J Gen Virol Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, H.
Right arrow Articles by Miyamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, H.
Right arrow Articles by Miyamura, T.
Agricola
Right arrow Articles by Yoshida, H.
Right arrow Articles by Miyamura, T.
Journal of General Virology (2002), 83, 1107-1111.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Prevalence of vaccine-derived polioviruses in the environment

Hiromu Yoshida1, Hitoshi Horie2, Kumiko Matsuura3, Takashi Kitamura3, So Hashizume2 and Tatsuo Miyamura1

Department of Virology II, National Institute of Infectious Diseases, Gakuen 4-7-1, Musashimurayama, Tokyo 208-0011, Japan1
Japan Poliomyelitis Research Institute, Kumegawa 5-34-4, Higashimurayama, Tokyo 189-0003, Japan2
Department of Virology, Toyama Institute of Health, Nakataikoyama, Kosugi-machi, Imizu-gun, Toyama 939-0363, Japan3

Author for correspondence: Hiromu Yoshida. Fax +81 42 561 4729. e-mail hyoshida{at}nih.go.jp


   Abstract
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
A survey of poliovirus in river and sewage water was conducted from October 1993 to September 1995 in Toyama Prefecture, Japan. In this study, 25 isolates differentiated as type 2 vaccine-derived polioviruses (VDPVs) were characterized using mutant analysis by PCR and restriction-enzyme cleavage (MAPREC) to estimate the ratio of 481-G revertants correlated to neurovirulence in a virus population. Of these isolates, 23 (92%) comprised between 44 and 96% 481-G revertants by MAPREC. The other two isolates had revertant percentages close to the 0·6% of the attenuated reference strain. It was presumed that these 23 isolates would be variant with potential neurovirulence by MAPREC analysis. Of the 23 isolates, three were isolated from river water. Moreover, our results by MAPREC showed that type 2 poliovirus was phenotypically more variable than type 1 (69%) or type 3 (55%), as determined in previous studies. The prevalence of virulent-type VDPVs in river and sewage water suggested that the oral poliovaccine itself had led to wide environmental pollution in nature. To terminate the cycle of virus transmission in nature, the ecology of VDPVs should be studied further. A hygiene programme, inactivated poliovirus vaccine immunization and well-maintained herd immunity may play key roles in reducing the potential risk of infection by virulent VDPVs.


   Introduction
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Although it is known that poliovirus exists widely in nature, in soil, sewage, wastewater, drinking water and food such as shellfish, there is very little evidence to connect it directly with an outbreak of poliomyelitis (Jaykus, 1997Down ; Metcalf et al., 1979Down ; Goyal et al., 1979Down ). Because most cases of infection by poliovirus are not apparent, it is not until secondary, person-to-person spread leads to the onset of poliomyelitis that the infection is recognized. Therefore, it is difficult to address the risk of infection from the environment (Metcalf et al., 1995Down ).

The polio eradication program is close to the final stage of replacing wild-type poliovirus in the population with vaccine-type by mass live oral poliovaccine (OPV) immunization. After the termination of OPV in the near future, the possibility of an outbreak caused by vaccine-derived poliovirus (VDPV) must be considered, since it has been shown in many studies that nucleotide substitution in the virus genome occurs gradually during replication in the human gut after OPV administration and the phenotype of excreted viruses changes from attenuated to virulent (Abraham et al., 1993Down ; Dunn et al., 1990Down ; Japan Live Poliovaccine Research Commission, 1967Down ; Benyesh-Melnick et al., 1967Down ; Guillot et al., 1994Down ; Wood & Macadam, 1997Down ). It is therefore difficult to distinguish whether vaccine-associated paralytic poliomyelitis (VAPP) cases are recipient VAPP or contact VAPP by sequencing the genome of excreted virus.

On the other hand, environmental surveillance is still epidemiologically important for the following reasons: (i) the results of virus surveillance retrospectively reflect the properties of virus circulating in the community (Divizia et al., 1999Down ; Shulman et al., 2000Down ; Tambini et al., 1993Down ; Pöyry et al., 1988Down ; van der Avoort et al., 1995Down ) and (ii) it assesses the potential risk of infection from the environment and food (Jaykus, 1997Down ; Richards, 1999Down ; Haas, 1983Down ; Haas & Heller, 1988Down ; Haas et al., 1993Down ). In Toyama, Japan, routine OPV immunization has been administered annually in May and October. We have shown in previous studies that VDPVs were isolated from sewage and river waters within approximately 3 months after OPV and then, in type 1 and 3 viruses, not only did genetic mutation occur with less than 1·4% nucleotide divergence from the vaccine strain, but neurovirulence also increased in some of the isolates, as indicated by mutant analysis by PCR and restriction-enzyme cleavage (MAPREC) and neurovirulence tests with transgenic mice (Matsuura et al., 2000Down ; Yoshida et al., 2000Down ; Horie et al., 2002Down ). This means that it would be possible to detect phenotypically changed vaccine strains circulating in the population retrospectively through environment surveillance provided by the MAPREC assessment.

Neurovirulence increased to varying degrees when the following changes took place in base positions of the viruses: in the case of type 1 viruses, positions 480 and 525 in the 5' non-coding region changed respectively from G to A and from U to C; for type 2, position 481 changed from A to G; and for type 3, position 472 changed from U to C (Kawamura et al., 1989Down ; Pollard et al., 1989Down ; Evans et al., 1985Down ). Chumakov et al. (1991Down , 1994Down ) developed the MAPREC method to estimate the ratio of revertants in a virus population that correlated with neurovirulence in monkey (Chumakov et al., 1991Down , 1994Down ; Chumakov, 1999Down ; Taffs et al., 1995Down ; Rezapkin et al., 1994Down , 1999Down ). MAPREC is a very sensitive method of determining the ratio of revertants, so, in type 1 and type 2 viruses, the results of MAPREC are not always related to the monkey neurovirulence test (MNVT), but are still useful in monitoring poliovirus mutants (Chumakov, 1999Down ; Rezapkin et al., 1999Down ). In this study, other type 2 strains were examined by MAPREC. Moreover, we report on the ecology of polioviruses in the environment, given the previous data on type 1 and type 3 viruses (Yoshida et al., 2000Down ; Horie et al., 2002Down ).


   Methods
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
{blacksquare} Virus isolation from sewage and river water.
From October 1993 to September 1995, samples were collected twice monthly at a sewage plant and river-monitoring points. The collected water was concentrated by using the method described by Matsuura et al. (1984)Down . Each concentrated specimen was inoculated into a total of 30 tube cultures of rhabdomyosarcoma (RD), primary monkey kidney (MK) or Vero cells and incubated at 36 °C (Matsuura et al., 1984Down ). Thirty-one isolates were identified as type 2 by polio pooled serum and differentiated intratypically as vaccine types (Yoshida et al., 1997Down ). The 25 available isolates were used for further study.

{blacksquare} MAPREC.
RNA purification, cDNA synthesis and PCR were performed as described by Taffs et al. (1995)Down . The primers used for PCR were pS2-465 (sense primer; 5' 431GCTACATAAGAGTCCTCCGGCCCCTGAATGCGGCT465 3') and pA2-483 (antisense primer; 5' 520CGCGTTACGACAAGCCAGTCACTGGTTCGCGACCACGT483 3'). The PCR product containing 481-G revertants was used for second-strand DNA synthesis using a 32P-labelled sense primer and digested with Bsp1286I. The proportion of 481-G revertants was calculated by measuring the radioactivity in c.p.m. of Bsp1286I-digested and undigested DNA strands, using the equation 100xdigested DNA (c.p.m.)/[digested DNA (c.p.m.)+undigested DNA (c.p.m.)]. F207, which is a Sabin original+2nd passaged strain (SOM-2) derived from the P712, ch, 2ab strain, was used as a reference strain for the attenuated phenotype and was compared with environmental strains. As for type 1 and 3 polioviruses, previously reported MAPREC results were used, and data for attenuated reference strains F113 for type 1 and F313 for type 3 were also referred to (Yoshida et al., 2000Down ; Horie et al., 2002Down ).


   Results and Discussion
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Twenty-five type-2 polioviruses were isolated from sewage and river water within 3 months of routine OPV immunization (Fig. 1Down), showing the properties of vaccine-derived strains (Matsuura et al., 2000Down ). The substitution ratio of position 481 in the 5' non-coding region of the virus genome was examined by using the MAPREC method, and 23 of 25 isolates (92%) comprised between 44 and 96% 481-G revertants by MAPREC (Fig. 2Down). Three isolates from the river contained 92–96% 481-G revertants. F207, as the attenuated reference strain, had 0·6% 481-G. Only two isolates were close to F207; the other 23 had a higher rate than that for the attenuated F207 strain. Taffs et al. (1995)Down reported that the stipulated cut-off of the ratio of 481-G revertants for passing or failing of type-2 vaccine viruses by MNVT was approximately 4%. Therefore, these 23 isolates were presumed to be variant with potential virulence. In type 1 virus, the stipulated cut-off value of 480-A+525-C was approximately 5% and, in type 3, the cut-off of 472-C was approximately 1% (Chumakov, 1999Down ; Rezapkin et al., 1994Down ). Therefore, in type 1 examined in a previous study as shown in Fig. 2Down, 9 of 13 (69%) isolates contained 83–94% 480-A+525-C by MAPREC and were presumed to be variant with potential virulence (Horie et al., 2002Down ). In type 3, 16 of 29 (55%) isolates contained 2–91% 472-C revertants (Fig. 2Down) (Yoshida et al., 2000Down ). Accordingly, the ratios of variant/total isolates were respectively 69, 92 and 55% in types 1, 2 and 3.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1. Time-series of VDPVs in the environment. Routine immunization was conducted in May and October. Each serotype was isolated in the environment within approximately 3 months of OPV immunization. Variant strains (filled bars) are VDPV strains that had a value that exceeded the stipulated cut-off percentage of 480-A+525-C for type 1, 481-G for type 2 and 472-C for type 3. Attenuated strains (open bars) are strains for which the content of 480-A+525-C (type 1), 481-G (type 2) or 472-C (type 3) was the same as or less than for F113, F207 or F313 (attenuated reference strains). Data for type 1 and type 3 viruses were taken from previous studies (Yoshida et al., 2000Down ; Horie et al., 2002Down ).

 


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 2. Contents of 480-A+525-C for type 1, 481-G for type 2 and 472-C for type 3 revertants in strains isolated from sewage and river water. {bullet}, Content of 480-A+525-C (type 1), 481-G (type 2) or 472-C (type 3) exceeded the stipulated cut-off values (approximately 5, 4 and 1%, respectively) for passing of each serotype vaccine virus by MNVT. {circ}, Content of 480-A+525-C (type 1), 481-G (type 2) or 472-C (type 3) was the same as or less than F113, F207 and F313 (attenuated reference strains). {triangleup}, Attenuated reference strains (F113, F207 and F313 for each serotype). Data for type 1 and type 3 viruses were reported in previous studies (Yoshida et al., 2000Down ; Horie et al., 2002Down ).

 
The results of our analysis of environmental strains by MAPREC showed that the ratio of revertants increased in 55–92% of isolates in each serotype, compared with the attenuated reference virus. Of the three serotypes, type 2 virus had the highest rate of mutation. As all samples from environmental sources examined were highly concentrated, the risk of infection by these isolates would be very small. However, the risk-assessment study by Haas and co-workers showed that the longer the term of exposure to water contaminated by enteroviruses, the higher the potential infection risk (Haas et al., 1993Down ; Haas & Heller, 1988Down ; Haas, 1983Down ). Although it is very rare in industrialized countries to have direct access to wastewater contaminated by viruses, this is not always the case in developing countries, which may have poor sewage and drinking water systems. Therefore, a risk-assessment study for virulent-type VDPVs would be epidemiologically important.

In agreement with our results, type 2 virus has been shown in other studies to have the highest rate of phenotypic mutation of the three serotypes by the T-marker test (Matyasova & Koza, 1982Down , 1985Down ). Generally, type 2 poliovirus has a higher rate of seroconversion after OPV administration than types 1 and 3, as a result of interference with the growth of types 1 and 3. Selection in the human gut might lead to high proportion of revertants in type 2.

It has been shown that isolates in the environment are genetically and epidemiologically related to those circulating in the community (Divizia et al., 1999Down ; Shulman et al., 2000Down ; Tambini et al., 1993Down ; Pöyry et al., 1988Down ; van der Avoort et al., 1995Down ; Slater et al., 1990Down ; Brancroft et al., 1957Down ). Therefore, the properties of isolates from sewage and river water would reflect those of viruses excreted from humans after OPV immunization, and, for susceptible individuals, VDPVs, which are a source of virulence, have the potential to be causative agents of poliomyelitis. As long as immunization coverage is maintained, OPV or inactivated poliovaccine will be effective in protecting against poliomyelitis caused by these VDPVs. The important point is that VDPVs in each serotype could be considered as potential causative agents of poliomyelitis, and might be spread widely in the community through contact infection, unapparent for susceptible individuals. The survey of seroconversion in the community would be useful to predict the risk of transmission of virulent-type VDPVs.

OPV immunization has contributed greatly to the poliomyelitis eradication programme. However, when the circulation of wild strains seems to have been interrupted, it is necessary to consider the possibility of the circulation of VDPVs. It has been reported that outbreaks of poliomyelitis caused by type 2 VDPV in Egypt and by type 1 in Haiti and the Dominican Republic have occurred in 2000 (Centers for Disease Control and Prevention, 2000Down , 2001Down ). Environmental virus surveillance is important in considering the potential risk towards the worldwide poliomyelitis eradication programme in its final stages.


   Acknowledgments
 
We are grateful to Dr A. Sasaki (University of Kyushu) and Dr Y. Nagai (Toyama Institute of Health) for critical review and helpful discussion. This report was supported by Grants in Aid for Promotion of Polio Eradication from the Ministry of Health and Welfare, Japan.


   References
TOP
Abstract
Introduction
Methods
Results and Discussion
References
 
Abraham, R., Minor, P., Dunn, G., Modlin, J. F. & Ogra, P. L. (1993). Shedding of virulent poliovirus revertants during immunization with oral poliovirus vaccine after prior immunization with inactivated polio vaccine. Journal of Infectious Diseases 168, 1105-1109.

Benyesh-Melnick, M., Melnick, J. L., Rawls, W. E., Wimberly, I., Oro, J. B., Ben-Porath, E. & Rennick, V. (1967). Studies of the immunogenicity, communicability and genetic stability of oral poliovaccine administration during the winter. American Journal of Epidemiology 86, 112-136.

Brancroft, P. M., Engelhard, W. E. & Evans, C. A. (1957). Poliomyelitis in Huskerville (Lincoln) Nebraska. Studies indicating a relationship between clinically severe infection and proximate fecal pollution of water. Journal of the American Medical Association 164, 836-847.

Centers for Disease Control & Prevention (2000). Outbreak of poliomyelitis – Dominican Republic and Haiti, 2000. Morbidity and Mortality Weekly Report 49, 1094, 1103.

Centers for Disease Control & Prevention (2001). Circulation of a type 2 vaccine-derived poliovirus – Egypt, 1982–1993. Morbidity and Mortality Weekly Report 50, 41–42, 51.

Chumakov, K. M. (1999). Molecular consistency monitoring of oral poliovirus vaccine and other live viral vaccines. Developments in Biological Standardization 100, 67-74.

Chumakov, K. M., Powers, L. B., Noonan, K. E., Roninson, I. B. & Levenbook, I. S. (1991). Correlation between amount of virus with altered nucleotide sequence and the monkey test for acceptability of oral poliovirus vaccine. Proceedings of the National Academy of Sciences, USA 88, 199-203.

Chumakov, K. M., Dragunsky, E. M., Norwood, L. P., Douthitt, M. P., Ran, Y., Taffs, R. E., Ridge, J. & Levenbook, I. S. (1994). Consistent selection of mutations in the 5'-untranslated region of oral poliovirus vaccine upon passaging in vitro. Journal of Medical Virology 42, 79-85.

Divizia, M., Palombi, L., Buonomo, E., Donia, D., Ruscio, V., Equestre, M., Leno, L., Pana, A. & Degener, A. M. (1999). Genomic characterization of human and environmental polioviruses isolated in Albania. Applied and Environmental Microbiology 65, 3534-3539.

Dunn, G., Begg, N. T., Cammack, N. & Minor, P. D. (1990). Virus excretion and mutation by infants following primary vaccination with live oral poliovaccine from two sources. Journal of Medical Virology 32, 92-95.

Evans, D. M., Dunn, G., Minor, P. D., Schild, G. C., Cann, A. J., Stanway, G., Almond, J. W., Currey, K. & Maizel, J. V.Jr(1985). Increased neurovirulence associated with a single nucleotide change in a noncoding region of the Sabin type 3 poliovaccine genome. Nature 314, 548-550.

Goyal, S. M., Gerba, C. P. & Melnick, J. L. (1979). Human enteroviruses in oysters and their overlying waters. Applied and Environmental Microbiology 37, 572-581.

Guillot, S., Otelea, D., Delpeyroux, F. & Crainic, R. (1994). Point mutations involved in the attenuation/neurovirulence alternation in type 1 and 2 oral polio vaccine strains detected by site-specific polymerase chain reaction. Vaccine 12, 503-507.

Haas, C. N. (1983). Estimation of risk due to low doses of microorganisms: a comparison of alternative methodologies. American Journal of Epidemiology 118, 573-582.

Haas, C. N. & Heller, B. (1988). Test of the validity of the Poisson assumption for analysis of most-probable-number results. Applied and Environmental Microbiology 54, 2996-3002.

Haas, C. N., Rose, J. B., Gerba, C. & Regli, S. (1993). Risk assessment of virus in drinking water. Risk Analysis 13, 545-552.

Horie, H., Yoshida, H., Matsuura, K., Miyazawa, M., Ota, Y., Nakayama, T., Doi, Y. & Hashizume, S. (2002). Neurovirulence of type 1 polioviruses isolated from sewage in Japan. Applied and Environmental Microbiology 68, 138-142.

Japan Live Poliovaccine Research Commission (1967). Evaluation of Sabin live poliovirus vaccine in Japan. IV. Marker tests on poliovirus strains recovered from vaccinees and their contacts. Marker Test Subcommittee. Japanese Journal of Medical Science and Biology 20, 167–173.

Jaykus, L. A. (1997). Epidemiology and detection as options for control of viral and parasitic foodborne disease. Emerging Infectious Diseases 3, 529-539.

Kawamura, N., Kohara, M., Abe, S., Komatsu, T., Tago, K., Arita, M. & Nomoto, A. (1989). Determinants in the 5' noncoding region of poliovirus Sabin 1 RNA that influence the attenuation phenotype. Journal of Virology 63, 1302-1309.

Matsuura, K., Hasegawa, S., Nakayama, T., Morita, O. & Uetake, H. (1984). Viral pollution of the rivers in Toyama City. Microbiology and Immunology 28, 575-588.

Matsuura, K., Ishikura, M., Yoshida, H., Nakayama, T., Hasegawa, S., Ando, S., Horie, H., Miyamura, T. & Kitamura, T. (2000). Assessment of poliovirus eradication in Japan: genomic analysis of polioviruses isolated from river water and sewage in Toyama Prefecture. Applied and Environmental Microbiology 66, 5087-5091.

Matyasova, I. & Koza, J. (1982). Properties of poliovirus strains isolated over the period 1969–1978 from the main municipal sewerage system of the city of Prague. Journal of Hygiene Epidemiology Microbiology and Immunology 26, 162-175.

Matyasova, I. & Koza, J. (1985). Properties of poliovirus strains isolated from waste waters of nurseries in Prague in 1969–1982. Journal of Hygiene Epidemiology Microbiology and Immunology 29, 387-398.

Metcalf, T. G., Mullin, B., Eckerson, D., Moulton, E. & Larkin, E. P. (1979). Bioaccumulation and depuration of enteroviruses by the soft-shelled clam, Mya arenaria. Applied and Environmental Microbiology 38, 275-282.

Metcalf, T. G., Melnick, J. L. & Estes, M. K. (1995). Environmental virology: from detection of virus in sewage and water by isolation to identification by molecular biology – a trip of over 50 years. Annual Review of Microbiology 49, 461-487.

Pollard, S. R., Dunn, G., Cammack, N., Minor, P. D. & Almond, J. W. (1989). Nucleotide sequence of a neurovirulent variant of the type 2 oral poliovirus vaccine. Journal of Virology 63, 4949-4951.

Pöyry, T., Stenvik, M. & Hovi, T. (1988). Viruses in sewage waters during and after a poliomyelitis outbreak and subsequent nationwide oral poliovirus vaccination campaign in Finland. Applied and Environmental Microbiology 54, 371-374.

Rezapkin, G. V., Chumakov, K. M., Lu, Z., Ran, Y., Dragunsky, E. M. & Levenbook, I. S. (1994). Microevolution of Sabin 1 strain in vitro and genetic stability of oral poliovirus vaccine. Virology 202, 370-378.

Rezapkin, G. V., Fan, L., Asher, D. M., Fibi, M. R., Dragunsky, E. M. & Chumakov, K. M. (1999). Mutations in Sabin 2 strain of poliovirus and stability of attenuation phenotype. Virology 258, 152-160.

Richards, G. P. (1999). Limitations of molecular biological techniques for assessing the virological safety of foods. Journal of Food Protection 62, 691-697.

Shulman, L. M., Handsher, R., Yang, C. F., Yang, S. J., Manor, J., Vonsover, A., Grossman, Z., Pallansch, M., Mendelson, E. & Kew, O. M. (2000). Resolution of the pathways of poliovirus type 1 transmission during an outbreak. Journal of Clinical Microbiology 38, 945-952.

Slater, P. E., Orenstein, W. A., Morag, A., Avni, A., Handsher, R., Green, M. S., Costin, C., Yarrow, A., Rishpon, S., Havkin, O., Ben-Zvi, T., Kew, O. M., Rey, M., Epstein, I., Swartz, T. A. & Melnick, J. L. (1990). Poliomyelitis outbreak in Israel in 1988: a report with two commentaries. Lancet 335, 1192-1195.

Taffs, R. E., Chumakov, K. M., Rezapkin, G. V., Lu, Z., Douthitt, M., Dragunsky, E. M. & Levenbook, I. S. (1995). Genetic stability and mutant selection in Sabin 2 strain of oral poliovirus vaccine grown under different cell culture conditions. Virology 209, 366-373.

Tambini, G., Andrus, J. K., Marques, E., Boshell, J., Pallansch, M., de Quadros, C. A. & Kew, O. (1993). Direct detection of wild poliovirus circulation by stool surveys of healthy children and analysis of community wastewater. Journal of Infectious Diseases 168, 1510-1514.

van der Avoort, H. G., Reimerink, J. H., Ras, A., Mulders, M. N. & van Loon, A. M. (1995). Isolation of epidemic poliovirus from sewage during the 1992–3 type 3 outbreak in The Netherlands. Epidemiology and Infection 114, 481-491.

Wood, D. J. & Macadam, A. J. (1997). Laboratory tests for live attenuated poliovirus vaccines. Biologicals 25, 3-15.

Yoshida, H., Li, J., Yoneyama, T., Yoshii, K., Shimizu, H., Nguyen, T. H., Toda, K., Nguyen, T. L., Phan, V. T., Miyamura, T. & Hagiwara, A. (1997). Two major strains of type 1 wild poliovirus circulating in Indochina. Journal of Infectious Diseases 175, 1233-1237.

Yoshida, H., Horie, H., Matsuura, K. & Miyamura, T. (2000). Characterization of vaccine-derived polioviruses isolated from sewage and river water in Japan. Lancet 356, 1461-1463.

Received 26 October 2001; accepted 15 January 2002.


This article has been cited by other articles:


Home page
Appl. Environ. Microbiol.Home page
M. Iwai, H. Yoshida, K. Matsuura, T. Fujimoto, H. Shimizu, T. Takizawa, and Y. Nagai
Molecular Epidemiology of Echoviruses 11 and 13, Based on an Environmental Surveillance Conducted in Toyama Prefecture, 2002-2003
Appl. Envir. Microbiol., September 1, 2006; 72(9): 6381 - 6387.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. C. Burns, J. Shaw, R. Campagnoli, J. Jorba, A. Vincent, J. Quay, and O. Kew
Modulation of Poliovirus Replicative Fitness in HeLa Cells by Deoptimization of Synonymous Codon Usage in the Capsid Region.
J. Virol., April 1, 2006; 80(7): 3259 - 3272.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C.-F. Yang, T. Naguib, S.-J. Yang, E. Nasr, J. Jorba, N. Ahmed, R. Campagnoli, H. van der Avoort, H. Shimizu, T. Yoneyama, et al.
Circulation of Endemic Type 2 Vaccine-Derived Poliovirus in Egypt from 1983 to 1993
J. Virol., August 1, 2003; 77(15): 8366 - 8377.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, H.
Right arrow Articles by Miyamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, H.
Right arrow Articles by Miyamura, T.
Agricola
Right arrow Articles by Yoshida, H.
Right arrow Articles by Miyamura, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS