important for the productive infection of lymphocytes. Virology 239, 360-377.[Medline]
Falkner, F. G. & Moss, B. (1988). Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors. Journal of Virology 62, 1849-1854.
Falkner, F. G. & Moss, B. (1990). Transient dominant selection of recombinant vaccinia viruses. Journal of Virology 64, 3108-3111.
Gershon, P. D. & Black, D. N. (1989). A capripoxvirus psuedogene whose only intact homologs are in other poxvirus genomes. Virology 172, 350-354.[Medline]
Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247-266.[Medline]
Horton, R. M., Cai, Z. L., Ho, S. N. & Pease, L. R. (1989). Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8, 528-535.
Howard, S. T. (1991). Structural and functional analyses of the SalI G fragment of vaccinia virus. PhD thesis, University of Cambridge, UK.
Howard, S. T., Chan, Y. S. & Smith, G. L. (1991). Vaccinia virus homologues of the Shope fibroma virus inverted terminal repeat proteins and a discontinuous ORF related to the tumor necrosis factor receptor family. Virology 180, 633-647.[Medline]
Hughes, S. J., Johnston, L. H., de Carlos, A. & Smith, G. L. (1991). Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 20103-20109.
Isaacs, S. N., Kotwal, G. J. & Moss, B. (1990). Reverse guanine phosphoribosyltransferase selection of recombinant vaccinia viruses. Virology 178, 626-630.[Medline]
Kerr, S. M. & Smith, G. L. (1991). Vaccinia virus DNA ligase is nonessential for virus replication: recovery of plasmids from virus-infected cells. Virology 180, 625-632.[Medline]
Kettle, S., Alcami, A., Khanna, A., Ehret, R., Jassoy, C. & Smith, G. L. (1997). Vaccinia virus serpin B13R (SPI-2) inhibits interleukin-1
-converting enzyme and protects virus-infected cells from TNF- and Fas-mediated apoptosis, but does not prevent IL-1
-induced fever. Journal of General Virology 78, 677-685.[Abstract]
Massung, R. F., Liu, L. I., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201, 215-240.[Medline]
Moss, B. (1996). Poxviridae: the viruses and their replication. In Fields Virology , pp. 2637-2671. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Perkus, M. E., Goebel, S. J., Davis, S. W., Johnson, G. P., Limbach, K., Norton, E. K. & Paoletti, E. (1990). Vaccinia virus host range genes. Virology 179, 276-286.[Medline]
Price, N., Tscharke, D. C., Hollinshead, M. & Smith, G. L. (2000). Vaccinia virus gene B7R encodes an 18-kDa protein that is resident in the endoplasmic reticulum and affects virus virulence. Virology 267, 65-79.[Medline]
Shchelkunov, S. N., Blinov, V. M., Resenchuk, S. M., Totmenin, A. V., Olenina, L. V., Chirikova, G. B. & Sandakhchiev, L. S. (1994). Analysis of the nucleotide sequence of 53 kbp from the right terminus of the genome of variola virus strain India-1967. Virus Research 34, 207-236.[Medline]
Shchelkunov, S. N., Safronov, P. F., Totmenin, A. V., Petrov, N. A., Ryazankina, O. I., Gutorov, V. V. & Kotwal, G. J. (1998). The genomic sequence analysis of the left and right species-specific terminal region of a cowpox virus strain reveals unique sequences and a cluster of intact ORFs for immunomodulatory and host range proteins. Virology 243, 432-460.[Medline]
Smith, G. L., Chan, Y. S. & Howard, S. T. (1991). Nucleotide sequence of 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat. Journal of General Virology 72, 1349-1376.
Smith, G. L., Symons, J. A., Khanna, A., Vanderplasschen, A. & Alcamí, A. (1997). Vaccinia virus immune evasion. Immunological Reviews 159, 137-154.[Medline]
Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences, USA 76, 4350-4354.
Tscharke, D. C. & Smith, G. L. (1999). A model for vaccinia virus pathogenesis and immunity based on intradermal injection of mouse ear pinnae. Journal of General Virology 80, 2751-2755.
Upton, C., DeLange, A. M. & McFadden, G. (1987). Tumorigenic poxviruses: genomic organisation and DNA sequence of the telomeric region of the Shope fibroma virus genome. Virology 160, 20-30.[Medline]
Williamson, J. D., Reith, R. W., Jeffrey, L. J., Arrand, J. R. & Mackett, M. (1990). Biological characterization of recombinant vaccinia viruses in mice infected by the respiratory route. Journal of General Virology 71, 2761-2767.
Received 12 November 2001;
accepted 21 December 2001.
This article has been cited by other articles:
![]() |
E. R. Tulman, G. Delhon, C. L. Afonso, Z. Lu, L. Zsak, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock Genome of horsepox virus. J. Virol., September 1, 2006; 80(18): 9244 - 9258. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Pasquetto, H.-H. Bui, R. Giannino, F. Mirza, J. Sidney, C. Oseroff, D. C. Tscharke, K. Irvine, J. R. Bennink, B. Peters, et al. HLA-A*0201, HLA-A*1101, and HLA-B*0702 Transgenic Mice Recognize Numerous Poxvirus Determinants from a Wide Variety of Viral Gene Products J. Immunol., October 15, 2005; 175(8): 5504 - 5515. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Likos, S. A. Sammons, V. A. Olson, A. M. Frace, Y. Li, M. Olsen-Rasmussen, W. Davidson, R. Galloway, M. L. Khristova, M. G. Reynolds, et al. A tale of two clades: monkeypox viruses J. Gen. Virol., October 1, 2005; 86(10): 2661 - 2672. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Kulesh, R. O. Baker, B. M. Loveless, D. Norwood, S. H. Zwiers, E. Mucker, C. Hartmann, R. Herrera, D. Miller, D. Christensen, et al. Smallpox and pan-Orthopox Virus Detection by Real-Time 3'-Minor Groove Binder TaqMan Assays on the Roche LightCycler and the Cepheid Smart Cycler Platforms J. Clin. Microbiol., February 1, 2004; 42(2): 601 - 609. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Tscharke, P. C. Reading, and G. L. Smith Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes J. Gen. Virol., August 1, 2002; 83(8): 1977 - 1986. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |