|
|
||||||||
Animal: DNA Viruses |
Department of Infectious Diseases and Microbiology, Graduate School of Public Health, 130 Desoto Street, Pittsburgh, PA 15213, USA1
Author for correspondence: David Rowe. Fax +1 412 383 7490. e-mail rowe1{at}pitt.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The LMP2 gene encodes two messages of 2·0 and 1·7 kb in length, which are produced by alternative promoter usage (Laux et al., 1988
; Sample et al., 1989
). The longer message encodes LMP2A, while the shorter message is initiated from a promoter, approximately 5 kb downstream, that is bidirectional and responsible for LMP1 expression in the leftward direction and LMP2B expression in the rightward direction (Laux et al., 1988
; Rowe, 1999
). The mRNAs share eight 3' exons but have unique 5' exons. Initial transcripts cross the fused terminal repeat region of the virus episome with the promoters and 5' exons located near the right end of the genome and the common exons located at the left end of the genome (Laux et al., 1988
; Sample et al., 1989
). The eight common exons encode 12 membrane-spanning segments connected by short loops and ending with a 27 aa cytoplasmic C-terminal domain. (Kieff, 1996b
; Longnecker, 2000
). The difference between the two isoforms is that LMP2A has an N-terminal 119 aa cytoplasmic-signalling domain that is not present in LMP2B.
The restriction of viral gene expression to LMP2A in situ suggests that the protein may have a key role in either the establishment or the maintenance of latency and/or the reactivation of productive infection from the latent state. The focus of most studies has been on the LMP2A product. To date, there has not been a comprehensive phenotypic analysis of the LMP2B isoform. This is partly because of the hydrophobic character of LMP2 proteins. The rabbit polyclonal sera and rat monoclonal antibodies that have been produced have specificities for epitopes in the cytoplasmic domain (Fruehling et al., 1996
; Longnecker et al., 1991
; Rowe et al., 1990
). No sera have been made that unequivocally detect LMP2B. Although mRNAs for both proteins are expressed in immortalized B cells, genetic analyses of the LMP2 gene have shown that neither product is required for immortalization of B cells by the virus. Three different virus recombinants (a stop codon in place of residue 19 in the LMP2A sequence allowing LMP2B expression only, a stop codon at residue 260, truncating both LMP2 proteins after the fifth membrane-spanning segment, and a deletion between residues 120 and 260 that allows only LMP2A cytoplasmic domain expression) gave rise to essentially normal LCLs (Longnecker et al., 1992
, 1993
; Yates, 1993). Recent studies with pure LMP2A-knockout viruses as inocula for immortalization of primary B cells revealed no discernable defect in their ability to generate immortalized cell lines (Konishi, 2001
). Virus mutants that interrupt LMP2A exon1 and leave LMP2B intact and, presumably, expressed, indicate that LMP2B possesses no independent role in producing the B cell receptor signalling blockade phenotype of the LMP2 gene.
While the significance of LMP2B and its role in pathogenesis remain unclear, homology studies comparing the LMP2 gene of EBV with that of rhesus and baboon lymphocryptoviruses have revealed that the ability to make the LMP2B transcript is conserved (Rivailler et al., 1999
). This implies that there is an as yet unrecognized role for LMP2B in the EBV life cycle. In this report, we describe the initial characterization of the localization of the LMP2B protein in transiently transfected cells. LMP2B cDNA expression vectors containing N- or C-terminal enhanced green fluorescent protein (EGFP) or DsRed protein fusions were constructed to allow detection of LMP2B protein expression in living cells. Conventional and confocal fluorescence microscopy revealed that LMP2B localized to perinuclear regions in transiently transfected cells and co-localized with LMP2A.
| Methods |
|---|
|
|
|---|
Cell lines and cell culture.
Construction of recombinant LMP2 plasmids.
DNA fragments encoding full-length LMP2A or LMP2B were amplified by PCR from B958 cDNA using the following primers: Exon1 (5' CCCCTCGAGCTCAAGCTTACTACCAT GGGGTCCCTAGAA 3') or Exon2 (5' CCCCTCGAGCTCAAGCTTACTAGTATGAA TCCAGTATGCCTG 3') with LMP2 C-term (5' GCGCGGTACCACAGTGTTGCGATATGG 3'), respectively. Both 5' primers contain an Xho1 restriction site (underlined) and the 3' primer contains a Kpn1 restriction site. PCR products were digested with Xho1/Kpn1 and ligated into pN1EGFP, pC1EGFP or pN1DsRed mammalian expression vectors (Clontech). FLAG epitope-tagged LMP2-expressing vectors were constructed by a multistep cloning approach. Oligonucleotides encoding the FLAG epitope were used to incorporate an iterated 3x FLAG into the open reading frame (ORF) of LMP2. All constructs were sequenced to ensure the correct alignment of the LMP2 ORFs after assembly.
Transfections.
All DNA used for transfection were banded on CsCl2 equilibrium density gradients. For B cell lines, 5x106 cells were washed once in PBS and resuspended at room temperature in 0·4 ml of serum-free, phenol red-free RPMI 1640 containing 20 µg pN1EGFPLMP2A or pN1DsRedLMP2B. Cells were transferred to a sterile electroporation cuvette (0·4 cm electrode gap) (Invitrogen) and pulsed twice; the multiporator (Eppendorf) was set at 400 V for 100 µs. Cells were then settled for 10 min at 37 °C and diluted into 10 ml of complete phenol red-free RPMI 1640. For 293T cells, confluent T225 flasks were trypsinized with 10x trypsin (Gibco) and washed. The cells were then adjusted to a concentration of 1x107 cells/ml in serum-free, phenol red-free DMEM. Approximately 4x106 cells were then pulsed twice in a 0·4 cm cuvette containing 20 µg of plasmid in a multiporator (Eppendorf) set at 280 V for 100 µs. Cells were settled for 10 min at 37 °C and approximately 0·1x106 cells were seeded into chamber slides.
Antibodies and immunofluorescence.
Anti-human IgM antibodies for immunofluorescence were purchased from Biosource International. Anti-human CD19 (BD Biosciences), LAMP-1, EEA-1,
-adaptin, PDI (Transduction Laboratories) and BIP (StressGen Biotechnologies) antibodies were also purchased. The rat monoclonal antibody anti-human LMP2A (14B7) was kindly provided by R. Longnecker (NorthWestern University, Chicago, USA ). Alexa-fluor 488 and 594 secondary antibodies were purchased from Molecular Probes. Mounting media containing DAPI was purchased from Vector Laboratories. Immunofluorescence was performed by washing transiently transfected B cells twice in PBS. Cells were then fixed to microscope slides using a cytospin (Shanndon) set at 500 r.p.m. for 5 min. Slides were dried for 1 h at room temperature in the dark and fixed in freshly prepared 24% paraformaldehyde, pH 7·4, for 15 min at room temperature. Samples were blocked for 1 h in blocking buffer containing 0·5% BSA, 0·1% NaN3 and 0·1% saponin. Primary antibodies were incubated at varying dilutions in blocking buffer for 30 min at 4 °C. Secondary antibodies were diluted in blocking buffer (1:2000 dilution) for 30 min at 4 °C. Slides were washed and mounted with Vectashield-mounting medium containing DAPI (Vector Laboratories). For cell surface immunostaining, live cells were chilled on ice for 10 min and incubated with anti-FLAG antibody (Sigma) for 30 min at 4 °C. Cells were washed in cold blocking buffer, fixed in 2% phosphonoformic acid and incubated with Alexa-fluor secondary antibodies (Molecular Probes).
Microscopy.
Slides were examined with a Nikon E600 equipped with a SPOTII CCD digital camera. Digital images were composed using METAMORPH software (Universal Imaging). Confocal digital images were taken using BioRad LASERSHARP software coupled with a BioRad RadiancePLUS confocal microscope system. Integrated average pixel area and intensity values for individual cells were measured using METAMORPH software.
| Results |
|---|
|
|
|---|
Constructs with DsRed or EGFP fused to the C terminus of LMP2B (LMP2BDsRed and LMP2BEGFP) or the base vectors (pDsRed and pN1EGFP) were transiently transfected into BJAB (lymphocyte) and 293T (epithelial) cells (Fig. 1
). Protein expression was examined 12, 24, 48 and 96 h post-transfection. Cells were viewed both live and after fixation in 2% paraformaldehyde. At 24 h post-transfection, transient expression from the control vectors cells was detected as a uniform bright red or green fluorescence that filled the entire volume of the cell and whose appearance was unaltered by fixation (Fig. 1
). Only the DsRed fluorescence is shown as the localization of EGFP fusions was identical. LMP2BDsRed-expressing cells, both live and fixed, displayed from one to several distinct patches of fluorescence, which consistently appear to be located proximal to the nucleus. Electroporation typically yielded 1015% positive expressing B cells and 6080% positive expressing 293T cells after 72 h of incubation. Fluorescence was detectable as early as 12 h post-transfection and persisted for more than 2 weeks without selection. At the earliest time-points, the level of LMP2B fluorescence was weaker in intensity but localized to patches in the intracellular perinuclear region. Protein localization was not altered, irrespective of the time post-transfection that the observations were made, the level of LMP2BDsRed fluorescence in a cell or the type of cell transfected. The expression vectors contain a G418 resistance selectable marker but cells lines expressing LMP2BDsRed have been difficult to establish and maintain. Resistant cells lines have a tendency to loose LMP2BDsRed fluorescence and need to be flow-sorted to retain a high proportion of positive cells.
|
|
|
LMP2B co-localization with LMP2A
Because of the high degree of structural relatedness between the LMP2A and LMP2B isoforms, it was anticipated that the molecules should localize to the same cellular compartment. However, the perinuclear localization of LMP2B contrasted with the expected plasma membrane localization of LMP2A. We therefore conducted an analysis of LMP2A membrane localization and assessed whether the two proteins had the same or different fluorescence patterns when co-expressed in our fluorescent molecule-tagging system. For these experiments, LMP2A bore a C-terminal EGFP tag and LMP2B bore a C-terminal DsRed tag. This allowed us to visualize the localization of the two proteins together in live cells in the absence of any potential fixation artefacts (Fig. 4A
). Only the results for BJAB cells are shown as they were identical to the results for 293T cells. Co-transfections yielded a mixture of cells that were untransfected, singly transfected or doubly transfected on the same slide preparation. Localizations of LMP2A and LMP2B were not altered by the presence or absence of the other isoform or by paraformaldehyde fixation (Fig. 4B
). Both proteins displayed a perinuclear localization in singly transfected cells and co-localized to the same patches when they were co-expressed. Analysis of the area/intensity-averaged overlap indicated that there was >99% overlap of the two proteins in the transfected cells.
|
A probe for LMP2A protein at the surface of live cells with loop1 epitope tags
There has never been a direct observation of LMP2A protein at the surface of live cells because no appropriate reagent for detecting the molecules from outside the cell has been produced. We constructed LMP2A loop1-tagged protein expression vectors for this purpose. After transfection into BJAB or 293T cells, unpermeabilized cells were probed with anti-FLAG antibody. No immunofluorescence was detected (Fig. 5A
). Permeabilized cells from the same transfections gave readily detectable FLAG fluorescence signals. A survey of 293T and BJAB cells transfected with a loop1 3x FLAG-tagged LMP2AEGFP fusion to easily identify LMP2A-expressing cells was conducted but no evidence for surface staining for LMP2A was detected (data not shown).
|
Subcellular localization of LMP2BDsRed
Immunofluorescence microscopy with a panel of antibodies specific for markers of intracellular compartments was used to investigate the localization of LMP2BDsRed in transiently transfected BJAB cells. At 24 h post-transfection, cells were probed for CD19 (surface marker), LAMP-1 (lysosomes), EEA-1 (early endosomes),
-adaptin (trans-Golgi network) and BIP-1 (endoplasmic reticulum) (Fig. 6
). The greatest overlap in fluorescence was between LMP2BDsRed and
-adaptin (a component of the trans-Golgi network). Analysis of the area/intensity-averaged overlap indicated that >80% of LMP2B was associated with
-adaptin. However, there were also significant amounts of
-adaptin that were not associated with LMP2B. Partial co-localization was observed between LMP2BDsRed and BIP-1 (the endoplasmic reticulum resident protein). There was also a partial overlap between LMP2B and the CD19 surface marker. There was no appreciable overlapping of fluorescence between LMP2B and the markers for endosomes or lysosomes. The pattern of immunofluorescence for all of the cellular compartment markers in LMP2B-expressing cells was essentially indistinguishable from the untransfected cells on the same slide, indicating that LMP2B expression did not appear to significantly alter the functioning of membrane trafficking within the transfected cells.
|
-adaptin. Analysis of the area/intensity-averaged overlap indicated that >40% of LMP2A was associated with
-adaptin. There was also significant localization with EEA-1, the endosome marker. Analysis of the area/intensity-averaged overlap indicated that >60% of LMP2A was associated with EEA-1. There was no significant co-localization with either the BIP-1 endoplasmic reticulum marker, the CD19 plasma membrane marker or the lysosome marker.
|
-adaptin (Fig. 8C
-adaptin occurs in BJAB cells transiently expressing LMP2BDsRed. Confocal analysis of B958CR cells probed for both LMP2A and
-adaptin revealed a similar pattern of co-localization (data not shown).
|
| Discussion |
|---|
|
|
|---|
Previous studies showing LMP2A immunofluorescence have described the presence of aggregated proteins and implicated the plasma membrane as a significant site of localization (Longnecker et al., 1991
; Longnecker & Kieff, 1990
). Those studies showed no live cell localizations, co-localization with surface markers or detection of the protein in unpermeabilized cells. Nevertheless, differences in the localization of LMP2A and LMP2B would have important implications for the functional role of LMP2B. Our analysis of transiently co-expressed LMP2A and LMP2B proteins showed that there was a high degree of co-localization observed when recombinant LMP2A and LMP2B plasmids were co-transfected into BJAB or 293T cells and viewed simultaneously by live cell fluorescence microscopy. When LMP2BDsRed was transiently transfected into B958CR cells, more than 95% of LMP2B co-localized with the endogenously expressed LMP2A. In these cells, at least one quarter of endogenous LMP2A was not co-localized with LMP2B. This could reflect a real difference in the localization of LMP2A. Since these cells had pre-existing LMP2A proteins at the time that they were transfected, it is possible that only LMP2A synthesized de novo in the post-transfection period was co-localizing with LMP2B. It is possible that only when the two proteins are being made together is LMP2B able to restrict the trafficking of LMP2A. The very high degree of co-localization seen in co-transfection experiments is consistent with this scenario.
LMP2A in the absence of LMP2B might be able to traffic within the endomembrane system and work its way to the surface. The notable difference in LMP2A and LMP2B localization was the significant co-localization of endogenous LMP2A with EEA-1, an endosomal marker in B958CR cells. A similar association was not detected in any LMP2B-transfected cells. This is consistent with a less restricted movement for LMP2A in the absence of LMP2B and leaves open the possibility that some of these molecules are surface bound. However, experiments with the loop1-tagged LMP2A and LMP2B proteins suggest that less than 1% of the detectable LMP2 proteins are on the surface. The appearance of the LMP2A truncation mutants spread across the surface of the transfected cells indicated that the loop1 epitopes are readily detectable when they are in plasma membranes and that an intracellular retention phenotype is associated with sequences in the LMP2 transmembrane domain.
Markers for cellular membrane compartments were used to refine the intracellular location of LMP2B. The most significant co-localization was detected with a protein marker for the trans-Golgi network (
-adaptin, a scaffolding component involved in vesicle budding from the Golgi endomembrane system). Both epi-fluorescence and confocal sectioning showed the same high degree of localization. There was a detectable, albeit much lower, level of co-localization with BIP-1. These fluorescence results suggest that we might be detecting the synthesis of LMP2B on ER membranes and a very slow movement of LMP2B to and through the Golgi relative to LMP2A, where there is less than 1% BIP-1 association detected. LMP2B then appears to be deposited into an intracellular perinuclear vesicular membrane compartment. Evidence for an association of LMP2B with endosomes or lysosomes was not obtained. About 10% of the LMP2B fluorescence was associated with CD19 in an apparent contradiction to the finding that there was no surface fluorescence from loop1 epitope-tagged LMP2B. Confocal sectioning revealed that the CD19 fluorescence associated with LMP2B was intracellular and perinuclear. LMP2A did not show a similar CD19 co-localization. In contrast to LMP2B, more than half of the LMP2A fluorescence was found associated with the endosomal membrane compartment. Further studies are required to determine if this association represents an important difference in the trafficking of LMP2A and LMP2B.
Our studies show that when co-expressed with LMP2A, LMP2B co-localizes and probably associates with LMP2A in the same compartment within the cell. Neither protein seemed to redirect or dramatically influence the localization of the other molecule. In addition, neither protein showed a pattern of fluorescence consistent with a significant plasma membrane localization or surface presence. Our fluorescence microscopy studies included more controls, more cell lines and more LMP2 constructs than earlier reports. We have performed confocal microscopy studies clearly showing the absence of recombinant LMP2B and LMP2A localization to the surface and a lack of co-localization on the surface with a cell surface marker, CD19. A recent report by C. W. Dawson that used different cells and tagged LMP2 proteins reached similar conclusions (Dawson, 2001
). In the main finding of their study of epithelial cells, LMP2A and LMP2B were described as intracellular and perinuclear. The conclusions about the sub-cellular compartment localization were not identical to ours but different compartment markers were employed so direct comparison is problematic. In our study, both lymphocytes and epithelial cells are presented and the results from the two cell types are consistent. Taken together, the evidence from the two studies indicates that the LMP2 proteins rarely visit the plasma membrane and that sequences within the transmembrane domain retain the molecules within intracellular membrane compartments. Intracellular localization is compatible with previous genetic and biochemical studies of LMP2 function. It is now necessary to determine what factors affect the localization of LMP2 proteins and whether alterations in the environment of a virus-infected cell change the localization. It will also be important to determine the extent to which LMP2 protein localization affects the localization and functioning of receptors and signal transducers. An intracellular destination for a latency-associated membrane protein offers intriguing possibilities for the control of the latent state and for the triggering mechanism for reactivation of the lytic cycle.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Babcock, G. J., Decker, L. L., Freeman, R. B. & Thorley-Lawson, D. A. (1999). EpsteinBarr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients. Journal of Experimental Medicine 190, 567-576.
Babcock, G. J., Hochberg, D. & Thorley-Lawson, D. A. (2000). The expression pattern of EpsteinBarr virus latent genes in vivo is dependent upon the differentiation stage of the infected B cell. Immunity 13, 497-506.[Medline]
Cohen, J. I. (1999). The biology of EpsteinBarr virus: lessons learned from the virus and the host. Current Opinion in Immunology 11, 365-370.[Medline]
Dawson, C. W., George, J. H., Blake, S. M. S., Longnecker, R. & Young, L. S. (2001). The EpsteinBarr virus encoded latent membrane protein 2A augments signaling from latent membrane protein 1. Virology 289, 192-207.[Medline]
Fruehling, S., Lee, S. K., Herrold, R., Frech, B., Laux, G., Kremmer, E., Grasser, F. A. & Longnecker, R. (1996). Identification of latent membrane protein 2A (LMP2A) domains essential for the LMP2A dominant-negative effect on B-lymphocyte surface immunoglobin signal transduction. Journal of Virology 70, 6216-6226.[Abstract]
Khan, G., Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1996). Is EBV persistence in vivo a model for B cell homeostasis? Immunity 5, 173-179.[Medline]
Kieff, E. (1996a). EpsteinBarr virus and its replication. In Fundamental Virology , pp. 1109-1162. Edited by D. M. Knipe, B. N. Fields & P. M. Howley. Philadelphia:LippincottRaven.
Kieff, E. (1996b). Herpesviridae. In Fields Virology , pp. 2343-2396. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Kim, O. J. & Yates, J. L. (1993). Mutants of EpsteinBarr virus with a selective marker disrupting the TP gene transform B cells and replicate normally in culture. Journal of Virology 67, 7634-7640.
Konishi, K. M., Maruo, S., Kato, H. & Takada, K. (2001). Role of EpsteinBarr virus-encoded latent membrane protein 2A on virus-induced immortalization and virus activation. Journal of General Virology 82, 1451-1456.
Laux, G., Perricaudet, M. & Farrell, P. J. (1988). A spliced EpsteinBarr virus gene expressed in immortalized lymphocytes is created by circularization of the linear viral genome. EMBO Journal 7, 769-774.[Medline]
Longnecker, R. (2000). EpsteinBarr virus latency: LMP2, a regulator or means for EpsteinBarr virus persistence? Advances in Cancer Research 79, 175-200.[Medline]
Longnecker, R. & Kieff, E. (1990). A second EpsteinBarr virus membrane protein (LMP2) is expressed in latent infection and colocalizes with LMP1. Journal of Virology 64, 2319-2326.
Longnecker, R., Druker, B., Roberts, T. M. & Kieff, E. (1991). An EpsteinBarr virus protein associated with cell growth transformation interacts with a tyrosine kinase. Journal of Virology 65, 3681-3692.
Longnecker, R., Miller, C. L., Miao, X. Q., Marchini, A. & Kieff, E. (1992). The only domain which distinguishes EpsteinBarr virus latent membrane protein 2A (LMP2A) from LMP2B is dispensable for lymphocyte infection and growth transformation in vitro; LMP2A is therefore nonessential. Journal of Virology 66, 6461-6469.
Longnecker, R., Miller, C. L., Miao, X. Q., Tomkinson, B. & Kieff, E. (1993). The last seven transmembrane and carboxy-terminal cytoplasmic domains of EpsteinBarr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. Journal of Virology 67, 2006-2013.
Miller, G. (1990). The switch between latency and replication of EpsteinBarr virus. Journal of Infectious Diseases 161, 833-844.[Medline]
Miyashita, E. M., Yang, B., Lam, K. M. C., Crawford, D. H. & Thorley-Lawson, D. A. (1995). A novel form of EpsteinBarr virus latency in normal B cells in vivo. Cell 80, 593-601.[Medline]
Miyashita, E. M., Yang, B., Babcock, G. J. & Thorley-Lawson, D. A. (1997). Identification of the site of EpsteinBarr virus persistence in vivo as a resting B cell. Journal of Virology 71, 4882-4891.[Abstract]
Qu, L. & Rowe, D. T. (1992). EpsteinBarr virus latent gene expression in uncultured peripheral blood lymphocytes. Journal of Virology 66, 3715-3724.
Rivailler, P., Quink, C. & Wang, F. (1999). Strong selective pressure for evolution of an EpsteinBarr virus LMP2B homologue in the rhesus lymphocryptovirus. Journal of Virology 73, 8867-8872.
Rowe, D. T. (1999). EpsteinBarr virus immortalization and latency. Frontiers in Bioscience 4, 346-371.
Rowe, D. T., Hall, L., Joab, I. & Laux, G. (1990). Identification of the EpsteinBarr virus terminal protein gene products in latently infected lymphocytes. Journal of Virology 64, 2866-2875.
Sample, J., Liebowitz, D. & Kieff, E. (1989). Two related EpsteinBarr virus membrane proteins are encoded by separate genes. Journal of Virology 63, 933-937.
Sugden, B. (1994). Latent infection of B lymphocytes by EpsteinBarr virus. Seminars in Virology 5, 197-205.
Thorley-Lawson, D. A. & Babcock, G. J. (1999). A model for persistent infection with EpsteinBarr virus: the stealth virus of human B cells. Life Sciences 65, 1433-1453.[Medline]
Received 18 December 2001;
accepted 2 February 2002.
This article has been cited by other articles:
![]() |
M. P. Rechsteiner, C. Berger, L. Zauner, J. A. Sigrist, M. Weber, R. Longnecker, M. Bernasconi, and D. Nadal Latent Membrane Protein 2B Regulates Susceptibility to Induction of Lytic Epstein-Barr Virus Infection J. Virol., February 15, 2008; 82(4): 1739 - 1747. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Rechsteiner, C. Berger, M. Weber, J. A. Sigrist, D. Nadal, and M. Bernasconi Silencing of latent membrane protein 2B reduces susceptibility to activation of lytic Epstein-Barr virus in Burkitt's lymphoma Akata cells J. Gen. Virol., May 1, 2007; 88(5): 1454 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rovedo and R. Longnecker Epstein-Barr Virus Latent Membrane Protein 2B (LMP2B) Modulates LMP2A Activity J. Virol., January 1, 2007; 81(1): 84 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Ingham, J. Raaijmakers, C. S. H. Lim, G. Mbamalu, G. Gish, F. Chen, L. Matskova, I. Ernberg, G. Winberg, and T. Pawson The Epstein-Barr Virus Protein, Latent Membrane Protein 2A, Co-opts Tyrosine Kinases Used by the T Cell Receptor J. Biol. Chem., October 7, 2005; 280(40): 34133 - 34142. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Allen, L. S. Young, and C. W. Dawson The Epstein-Barr Virus-Encoded LMP2A and LMP2B Proteins Promote Epithelial Cell Spreading and Motility J. Virol., February 1, 2005; 79(3): 1789 - 1802. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Taylor, T. A. Haigh, N. H. Gudgeon, R. J. Phelps, S. P. Lee, N. M. Steven, and A. B. Rickinson Dual Stimulation of Epstein-Barr Virus (EBV)-Specific CD4+- and CD8+-T-Cell Responses by a Chimeric Antigen Construct: Potential Therapeutic Vaccine for EBV-Positive Nasopharyngeal Carcinoma J. Virol., January 15, 2004; 78(2): 768 - 778. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Morrison, A. J. Klingelhutz, and N. Raab-Traub Epstein-Barr Virus Latent Membrane Protein 2A Activates {beta}-Catenin Signaling in Epithelial Cells J. Virol., November 15, 2003; 77(22): 12276 - 12284. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |