J Gen Virol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by de Assis Filho, F. M.
Right arrow Articles by Deom, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Assis Filho, F. M.
Right arrow Articles by Deom, C. M.
Agricola
Right arrow Articles by de Assis Filho, F. M.
Right arrow Articles by Deom, C. M.
Journal of General Virology (2002), 83, 879-883.
© 2002 Society for General Microbiology


Plant

Symptom induction by Cowpea chlorotic mottle virus on Vigna unguiculata is determined by amino acid residue 151 in the coat protein

F. M. de Assis Filho1, O. R. Paguio1, J. L. Sherwood1 and C. M. Deom1

Department of Plant Pathology, The University of Georgia, Athens, GA 30602, USA1

Author for correspondence: Carl Deom. Fax +1 706 542 1262. e-mail deom{at}uga.edu


   Abstract
TOP
Abstract
Main text
References
 
The type strain of Cowpea chlorotic mottle virus (CCMV-T) produces a bright chlorosis in cowpea (Vigna unguiculata cv. California Blackeye). The attenuated variant (CCMV-M) induces mild green mottle symptoms that were previously mapped to RNA 3. Restriction fragment exchanges between RNA 3 cDNA clones of CCMV-T and CCMV-M that generate infectious transcripts and site-directed mutagenesis indicated that the codon encoding amino acid residue 151 of the coat protein determines the symptom phenotypes of CCMV-T and CCMV-M. Amino acid 151 is within an {alpha}-helical structure required for calcium ion binding and virus particle stability. No differences in virion stability or accumulation were detected between CCMV-T and CCMV-M. Mutational analysis suggested that the amino acid at position 151 and not the nucleotide sequence induce the symptom phenotype. Thus, it is likely that subtle influences by amino acid residue 151 in coat protein–host interactions result in chlorotic and mild green mottle symptoms.


   Main text
TOP
Abstract
Main text
References
 
Cowpea chlorotic mottle virus (CCMV), a member of the genus Bromovirus, contains a tripartite, single-strand RNA genome of positive polarity (Ahlquist, 1999Down ). The genome of the CCMV type strain (CCMV-T) has been cloned and sequenced (Allison et al., 1989Down ; Dzianott & Bujarski, 1991Down ). RNA 1 (3·2 kb) and RNA 2 (2·8 kb) encode proteins required for replication. The dicistronic RNA 3 (2·2 kb) contains open reading frames for the 3a movement protein (MP) and the coat protein (CP). The CP is translated from RNA 4, a subgenomic RNA transcribed from minus-strand RNA 3.

CCMV-T induces an extensive systemic chlorosis in cowpea [Vigna unguiculata (L.) Walp. subsp. unguiculata ‘California Blackeye’] (Kuhn, 1964Down ). Continuous propagation of CCMV-T in cowpea resulted in an attenuated variant, CCMV-M, which induces mild green mottle symptoms (Kuhn & Wyatt, 1979Down ). The specific infectivities of CCMV-T and CCMV-M were similar, as were their levels of replication in cowpea (Kuhn & Wyatt, 1979Down ). Using pseudorecombinants generated with isolated genomic RNAs from CCMV-T and CCMV-M, the determinant of systemic symptoms was mapped to RNA 3 (Kuhn & Wyatt, 1979Down ). In this report, we exchanged regions between biologically active cDNA clones of RNA 3 from CCMV-T and CCMV-M and localized the symptom determinant to the CP gene. Further analysis by site-directed mutagenesis identified CP amino acid residue 151 as a determinant in systemic disease symptoms in cowpea.

Cowpea plants (cv. California Blackeye) were used in all experiments. Purified viruses, in vitro transcripts from infectious viral cDNA clones or homogenates from infected cowpea leaves were inoculated onto primary leaves of 8-day-old cowpea seedlings. Virus- or mock-inoculated plants were maintained in either a growth chamber (14 h light/10 h dark cycle) at 27 °C or a greenhouse at a similar temperature. Inoculated plants were evaluated for infection by symptomology and serology (Western blot analysis or protein-A enzyme-linked immunosorbent assay, PAS-ELISA) (Edwards & Cooper, 1985Down ) using polyclonal antibodies specific for the CP of CCMV-T.

RT–PCR (Deom et al., 2000Down ) was used to synthesize and amplify cDNA representing full-length CCMV-M RNA 3 from purified CCMV-M RNA (Kuhn & Wyatt, 1979Down ). The 5'-primer was 5' CGGGGTACCTAATACGACTCACTATTG-TAATCTTTACCAAACAAC 3', which contains a T7 promoter (underlined) and a unique 5'-flanking KpnI site (italics). The 3'-primer was 5' TGCTCTAGATGGTCTCCTTAGAGATCACC 3', which is complementary to the 3' end of CCMV-T RNA 3 and contains a unique 5'-flanking XbaI site (italics). The primers were based on the published sequence of CCMV-T (Allison et al., 1989Down ). PCR products were ligated into the KpnI–XbaI sites of pUC19 (Life Technologies). Biologically active transcripts were synthesized from full-length cDNA clones of CCMV-T RNA 1, RNA 2 and RNA 3 (pCCT1, pCCT2 and pCCT3, respectively; S. Quan & C. Deom, unpublished results), CCMV-M RNA 3 (pCCM3) and from chimeric RNA 3 cDNA clones using a RiboMAX Large Scale RNA Production System-T7 (Promega).

In vitro transcripts from each of five CCMV-M RNA 3 cDNA clones were co-inoculated onto cowpea plants with in vitro transcripts from pCCT1 and pCCT2. All induced mild green mottle symptoms that were indistinguishable from those induced by CCMV-M. The clone pCCM3 was chosen for further study. The nucleotide sequence of pCCM3 was determined and compared to the sequence of pCCT3 (S. Quan & C. Deom, unpublished results). Four nucleotide differences between pCCT3 and pCCM3 were identified (Table 1Down). In addition, there was a deletion of seven A residues from the polyadenylation [poly(A)] tract in the intergenetic region of CCMV-M RNA 3 between the MP and CP genes. With the seven deleted A-residues in CCMV-M, the nucleotide at position 1813 in CCMV-T is equivalent to position 1806 in CCMV-M.


View this table:
[in this window]
[in a new window]
 
Table 1. Nucleotide differences in RNA 3 of CCMV type (T) and mild (M) strains and subsequent predicted amino acid substitutions

 
To map the mild symptom determinant in CCMV-M RNA 3, chimeric cDNA clones were generated between cDNA clones of CCMV-T RNA 3 and CCMV-M RNA 3 (Fig. 1Down). RNA transcripts derived from each chimeric cDNA clone were inoculated onto cowpea together with transcripts from pCCT1 and pCCT2. All chimeric RNA 3 cDNA clones that contained the majority of the CP gene and 3' untranslated region of CCMV-M RNA 3 (HpaI–XbaI region) induced mild green mottle symptoms on cowpea that were indistinguishable from those induced by CCMV-M (Fig. 1Down). Similarly, all chimeric RNA 3 cDNA clones that contained the majority of the CP gene and 3' untranslated region of CCMV-T RNA 3 induced severe symptoms on cowpea that were indistinguishable from those induced by CCMV-T (Fig. 1Down). RT–PCR products representing chimeric RNA 3 cDNA clones were generated from total RNA extracted from infected plants (Deom et al., 2000Down ) and the genotype of each chimeric RNA 3 cDNA clone was confirmed by sequencing.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Schematic of chimeric CCMV RNA 3 cDNA clones and symptoms induced by in vitro transcripts from each clone. Five unique restriction sites (B, BsiWI; H, HpaI; K, KpnI; M, MfeI; X, XbaI) were used for constructing chimeric RNA 3 cDNA clones. Four to six cowpea seedlings were co-inoculated with in vitro transcripts from pCCT1, pCCT2 and pCCT3; pCCT1, pCCT2 and pCCM3; or pCCT1, pCCT2 and the chimeric RNA 3 cDNA clones. Each experiment was replicated three to five times with independently synthesized in vitro transcripts. Plasmid pCCT3 contains a full-length cDNA of CCMV-T RNA 3. Plasmid pCCM3 contains a full-length cDNA of CCMV-M RNA 3. MP, movement protein gene; CP, coat protein gene.

 
The only difference between RNA 3 cDNA clones of CCMV-T and CCMV-M in the HpaI–XbaI region is the C1813->U1806 substitution (Ala151->Val151) in the CP gene. When U1806 in CCMV-M RNA 3 was mutated to C1806 (pM151VA, Table 2Down), transcripts from pCCT1, pCCT2 and pM151VA elicited symptoms on cowpea indistinguishable from those induced by CCMV-T. In contrast, when C1813 in CCMV-T RNA 3 was mutated to U1813 (pT151AV, Table 2Down), transcripts from pCCT1, pCCT2 and pT151AV induced symptoms on cowpea indistinguishable from those induced by CCMV-M. Therefore, the nucleotide at position 1813 in CCMV-T (the equivalent position is 1806 in CCMV-M) or the resulting amino acid substitution is important in determining symptoms of CCMV-T and CCMV-M on cowpea.


View this table:
[in this window]
[in a new window]
 
Table 2. Analysis of symptom phenotypes of CCMV CP mutants

 
To determine if the phenotype is induced by the nucleotide sequence or the subsequent amino acid substitution in the coat protein, additional mutations were made in the codon (nucleotide 1812–1814) of amino acid residue 151 in RNA 3 of CCMV-T (Table 2Up). While the substitution of C1813->U1813 in RNA 3 of CCMV-T (pT151AV) resulted in mild green mottle symptoms identical to those induced by CCMV-M, the substitution of C1813->G1813 (pT151AG) and C1813->A1813 (pT151AD) resulted in severe symptoms identical to those induced by CCMV-T. However, when multiple substitutions were introduced into the codon (GCC1814->AAG1814), transcripts from the mutant pT151AK elicited mild green mottle symptoms. One of the substitutions in pT151AK was C1813->A1813, which alone (pT151AD) elicited severe symptoms. Taken together, the results suggest that the amino acid residue at position 151 is the important factor in determining the symptom phenotype, not the nucleotide sequence.

The structure of native CCMV has been determined by X-ray crystallography to a resolution of 3·2 (Speir et al., 1995Down ). Amino acid residue 151 lies within the {alpha}GH helix, one of two helices (the second is {alpha}GDII) that make up the putative calcium-binding site that helps stabilize intercapsomere interactions along the quasi three-fold axis of the icosahedral shell. Amino acids within the {alpha}GH helix that coordinate calcium binding are Glu-148, Gln-149 and Asp-153. Not surprisingly, amino acid modifications at residue 151 might be expected to have an effect on calcium binding and, therefore, virion stability. The degree of stability between capsomeres mediated by calcium ions might play a role in symptom determination.

To determine if there is a correlation between symptoms induced by CCMV-T and CCMV-M and virus stability, a series of experiments was performed to evaluate particle stability in vitro under conditions that induce either a conformational change in virion structure (swelling) or virion dissociation. At pH<6·0 and low ionic strength (i<0·2), CCMV particles are contracted and sediment at 88S, while at pH>7·0 and low ionic strength (i<0·2) the peak of sedimentation changes to 78S as a result of swelling (Bancroft et al., 1967Down ; Speir et al., 1995Down ). Swelling is thought to result from the removal of Ca2+ from the quasi three-fold axis of the virion (Speir et al., 1995Down ). Purified CCMV-T or CCMV-M was incubated in 0·1 M phosphate buffer at pH 5·0 or pH 7·5. Virus was centrifuged through 10–40% linear sucrose gradients for 4 h at 25000 g (Fox et al., 1996Down ) and gradient profiles were monitored by absorbance at 254 nm. CCMV-T and CCMV-M were equally susceptible to swelling at pH 7·5, as indicated by identical changes in the gradient profiles of each virus, when incubation times prior to centrifugation were as short as 1 min (data not shown). Using a second approach, agarose gel electrophoresis, under conditions that result in pH-induced conformational changes (Heaton, 1992Down ), CCMV-T and CCMV-M were found to be equally susceptible to swelling at pH 7·5, based on the slower migration pattern of each virus relative to contracted virus particles (data not shown). Kuhn & Wyatt (1979)Down previously reported that CCMV-M could swell more easily than CCMV-T in low molarity phosphate buffer (0·01 M) at pH 7·5, but we detected no difference under the same conditions.

The stability of CCMV-T and CCMV-M was also compared on sucrose gradients under conditions that either induce or do not induce particle dissociation (Fox et al., 1996Down ). Virions dissociate into genomic RNA and CP at pH>7·4 and high ionic strength (i>=1·0). Both CCMV-T and CCMV-M were stable under low salt (0·1 M) and low pH (pH 5·0) conditions, while both viruses dissociated under high salt (1·0 M) and high pH (pH 7·5) conditions. Taken together, the conformational and dissociation data indicate that there is no correlation between virion stability and symptoms. This conclusion is supported by research on mutants of the CP of Turnip crinkle virus, where there was no correlation detected between particle stability and symptom phenotype (Lin & Heaton, 1999Down ).

Although residue 151 is in the {alpha}GH helix, no differences were detected in the stability of CCMV-T and CCMV-M under conditions that cause virus swelling or dissociation in vitro. We believe this indicates that Ca2+ binding is similar in CCMV-T and CCMV-M and this conclusion is in agreement with virus accumulation data. At 10 days post-inoculation (p.i.), there was no significant difference in the levels of accumulation of CCMV-T and CCMV-M in inoculated or systemic leaf tissue as determined by virus purification or ELISA. Interestingly, CCMV-M was previously shown to be as fit as CCMV-T with a strong tendency for CCMV-M to become dominant when co-inoculated with CCMV-T (Kuhn & Wyatt, 1979Down ). Furthermore, no significant difference was detected between the levels of viruses having substitutions at position 151 (Table 2Up) and the levels of CCMV-T and CCMV-M at 10 days p.i. as determined by ELISA.

The role of viral CP in symptom development has been demonstrated at the molecular level for several viruses (Banerjee et al., 1995Down ; Culver & Dawson, 1989Down ; Dawson et al., 1988Down ; Heaton et al., 1991Down ; Knorr & Dawson, 1988Down ; Lin & Heaton, 1999Down ; Neelman et al., 1991Down ; Shintaku & Palukaitis, 1992Down ). Significant structural changes to the {alpha}GH helix would be expected to disrupt the putative calcium-binding site that helps stabilize intercapsomere interactions. However, the similarity in stability of CCMV-T and CCMV-M and the similar accumulation levels of CCMV-T, CCMV-M and the viruses with mutations at residue 151 suggests that subtle influences by amino acid residues at position 151 likely play a role in the CP–host interactions that determine the respective symptom phenotypes.

Cowpea likely plays a host specific role in symptom induction by CCMV-T and CCMV-M, since symptoms were similar for CCMV-T and CCMV-M on other known hosts of CCMV-T, and no new hosts were identified for CCMV-M (Kuhn & Wyatt, 1979Down ). This would not be surprising since CCMV-M was selected by continuous passage of CCMV-T in cowpea (Kuhn & Wyatt, 1979Down ).


   Acknowledgments
 
This work was supported by state Hatch funds allocated to the Georgia Agricultural Experiment Stations. F.M.A.F. received a scholarship from Conselho Nacional de Desevolvimento Cientifico e Tecnologico, CNPq, Brazil. The authors thank Katherine Stevenson for help with statistical analysis and Jim Culver, R. A. Naidu and Herman Scholthof for critical review of the manuscript.


   Footnotes
 
The GenBank accession number for the sequence of CCMV-M RNA 3 reported in this paper is AF428096.


   References
TOP
Abstract
Main text
References
 
Ahlquist, P. (1999). Bromoviruses (Bromoviridae). In Encyclopedia of Virology , pp. 198-204. Edited by A. Granoff & R. G. Webster. San Diego:Academic Press.

Allison, R. F., Janda, M. & Ahlquist, P. (1989). Sequence of cowpea chlorotic mottle virus RNAs 2 and 3 and evidence of a recombinant event during bromovirus evolution. Virology 172, 321-330.[Medline]

Bancroft, J. B., Hills, G. J. & Markham, R. (1967). A study of the self-assembly process in a small spherical virus: formation of organized structures from protein subunits in vitro. Virology 31, 354-379.[Medline]

Banerjee, N., Wang, J.-Y. & Zaitlin, M. (1995). A single nucleotide change in the coat protein gene of tobacco mosaic virus is involved in the induction of severe chlorosis. Virology 207, 234-239.[Medline]

Culver, J. N. & Dawson, W. O. (1989). Point mutations in the coat protein gene of the tobacco mosaic virus induce hypersensitivity in Nicotiana sylvestris. Molecular Plant–Microbe Interactions 2, 209-213.

Dawson, W. O., Bubrick, P. & Grantham, G. L. (1988). Modifications of the tobacco mosaic virus coat protein gene affecting replication, movement and symptomatology. Phytopathology 78, 783-789.

Deom, C. M., Naidu, R. A., Chiyembekeza, A. J., Ntare, B. R. & Subrahmanyam, P. (2000). Sequence diversity within the three agents of groundnut rosette disease. Phytopathology 90, 214-219.[Medline]

Dzianott, A. M. & Bujarski, J. J. (1991). The nucleotide sequence and genome organization of the RNA1 segment in two bromoviruses: broad bean mottle virus and cowpea chlorotic mottle virus. Virology 185, 553-562.[Medline]

Edwards, M. L. & Cooper, J. I. (1985). Plant virus detection using a new form of indirect ELISA. Journal of Virological Methods 11, 309-319.[Medline]

Fox, J. M., Zhao, X., Speir, J. A. & Young, M. (1996). Analysis of a salt stable mutant of cowpea chlorotic mottle virus. Virology 222, 115-122.[Medline]

Heaton, L. A. (1992). Use of agarose gel electrophoresis to monitor conformational changes of some small, spherical plant viruses. Phytopathology 82, 803-807.

Heaton, L. A., Lee, T. C., Wei, N. & Morris, T. J. (1991). Point mutations in the turnip crinkle virus capsid protein affect the symptoms expressed by Nicotiana benthamiana. Virology 183, 143-150.[Medline]

Knorr, D. A. & Dawson, W. O. (1988). A point mutation in the tobacco mosaic virus capsid protein gene induces hypersensitivity in Nicotiana sylvestris. Proceedings of the National Academy of Sciences, USA 85, 170-174.[Abstract/Free Full Text]

Kuhn, C. W. (1964). Purification, serology, and properties of a new cowpea virus. Phytopathology 54, 853-857.

Kuhn, C. W. & Wyatt, S. D. (1979). A variant of cowpea chlorotic mottle virus obtained by passage through beans. Phytopathology 69, 621-624.

Lin, B. & Heaton, L. A. (1999). Mutational analysis of the putative calcium binding site and hinge of the turnip crinkle virus coat protein. Virology 259, 34-42.[Medline]

Neelman, L., Van Der Kuyl, A. C. & Bol, J. F. (1991). Role of alfalfa mosaic virus coat protein gene in symptom formation. Virology 181, 687-693.[Medline]

Shintaku, M. H. & Palukaitis, P. (1992). A single amino acid substitution in the coat protein of Cucumber mosaic virus induces chlorosis in tobacco. Plant Cell 4, 751-757.[Abstract/Free Full Text]

Speir, J. A., Munshi, S., Wang, G., Baker, T. S. & Johnson, J. E. (1995). Structures of the native and swollen forms of cowpea chlorotic mottle virus determined by X-ray crystallography and cryo-electron microscopy. Structure 3, 63-78.[Medline]

Received 15 October 2001; accepted 18 December 2001.


This article has been cited by other articles:


Home page
J. Gen. Virol.Home page
H. Hirata, X. Lu, Y. Yamaji, S. Kagiwada, M. Ugaki, and S. Namba
A single silent substitution in the genome of Apple stem grooving virus causes symptom attenuation
J. Gen. Virol., September 1, 2003; 84(9): 2579 - 2583.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by de Assis Filho, F. M.
Right arrow Articles by Deom, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Assis Filho, F. M.
Right arrow Articles by Deom, C. M.
Agricola
Right arrow Articles by de Assis Filho, F. M.
Right arrow Articles by Deom, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS