|
|
||||||||
Animal: RNA Viruses |
Department of Virology II, National Institute of Infectious Diseases, Gakuen 4-7-1, Musashimurayama, Tokyo 208-0011, Japan1
Japan Poliomyelitis Research Institute, Kumegawa 5-34-4, Higashimurayama, Tokyo 189-0003, Japan2
Department of Virology, Toyama Institute of Health, Nakataikoyama, Kosugi-machi, Imizu-gun, Toyama 939-0363, Japan3
Author for correspondence: Hiromu Yoshida. Fax +81 42 561 4729. e-mail hyoshida{at}nih.go.jp
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The polio eradication program is close to the final stage of replacing wild-type poliovirus in the population with vaccine-type by mass live oral poliovaccine (OPV) immunization. After the termination of OPV in the near future, the possibility of an outbreak caused by vaccine-derived poliovirus (VDPV) must be considered, since it has been shown in many studies that nucleotide substitution in the virus genome occurs gradually during replication in the human gut after OPV administration and the phenotype of excreted viruses changes from attenuated to virulent (Abraham et al., 1993
; Dunn et al., 1990
; Japan Live Poliovaccine Research Commission, 1967
; Benyesh-Melnick et al., 1967
; Guillot et al., 1994
; Wood & Macadam, 1997
). It is therefore difficult to distinguish whether vaccine-associated paralytic poliomyelitis (VAPP) cases are recipient VAPP or contact VAPP by sequencing the genome of excreted virus.
On the other hand, environmental surveillance is still epidemiologically important for the following reasons: (i) the results of virus surveillance retrospectively reflect the properties of virus circulating in the community (Divizia et al., 1999
; Shulman et al., 2000
; Tambini et al., 1993
; Pöyry et al., 1988
; van der Avoort et al., 1995
) and (ii) it assesses the potential risk of infection from the environment and food (Jaykus, 1997
; Richards, 1999
; Haas, 1983
; Haas & Heller, 1988
; Haas et al., 1993
). In Toyama, Japan, routine OPV immunization has been administered annually in May and October. We have shown in previous studies that VDPVs were isolated from sewage and river waters within approximately 3 months after OPV and then, in type 1 and 3 viruses, not only did genetic mutation occur with less than 1·4% nucleotide divergence from the vaccine strain, but neurovirulence also increased in some of the isolates, as indicated by mutant analysis by PCR and restriction-enzyme cleavage (MAPREC) and neurovirulence tests with transgenic mice (Matsuura et al., 2000
; Yoshida et al., 2000
; Horie et al., 2002
). This means that it would be possible to detect phenotypically changed vaccine strains circulating in the population retrospectively through environment surveillance provided by the MAPREC assessment.
Neurovirulence increased to varying degrees when the following changes took place in base positions of the viruses: in the case of type 1 viruses, positions 480 and 525 in the 5' non-coding region changed respectively from G to A and from U to C; for type 2, position 481 changed from A to G; and for type 3, position 472 changed from U to C (Kawamura et al., 1989
; Pollard et al., 1989
; Evans et al., 1985
). Chumakov et al. (1991
, 1994
) developed the MAPREC method to estimate the ratio of revertants in a virus population that correlated with neurovirulence in monkey (Chumakov et al., 1991
, 1994
; Chumakov, 1999
; Taffs et al., 1995
; Rezapkin et al., 1994
, 1999
). MAPREC is a very sensitive method of determining the ratio of revertants, so, in type 1 and type 2 viruses, the results of MAPREC are not always related to the monkey neurovirulence test (MNVT), but are still useful in monitoring poliovirus mutants (Chumakov, 1999
; Rezapkin et al., 1999
). In this study, other type 2 strains were examined by MAPREC. Moreover, we report on the ecology of polioviruses in the environment, given the previous data on type 1 and type 3 viruses (Yoshida et al., 2000
; Horie et al., 2002
).
| Methods |
|---|
|
|
|---|
Virus isolation from sewage and river water.
MAPREC.
RNA purification, cDNA synthesis and PCR were performed as described by Taffs et al. (1995)
. The primers used for PCR were pS2-465 (sense primer; 5' 431GCTACATAAGAGTCCTCCGGCCCCTGAATGCGGCT465 3') and pA2-483 (antisense primer; 5' 520CGCGTTACGACAAGCCAGTCACTGGTTCGCGACCACGT483 3'). The PCR product containing 481-G revertants was used for second-strand DNA synthesis using a 32P-labelled sense primer and digested with Bsp1286I. The proportion of 481-G revertants was calculated by measuring the radioactivity in c.p.m. of Bsp1286I-digested and undigested DNA strands, using the equation 100xdigested DNA (c.p.m.)/[digested DNA (c.p.m.)+undigested DNA (c.p.m.)]. F207, which is a Sabin original+2nd passaged strain (SOM-2) derived from the P712, ch, 2ab strain, was used as a reference strain for the attenuated phenotype and was compared with environmental strains. As for type 1 and 3 polioviruses, previously reported MAPREC results were used, and data for attenuated reference strains F113 for type 1 and F313 for type 3 were also referred to (Yoshida et al., 2000
; Horie et al., 2002
).
| Results and Discussion |
|---|
|
|
|---|
|
|
In agreement with our results, type 2 virus has been shown in other studies to have the highest rate of phenotypic mutation of the three serotypes by the T-marker test (Matyasova & Koza, 1982
, 1985
). Generally, type 2 poliovirus has a higher rate of seroconversion after OPV administration than types 1 and 3, as a result of interference with the growth of types 1 and 3. Selection in the human gut might lead to high proportion of revertants in type 2.
It has been shown that isolates in the environment are genetically and epidemiologically related to those circulating in the community (Divizia et al., 1999
; Shulman et al., 2000
; Tambini et al., 1993
; Pöyry et al., 1988
; van der Avoort et al., 1995
; Slater et al., 1990
; Brancroft et al., 1957
). Therefore, the properties of isolates from sewage and river water would reflect those of viruses excreted from humans after OPV immunization, and, for susceptible individuals, VDPVs, which are a source of virulence, have the potential to be causative agents of poliomyelitis. As long as immunization coverage is maintained, OPV or inactivated poliovaccine will be effective in protecting against poliomyelitis caused by these VDPVs. The important point is that VDPVs in each serotype could be considered as potential causative agents of poliomyelitis, and might be spread widely in the community through contact infection, unapparent for susceptible individuals. The survey of seroconversion in the community would be useful to predict the risk of transmission of virulent-type VDPVs.
OPV immunization has contributed greatly to the poliomyelitis eradication programme. However, when the circulation of wild strains seems to have been interrupted, it is necessary to consider the possibility of the circulation of VDPVs. It has been reported that outbreaks of poliomyelitis caused by type 2 VDPV in Egypt and by type 1 in Haiti and the Dominican Republic have occurred in 2000 (Centers for Disease Control and Prevention, 2000
, 2001
). Environmental virus surveillance is important in considering the potential risk towards the worldwide poliomyelitis eradication programme in its final stages.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Benyesh-Melnick, M., Melnick, J. L., Rawls, W. E., Wimberly, I., Oro, J. B., Ben-Porath, E. & Rennick, V. (1967). Studies of the immunogenicity, communicability and genetic stability of oral poliovaccine administration during the winter. American Journal of Epidemiology 86, 112-136.
Brancroft, P. M., Engelhard, W. E. & Evans, C. A. (1957). Poliomyelitis in Huskerville (Lincoln) Nebraska. Studies indicating a relationship between clinically severe infection and proximate fecal pollution of water. Journal of the American Medical Association 164, 836-847.
Centers for Disease Control & Prevention (2000). Outbreak of poliomyelitis Dominican Republic and Haiti, 2000. Morbidity and Mortality Weekly Report 49, 1094, 1103.
Centers for Disease Control & Prevention (2001). Circulation of a type 2 vaccine-derived poliovirus Egypt, 19821993. Morbidity and Mortality Weekly Report 50, 4142, 51.
Chumakov, K. M. (1999). Molecular consistency monitoring of oral poliovirus vaccine and other live viral vaccines. Developments in Biological Standardization 100, 67-74.
Chumakov, K. M., Powers, L. B., Noonan, K. E., Roninson, I. B. & Levenbook, I. S. (1991). Correlation between amount of virus with altered nucleotide sequence and the monkey test for acceptability of oral poliovirus vaccine. Proceedings of the National Academy of Sciences, USA 88, 199-203.
Chumakov, K. M., Dragunsky, E. M., Norwood, L. P., Douthitt, M. P., Ran, Y., Taffs, R. E., Ridge, J. & Levenbook, I. S. (1994). Consistent selection of mutations in the 5'-untranslated region of oral poliovirus vaccine upon passaging in vitro. Journal of Medical Virology 42, 79-85.
Divizia, M., Palombi, L., Buonomo, E., Donia, D., Ruscio, V., Equestre, M., Leno, L., Pana, A. & Degener, A. M. (1999). Genomic characterization of human and environmental polioviruses isolated in Albania. Applied and Environmental Microbiology 65, 3534-3539.
Dunn, G., Begg, N. T., Cammack, N. & Minor, P. D. (1990). Virus excretion and mutation by infants following primary vaccination with live oral poliovaccine from two sources. Journal of Medical Virology 32, 92-95.
Evans, D. M., Dunn, G., Minor, P. D., Schild, G. C., Cann, A. J., Stanway, G., Almond, J. W., Currey, K. & Maizel, J. V.Jr(1985). Increased neurovirulence associated with a single nucleotide change in a noncoding region of the Sabin type 3 poliovaccine genome. Nature 314, 548-550.
Goyal, S. M., Gerba, C. P. & Melnick, J. L. (1979). Human enteroviruses in oysters and their overlying waters. Applied and Environmental Microbiology 37, 572-581.
Guillot, S., Otelea, D., Delpeyroux, F. & Crainic, R. (1994). Point mutations involved in the attenuation/neurovirulence alternation in type 1 and 2 oral polio vaccine strains detected by site-specific polymerase chain reaction. Vaccine 12, 503-507.
Haas, C. N. (1983). Estimation of risk due to low doses of microorganisms: a comparison of alternative methodologies. American Journal of Epidemiology 118, 573-582.
Haas, C. N. & Heller, B. (1988). Test of the validity of the Poisson assumption for analysis of most-probable-number results. Applied and Environmental Microbiology 54, 2996-3002.
Haas, C. N., Rose, J. B., Gerba, C. & Regli, S. (1993). Risk assessment of virus in drinking water. Risk Analysis 13, 545-552.
Horie, H., Yoshida, H., Matsuura, K., Miyazawa, M., Ota, Y., Nakayama, T., Doi, Y. & Hashizume, S. (2002). Neurovirulence of type 1 polioviruses isolated from sewage in Japan. Applied and Environmental Microbiology 68, 138-142.
Japan Live Poliovaccine Research Commission (1967). Evaluation of Sabin live poliovirus vaccine in Japan. IV. Marker tests on poliovirus strains recovered from vaccinees and their contacts. Marker Test Subcommittee. Japanese Journal of Medical Science and Biology 20, 167173.
Jaykus, L. A. (1997). Epidemiology and detection as options for control of viral and parasitic foodborne disease. Emerging Infectious Diseases 3, 529-539.
Kawamura, N., Kohara, M., Abe, S., Komatsu, T., Tago, K., Arita, M. & Nomoto, A. (1989). Determinants in the 5' noncoding region of poliovirus Sabin 1 RNA that influence the attenuation phenotype. Journal of Virology 63, 1302-1309.
Matsuura, K., Hasegawa, S., Nakayama, T., Morita, O. & Uetake, H. (1984). Viral pollution of the rivers in Toyama City. Microbiology and Immunology 28, 575-588.
Matsuura, K., Ishikura, M., Yoshida, H., Nakayama, T., Hasegawa, S., Ando, S., Horie, H., Miyamura, T. & Kitamura, T. (2000). Assessment of poliovirus eradication in Japan: genomic analysis of polioviruses isolated from river water and sewage in Toyama Prefecture. Applied and Environmental Microbiology 66, 5087-5091.
Matyasova, I. & Koza, J. (1982). Properties of poliovirus strains isolated over the period 19691978 from the main municipal sewerage system of the city of Prague. Journal of Hygiene Epidemiology Microbiology and Immunology 26, 162-175.
Matyasova, I. & Koza, J. (1985). Properties of poliovirus strains isolated from waste waters of nurseries in Prague in 19691982. Journal of Hygiene Epidemiology Microbiology and Immunology 29, 387-398.
Metcalf, T. G., Mullin, B., Eckerson, D., Moulton, E. & Larkin, E. P. (1979). Bioaccumulation and depuration of enteroviruses by the soft-shelled clam, Mya arenaria. Applied and Environmental Microbiology 38, 275-282.
Metcalf, T. G., Melnick, J. L. & Estes, M. K. (1995). Environmental virology: from detection of virus in sewage and water by isolation to identification by molecular biology a trip of over 50 years. Annual Review of Microbiology 49, 461-487.
Pollard, S. R., Dunn, G., Cammack, N., Minor, P. D. & Almond, J. W. (1989). Nucleotide sequence of a neurovirulent variant of the type 2 oral poliovirus vaccine. Journal of Virology 63, 4949-4951.
Pöyry, T., Stenvik, M. & Hovi, T. (1988). Viruses in sewage waters during and after a poliomyelitis outbreak and subsequent nationwide oral poliovirus vaccination campaign in Finland. Applied and Environmental Microbiology 54, 371-374.
Rezapkin, G. V., Chumakov, K. M., Lu, Z., Ran, Y., Dragunsky, E. M. & Levenbook, I. S. (1994). Microevolution of Sabin 1 strain in vitro and genetic stability of oral poliovirus vaccine. Virology 202, 370-378.
Rezapkin, G. V., Fan, L., Asher, D. M., Fibi, M. R., Dragunsky, E. M. & Chumakov, K. M. (1999). Mutations in Sabin 2 strain of poliovirus and stability of attenuation phenotype. Virology 258, 152-160.
Richards, G. P. (1999). Limitations of molecular biological techniques for assessing the virological safety of foods. Journal of Food Protection 62, 691-697.
Shulman, L. M., Handsher, R., Yang, C. F., Yang, S. J., Manor, J., Vonsover, A., Grossman, Z., Pallansch, M., Mendelson, E. & Kew, O. M. (2000). Resolution of the pathways of poliovirus type 1 transmission during an outbreak. Journal of Clinical Microbiology 38, 945-952.
Slater, P. E., Orenstein, W. A., Morag, A., Avni, A., Handsher, R., Green, M. S., Costin, C., Yarrow, A., Rishpon, S., Havkin, O., Ben-Zvi, T., Kew, O. M., Rey, M., Epstein, I., Swartz, T. A. & Melnick, J. L. (1990). Poliomyelitis outbreak in Israel in 1988: a report with two commentaries. Lancet 335, 1192-1195.
Taffs, R. E., Chumakov, K. M., Rezapkin, G. V., Lu, Z., Douthitt, M., Dragunsky, E. M. & Levenbook, I. S. (1995). Genetic stability and mutant selection in Sabin 2 strain of oral poliovirus vaccine grown under different cell culture conditions. Virology 209, 366-373.
Tambini, G., Andrus, J. K., Marques, E., Boshell, J., Pallansch, M., de Quadros, C. A. & Kew, O. (1993). Direct detection of wild poliovirus circulation by stool surveys of healthy children and analysis of community wastewater. Journal of Infectious Diseases 168, 1510-1514.
van der Avoort, H. G., Reimerink, J. H., Ras, A., Mulders, M. N. & van Loon, A. M. (1995). Isolation of epidemic poliovirus from sewage during the 19923 type 3 outbreak in The Netherlands. Epidemiology and Infection 114, 481-491.
Wood, D. J. & Macadam, A. J. (1997). Laboratory tests for live attenuated poliovirus vaccines. Biologicals 25, 3-15.
Yoshida, H., Li, J., Yoneyama, T., Yoshii, K., Shimizu, H., Nguyen, T. H., Toda, K., Nguyen, T. L., Phan, V. T., Miyamura, T. & Hagiwara, A. (1997). Two major strains of type 1 wild poliovirus circulating in Indochina. Journal of Infectious Diseases 175, 1233-1237.
Yoshida, H., Horie, H., Matsuura, K. & Miyamura, T. (2000). Characterization of vaccine-derived polioviruses isolated from sewage and river water in Japan. Lancet 356, 1461-1463.
Received 26 October 2001;
accepted 15 January 2002.
This article has been cited by other articles:
![]() |
M. Iwai, H. Yoshida, K. Matsuura, T. Fujimoto, H. Shimizu, T. Takizawa, and Y. Nagai Molecular Epidemiology of Echoviruses 11 and 13, Based on an Environmental Surveillance Conducted in Toyama Prefecture, 2002-2003 Appl. Envir. Microbiol., September 1, 2006; 72(9): 6381 - 6387. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Burns, J. Shaw, R. Campagnoli, J. Jorba, A. Vincent, J. Quay, and O. Kew Modulation of Poliovirus Replicative Fitness in HeLa Cells by Deoptimization of Synonymous Codon Usage in the Capsid Region. J. Virol., April 1, 2006; 80(7): 3259 - 3272. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-F. Yang, T. Naguib, S.-J. Yang, E. Nasr, J. Jorba, N. Ahmed, R. Campagnoli, H. van der Avoort, H. Shimizu, T. Yoneyama, et al. Circulation of Endemic Type 2 Vaccine-Derived Poliovirus in Egypt from 1983 to 1993 J. Virol., August 1, 2003; 77(15): 8366 - 8377. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |