|
|
||||||||
Other Agents |
Institut für Neuropathologie, Universität Göttingen, Robert-Koch-Str. 40, D-37075 Göttingen, Germany1
Institut für Neuropathologie, Ludwig-Maximilians-Universität München, Marchioninistr. 17, D-81377 München, Germany2
Authors for correspondence: Hans Kretzschmar and Otto Windl. Fax +49 89 70954903. e-mail Hans.Kretzschmar{at}inp.med.uni-muenchen.de, Otto.Windl@inp.med.uni-muenchen.de
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
PrPC, a neuronal glycoprotein, is anchored to the plasma membrane by a glycosylphosphatidylinositol (GPI) moiety. The function of PrPC, which is a copper-binding protein (Brown et al., 1997a
), is still not clearly understood. Recent data point to a function in synaptic interaction (Herms et al., 1999
), resistance of neurons to oxidative stress (Brown et al., 1997b
) or signal transduction (Mouillet-Richard et al., 2000
).
Studies investigating PrPC metabolism have demonstrated that PrPC turns over with a half-life of 36 h in mouse neuroblastoma cells (Borchelt et al., 1990
; Caughey et al., 1989
). Chicken PrPC has been shown to recycle between the plasma membrane and an endosomal compartment (Shyng et al., 1993
). During its normal processing, PrPC is cleaved at the central hydrophobic region, yielding a C-terminal, GPI-anchored fragment that can be identified in brain tissue and in cultured cells (Chen et al., 1995
; Harris et al., 1993
; Jiménez-Huete et al., 1998
; Pan et al., 1992
).
PrPSc is derived from PrPC by a post-translational process that seems to involve species-specific molecular interactions between the two isoforms. PrPC is necessary for infectivity and pathology, as demonstrated by experiments showing complete resistance of Prnp-knockout mice to infection with prions (Brandner et al., 1996
; Brown et al., 1996
; Büeler et al., 1993
). PrPC is rich in
-helices, while PrPSc exhibits a greater content of
-sheets (Caughey et al., 1991
; Pan et al., 1993
; Safar et al., 1993
). The nuclear magnetic resonance structure of full-length recombinant PrPC revealed that the region comprising amino acids 121231 contains a high level of secondary structure, including three
-helices and a two-stranded antiparallel
-sheet, whereas the N terminus is highly flexible (Hornemann et al., 1997
; Riek et al., 1996
, 1997
). Copper binding seems to confer a distinct structure on the N terminus (Viles et al., 1999
). Synthesized peptides that are homologous to residues 109122 and 106126 form
-sheets spontaneously (Forloni et al., 1993
; Gasset et al., 1992
), with the internal sequence AGAAAAGA (residues 112119) displaying the highest tendency to form amyloid (Gasset et al., 1992
). Peptides containing the AGAAAAGA motif are toxic to neurons in culture, whereby the sequence AGAAAAGA was found to be necessary but not sufficient for the neurotoxic effect (Brown, 2000a
; Forloni et al., 1993
). A recent study using in vitro conversion assays of PrPC to PK-resistant PrPSc indicates that synthetic peptides derived from the central part of PrPC (amino acids 106141) have an inhibitory effect on this conversion (Chabry et al., 1998
). The presence of residues 119 and 120 (the two last residues within the motif AGAAAAGA) seems to be crucial for this inhibitory effect, arguing for their involvement in the intermolecular interaction that leads to PK-resistant PrP. Mutant PrP molecules carrying deletions of amino acids 108121 or 114121 are not convertible to PrPSc when overexpressed in scrapie-infected neuroblastoma cells (Hölscher et al., 1998
; Muramoto et al., 1996
). The central hydrophobic region, spanning all or most of the sequence AGAAAAGA, therefore plays an important role in the conversion process.
For further insight into the function of this region, we decided to establish a cell culture model. To develop such a system, we expressed PrP molecules carrying mutations at and around this hydrophobic sequence in murine neuroblastoma cells and analysed the mutant proteins for proteolytic processing and resistance to protease. We report here that one of these mutant PrP molecules acquired protease resistance in comparison with wild-type PrP.
| Methods |
|---|
|
|
|---|
Reagents and antibodies.
Brain tissues and N2a cells.
Tissues were obtained from brain hemispheres of tg81 mice (Scott et al., 1989
), hamster and hamster infected with the scrapie strain 263K. The murine neuroblastoma cell line N(euro-)2a (Klebe & Ruddle, 1969
) was obtained from the ATCC. N2a cells were grown in DMEM containing 10% foetal calf serum and penicillin/streptomycin in an atmosphere of 10% CO2.
Mutant Prnp genes.
The generation of the plasmid pCI-Prnp has been described previously (Windl et al., 1999
). The hamster-specific 13A5 epitope was inserted into the wild-type Prnpa allele via overlap-extension (OE)-PCR (Higuchi et al., 1988
) by using the outer primers T3 (5' AATTAACCCTCACTAAAGGG 3') and T7neo (5' TAATACGACTCACTATAGG 3') and the overlapping primers 13A5up (5' CCAAAATGCATCATGGGCC 3') and 13A5do (5' CCCATGATGCATTTTGGCA 3'). After cleavage with XbaI and XhoI, the PCR product was cloned into the corresponding restriction sites of pCI-neo (Promega) to give pCI-Prnp13A5. Based on pCI-Prnp13A5, plasmid pCI-Prnp
SmaI, containing a Prnp gene without its original SmaI site, was established. The following primers were used in an OE-PCR:
SmaIup (5' CCCTGCCCAGGATACCGGC 3') and
SmaIdo (5' CGGTATCCTGGGCAGGGAAG 3').
Plasmid pCI-Prnp
SmaI was the starting point for pCI-Prnp
105125, pCI-PrnpA112119 and pCI-PrnpG112119. Plasmid pCI-Prnp
105125 was generated via OE-PCR by using the following overlapping primers:
105125up (5' CCAGCATGTACCCGGGTTTGCTGGGCTTGT 3') and
105125do (5' CAGCAAACCCGGGTACATGCTGGGGAGCG 3'). In addition to the deletion (codons 105125), this construct carried a new SmaI restriction site by changing codons 104 and 126 silently from CCA to CCC and from GGC to GGG. Constructs pCI-PrnpA112119 and pCI-PrnpG112119 were generated based on pCI-Prnp
105125. The primers A112119up (5'ACCAAGGCCCCCCACTACTGCCGCAGCTGCCG CAGCCGCTGCCACATGCTTGAGGTTGGTTTT3') and A112119do (5' AAAACCAACCTCAAGCATGTGGCAGCGGCTGCGGCA GCTGCGGCAGTAGTGGGGGGCCTTGGT3') or G112119up (5' ACCAAGGCCCCCCACTACTCCCCCACCTCCCCCACC CCCTCCCACATGCTTGAGGTTGGTTTT3') and G112119do (5' AAAACCAACCTCAAGCATGTGGGAGGGGGTGGGGGAGGTGGGGGAGTAGTGGGGGGCCT-TGGT 3') were hybridized with each other and the resulting fragments were cloned into the SmaI site of pCI-Prnp
105125 to give pCI-PrnpA112119 and pCI-PrnpG112119, respectively. The sequences of all modified Prnp genes were verified by DNA sequence analysis.
The plasmid pHA58 carries the hygromycin-resistance gene under the control of the murine pgk-1 promoter. The construction of the vector phCMV*-Prnp has been described previously (Windl et al., 1999
). This plasmid was originally derived from the plasmid pUHD 10-3 and carries the wild-type Prnpa allele under the control of the transactivator-responsive promoter (PhCMV*-1). The plasmids pCI-Prnp13A5 and pCI-PrnpG112119 were cleaved with XhoI and the plasmid pUHD 10-3 was cleaved with EcoRI. After blunting the 5' protruding ends of the three constructs with the Klenow fragment of DNA polymerase, these constructs were cleaved with XbaI. The inserts excised from pCI-Prnp13A5 and pCI-PrnpG112119 were cloned between the Klenow-treated EcoRI site and the XbaI site of pUHD 10-3 to produce phCMV*-Prnp 13A5 and phCMV*-PrnpG112119.
Construction of recombinant cell lines.
N2a cells were stably transfected with the different pCI-Prnp constructs using Effectene or Superfect (both from Qiagen) as transfection reagents according to the manufacturers instructions. After transfection, antibiotic-resistant cells were selected in 400 µg/ml geniticin (G418) and polyclonal cell lines were obtained after 4 weeks. The level of PrP overexpression in the different cell lines was assayed by Western blot analysis (see below).
The use of the tetracycline-inducible expression system required stably double-transfected N2a cell lines carrying the reverse transactivator as a first component and wild-type and G112119 moPrP genes under the control of the transactivator-responsive promoter as a second component. N2a clones expressing the first component, the reverse tetracycline-controlled transactivator (rtTA), have been established previously (Windl et al., 1999
). One of the resulting N2artTA clones (clone 1) was subjected to a second round of transfection, a co-transfection with either phCMV*-Prnp13A5 or phCMV*-PrnpG112119 combined with pHA58 (Prnp plasmid and hygromycin-resistance plasmid in a 19:1 mixture) using Effectene as the transfection reagent. Cells were selected in the presence of hygromycin (200 µg/ml) and geniticin (200 µg/ml).
Immunocytochemistry.
Cells were grown in 24-well plates and were fixed with 10% paraformaldehyde in PBS for 10 min or with methanol for 30 min at 4 °C. After rinsing with PBS, the cells were incubated with mouse mAb 3B5 at a dilution of 1:5 for 1 h at room temperature. Cells were rinsed and then incubated with TRITC-conjugated secondary antibody at a dilution of 1:200 for 30 min at room temperature. After rinsing, the cells were embedded in PBS and examined with a fluorescence microscope (Olympus).
Western blot analysis.
Cells grown in 75 cm2 tissue culture flasks were lysed in 500 µl ice-cold lysis buffer containing 50 mM TrisHCl, pH 7·5, 150 mM sodium chloride, 0·5% NP-40 and 0·5% sodium deoxycholate supplemented with 1 mM PMSF. Brain tissue was homogenized in 9 vols ice-cold lysis buffer. Where indicated, lysates or brain homogenates were treated with PNGase F according to the manufacturers instructions. Proteins were separated by SDSPAGE (12·5 or 15% acrylamide), transferred to a PVDF membrane and processed further as described elsewhere (LeGendre, 1990
). For detection of PrP and its fragments, the membrane was incubated with one of various primary antibodies at a dilution of either 1:2000 (13A5, 6H4 and Kan72) or 1:50 (3B5). This was followed by incubation with AP-conjugated goat anti-mouse or goat anti-rabbit antibody (diluted 1:1000). Immunopositive signals were detected by using the chemiluminescent substrate CDP-Star (Tropix) according to the manufacturers instructions. The light signals were monitored, documented and quantified with a CCD camera system (raytest) and the accompanying software (DIANA, TINA; raytest).
Assay of protease resistance.
Cell lysates were treated with PK at different concentrations (3·3, 10, 20 or 50 µg/ml) for 10 min at 37 °C or they were digested with 3·3 µg/ml PK at 37 °C for 0, 10, 20, 40 or 60 min, as described previously (Lehmann & Harris, 1996
). Proteolytic digestions were terminated by adding 2 mM PMSF and analysed directly by Western blot. The protease resistance of PrP in brain tissue from scrapie-infected hamster was analysed by digesting the homogenized brain with PK at a concentration of 20 µg/ml for 1 h at 37 °C. Digestion was terminated by the addition of 2 mM PMSF. Proteins in the brain homogenate were methanol-precipitated, denatured in 7 M guanidine hydrochloride and methanol-precipitated again. The resulting pellet was resuspended in lysis buffer.
| Results |
|---|
|
|
|---|
105125) had a deletion in the central region including AGAAAAGA. Wild-type and mutant moPrPs were epitopically tagged by substituting a methionine residue for an isoleucine at position 138 (Fig. 1
|
105125, G112119 and A112119 moPrPs were all detected on the surface of intact cells. The staining pattern around the cell periphery was similar before and after permeabilization (data not shown).
|
105125 protein bands were shifted to a lower molecular mass (Fig. 2f
105125 and wild-type moPrPs in stably transfected N2a cell lines were comparable, but were much higher than the expression of endogenous moPrP in normal N2a cells (see Fig. 3b
|
105125, G112119 and A112119 moPrPs (Fig. 3a
Treatment of cell lysates with PNGase F reduced the heterogeneity of the PrP-specific bands in 13A5-tagged wild-type, G112119 and A112119 moPrPs to a fragment of 27 kDa [indicated by PrP in Fig. 3a
(lanes 35) and b (lanes 13)], which is consistent with the molecular mass of full-length deglycosylated PrP containing the GPI anchor.
105125 moPrP showed the expected difference in molecular mass of about 2·3 kDa in comparison with wild-type moPrP (Fig. 3a
, lane 6; b, lane 4). A prominent band of 18 kDa (designated C1) was recognized by mAbs 13A5 and 6H4 in blots of wild-type and A112119 moPrPs [Fig. 3a
(13A5), lanes 3 and 4; b (6H4), lanes 1 and 2]. It corresponded in size with the major C-terminal fragment of PrPC in hamster and tg81 mice (Fig. 3a
, lanes 1 and 2). The PrP-specific fragment of 18 kDa was not detectable or was only weakly detectable with both antibodies in blots of
105125 and G112119 moPrPs [Fig. 3a
(lanes 5 and 6), b (lanes 3 and 4) and c]. This finding was highly significant and reproducible. These experiments showed that, while all mutants carried N-linked glycosylation, the amount of the potentially proteolytic fragment C1 was dependent on the mutation introduced.
G112119 moPrP is resistant to protease
In order to test the mutant moPrPs for protease resistance, the lysates were digested for 10 min with 3·3 µg/ml PK and treated with PNGase F to simplify the evaluation. Wild-type, A112119 and endogenous moPrPs, as well as PrP of tg81 mice, were completely degraded under these conditions (Fig. 4a
, lanes 2, 8, 10 and 12), but the mutant G112119 moPrP gave a clear protease-resistant signal that migrated in the 22 kDa range (Fig. 4a
, lane 6).
|
Doxycycline-induced expression of wild-type and G112119 moPrPs
The protease resistance of G112119 moPrP was examined further with the reverse tetracycline-inducible expression system. The two stably transfected cell lines rtTAwild-type and rtTAG112119 displayed inducibility (Fig. 5a
; compare lane 2 with lane 3 and lane 4 with lane 5) when tested for background expression before induction and overexpression after induction with doxycycline. The level of expression increased about 2- to 3-fold after induction with 2 µg/ml doxycycline in the medium for 20 h. Comparison of the amount of wild-type or G112119 moPrP in the uninduced state with the level of endogenous PrP in untransfected N2a cells shows a background of wild-type and G112119 moPrPs (Fig. 5a
, lanes 2 and 4).
|
The high level of expression of wild-type and G112119 moPrPs in the induced state gave us reason to test the extent of resistance to PK at higher concentrations. After induction for 20 h with 2 µg/ml doxycycline, we treated lysates of the N2a cell lines rtTAG112119 and rtTAwild-type with PK at concentrations of 3·3, 10, 20 and 50 µg/ml for 10 min (Fig. 5c
). Wild-type moPrP was degraded completely (Fig. 5c
, lanes 7 and 8), whereas immunoreactive G112119 moPrP still remained after digestion with 10 µg/ml PK (Fig. 5c
, lane 3). The amount was still about 12% of full-length G112119 moPrP (Fig. 5c
, compare lane 3 with lane 1).
By employing both a permanent and an inducible expression system, we could show that the acquisition of protease resistance is an intrinsic property of G112119 moPrP in N2a cells.
| Discussion |
|---|
|
|
|---|
A certain amount of normal PrPC is cleaved physiologically, which is identifiable by the presence of a C-terminal fragment (Chen et al., 1995
; Harris et al., 1993
; Jiménez-Huete et al., 1998
; Pan et al., 1992
). It is the amount of this C-terminal fragment relative to the full-length PrP that is altered substantially in two of the mutant PrPs presented here. It is easily conceivable why this might be a consequence of the extensive deletion in mutant
105125 moPrP, in which all residues N- and C-terminal to the putative cleavage site (residue 110 or 111) have been removed (Chen et al., 1995
). The strongly inhibitory effect of the mutant G112119 on the efficacy of cellular cleavage is probably determined directly by a mutation-induced alteration in protein conformation, but there are several possible explanations for how proteolytic processing is influenced by the altered structure of G112119 moPrP: (i) the mutated residues might themselves be a poor substrate for the putative cleaving enzyme; (ii) the structure of the whole protein might be changed and the cleavage site might be less accessible; or (iii) due to the mutation introduced, the protein might be distributed on the cell surface in a different manner and therefore be in infrequent contact with the processing enzyme.
Analysis of the protease resistance of the various PrP mutants showed that G112119 moPrP displayed resistance against PK digestion at a concentration of 3·3 µg/ml for 10 min at 37 °C. These conditions are much milder than those used in the detection of PrPSc in brain homogenates of diseased animals and humans (e.g. 20 µg/ml for 30 min at 37 °C; Büeler et al., 1994
), but were used by Lehmann & Harris (1997)
in the analysis of Prnp genes carrying human-pathogenic mutations. In the latter study, the authors found that, under such conditions, the introduction of the human-pathogenic mutations P102L, D178N, T183A and E200K and an insertion of six additional octapeptides in the ORF of Prnp at the respective locations (P101L, D177N, T183A and E199K) rendered the mutated proteins resistant to PK at the above concentration. The PK resistance was always accompanied by enhanced detergent-insolubility of the mutated proteins (Daude et al., 1997
; Lehmann & Harris, 1997
). Similar PK resistance was reported for pathogenic mutations by other groups (Priola & Chesebro, 1998
; Singh et al., 1997
) but, by and large, the low concentration of PK, the dependence of these results on the cell type used (Petersen et al., 1996
; Priola & Chesebro, 1998
) and the lack of demonstrable infectivity resulting from this type of protease resistance leave it open whether the generated protease-resistant PrP is low-concentration PrPSc or unrelated to infectivity. We could show that the extent of protease resistance of the mutant G112119 moPrP was slightly higher than under the standard conditions of 3·3 µg/ml for 10 min at 37 °C, but still much lower than the resistance of PrPSc in infected animals or in infected tissue culture (Hölscher et al., 1998
). Yet, protease resistance is an intrinsic property of G112119 moPrP in N2a cells and was not a chance event in a particular N2a cell clone, as we confirmed the protease resistance of this particular mutant by expressing it in a different expression system, the doxycycline-inducible expression system. So far, this system has only been used to express wild-type PrP genes in transgenic animals and N2a cells (Tremblay et al., 1998
; Windl et al., 1999
). The mutant G112119 moPrP showed a concurrent increase in the amount of protease-resistant PrP after induction of expression by doxycycline, indicating that the acquisition of protease resistance occurs soon after the biosynthesis of this mutant protein.
These findings have two general meanings for the conversion of certain mutant PrP molecules to protease-resistant isoforms. (i) The acquisition of a mild form of protease resistance of mutant prion proteins in tissue culture is not restricted to mutations known to cause inherited prion diseases in humans. This might point to the fact that there are many more (and probably more devastating) pathogenic mutations possible in PrP that might not exist in living animals because they interfere with the evolutionary success of the respective carrier. A recent study using peptides randomized in this hydrophobic domain supports this argument, as the author showed that these peptides are more toxic than the neurotoxic fragment 106126 (Brown, 2000a
). (ii) Changes in the central hydrophobic region have immediate consequences for the structure or the processing of PrP. This is in line with studies on other mutants in this domain that have used different experimental set-ups (Hegde et al., 1998
; Hölscher et al., 1998
; Muramoto et al., 1996
). Recently, an alternative topological variant of PrP called CtmPrP has been proposed as a key factor in the development of neurodegeneration in prion diseases (Hegde et al., 1998
, 1999
). The fragment size generated from CtmPrP by mild PK digestion was found to be smaller than PK-resistant PrPSc. The general importance of CtmPrP for the pathogenesis of prion diseases remains controversial (Stewart & Harris, 2001
).
Structural data on full-length recombinant PrP define the N-terminal half of the protein (residues 23120 in moPrP and residues 23124 in hamster PrP) as flexibly disordered or random-coil (Donne et al., 1997
; Riek et al., 1997
). Copper binding seems to confer a distinctive structure on the N-terminal octapeptide repeats (Viles et al., 1999
), but the motif AGAAAAGA is positioned at the hydrophobic C terminus of this unstructured part of PrP, and a recent refinement of the structure by Liu et al. (1999)
has confirmed that it does not adopt regular secondary structure. Yet, the latter authors found indications of multiple discrete conformations in this hydrophobic domain, which might imply that this region is metastable and could therefore play an essential role in the formation of PrPSc. It was suggested that PrPSc interacts with recombinant PrPC at amino acid residues 112119 of the mouse sequence (Brown, 2000b
), which might indicate that the sequence encompassing residues 112119 is of special importance to the conversion of PrPC to PrPSc. Copper ions reversibly induce PrPC to become protease-resistant (Quaglio et al., 2001
), but it remains to be seen in what way the binding of copper to the N-terminal repeats and the concomitant adoption of structure influences the structural transitions that potentially take place in this more C-terminal hydrophobic domain of the N terminus. Our data demonstrate that a certain mutation in the hydrophobic region induces the ready formation of PK-resistant PrP. Therefore, it can be hypothesized that this mutation stabilizes a conformation that shares features with the infectious form of PrP. Whether prion infectivity was generated de novo in tissue culture will be tested in future by using infectivity assays and transgenic animals.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Brandner, S., Isenmann, S., Raeber, A., Fischer, M., Sailer, A., Kobayashi, Y., Marino, S., Weissmann, C. & Aguzzi, A. (1996). Normal host prion protein necessary for scrapie-induced neurotoxicity. Nature 379, 339-343.[Medline]
Brown, D. R. (2000a). Prion protein peptides: optimal toxicity and peptide blockade of toxicity. Molecular and Cellular Neurosciences 15, 66-78.[Medline]
Brown, D. R. (2000b). PrPSc-like prion protein peptide inhibits the function of cellular prion protein. Biochemical Journal 352, 511-518.
Brown, D. R., Schmidt, B. & Kretzschmar, H. A. (1996). Role of microglia and host prion protein in neurotoxicity of prion protein fragment. Nature 380, 345-347.[Medline]
Brown, D. R., Qin, K., Herms, J. W., Madlung, A., Manson, J., Strome, R., Fraser, P. E., Kruck, T., von Bohlen, A., Schulz-Schaeffer, W., Giese, A., Westaway, D. & Kretzschmar, H. (1997a). The cellular prion protein binds copper in vivo. Nature 390, 684-687.[Medline]
Brown, D. R., Schulz-Schaeffer, W. J., Schmidt, B. & Kretzschmar, H. A. (1997b). Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Experimental Neurology 146, 104-112.[Medline]
Büeler, H., Aguzzi, A., Sailer, A., Greiner, R. A., Autenried, P., Aguet, M. & Weissmann, C. (1993). Mice devoid of PrP are resistant to scrapie. Cell 73, 1339-1347.[Medline]
Büeler, H., Raeber, A., Sailer, A., Fischer, M., Aguzzi, A. & Weissmann, C. (1994). High prion and PrPSc levels but delayed onset of disease in scrapie-inoculated mice heterozygous for a disrupted PrP gene. Molecular Medicine 1, 19-30.[Medline]
Caughey, B., Race, R. E., Ernst, D., Buchmeier, M. J. & Chesebro, B. (1989). Prion protein biosynthesis in scrapie-infected and uninfected neuroblastoma cells. Journal of Virology 63, 175-181.
Caughey, B. W., Dong, A., Bhat, K. S., Ernst, D., Hayes, S. F. & Caughey, W. S. (1991). Secondary structure analysis of the scrapie-associated protein PrP2730 in water by infrared spectroscopy. Biochemistry 30, 7672-7680.[Medline]
Chabry, J., Caughey, B. & Chesebro, B. (1998). Specific inhibition of in vitro formation of protease-resistant prion protein by synthetic peptides. Journal of Biological Chemistry 273, 13203-13207.
Chen, S. G., Teplow, D. B., Parchi, P., Teller, J. K., Gambetti, P. & Autilio-Gambetti, L. (1995). Truncated forms of the human prion protein in normal brain and in prion diseases. Journal of Biological Chemistry 270, 19173-19180.
Daude, N., Lehmann, S. & Harris, D. A. (1997). Identification of intermediate steps in the conversion of a mutant prion protein to a scrapie-like form in cultured cells. Journal of Biological Chemistry 272, 11604-11612.
Donne, D. G., Viles, J. H., Groth, D., Mehlhorn, I., James, T. L., Cohen, F. E., Prusiner, S. B., Wright, P. E. & Dyson, H. J. (1997). Structure of recombinant full-length hamster prion protein PrP(29231): the N terminus is highly flexible. Proceedings of the National Academy of Sciences, USA 94, 13452-13457.
Forloni, G., Angeretti, N., Chiesa, R., Monzani, E., Salmona, M., Bugiani, O. & Tagliavini, F. (1993). Neurotoxicity of a prion protein fragment. Nature 362, 543-546.[Medline]
Gasset, M., Baldwin, M. A., Lloyd, D. H., Gabriel, J.-M., Holtzman, D. M., Cohen, F., Fletterick, R. & Prusiner, S. B. (1992). Predicted
-helical regions of the prion protein when synthesized as peptides form amyloid. Proceedings of the National Academy of Sciences, USA 89, 10940-10944.
Haraguchi, T., Fisher, S., Olofsson, S., Endo, T., Groth, D., Tarentino, A., Borchelt, D. R., Teplow, D., Hood, L., Burlingame, A., Lycke, E., Kobata, A. & Prusiner, S. B. (1989). Asparagine-linked glycosylation of the scrapie and cellular prion proteins. Archives of Biochemistry and Biophysics 274, 1-13.[Medline]
Harris, D. A., Huber, M. T., van Dijken, P., Shyng, S. L., Chait, B. T. & Wang, R. (1993). Processing of a cellular prion protein: identification of N- and C-terminal cleavage sites. Biochemistry 32, 1009-1016.[Medline]
Hegde, R. S., Mastrianni, J. A., Scott, M. R., DeFea, K. A., Tremblay, P., Torchia, M., DeArmond, S. J., Prusiner, S. B. & Lingappa, V. R. (1998). A transmembrane form of the prion protein in neurodegenerative disease. Science 279, 827-834.
Hegde, R. S., Tremblay, P., Groth, D., DeArmond, S. J., Prusiner, S. B. & Lingappa, V. R. (1999). Transmissible and genetic prion diseases share a common pathway of neurodegeneration. Nature 402, 822-826.[Medline]
Herms, J., Tings, T., Gall, S., Madlung, A., Giese, A., Siebert, H., Schürmann, P., Windl, O., Brose, N. & Kretzschmar, H. (1999). Evidence of presynaptic location and function of the prion protein. Journal of Neuroscience 19, 8866-8875.
Higuchi, R., Krummel, B. & Saiki, R. K. (1988). A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Research 16, 7351-7367.
Hölscher, C., Delius, H. & Bürkle, A. (1998). Overexpression of nonconvertible PrPc
114121 in scrapie-infected mouse neuroblastoma cells leads to trans-dominant inhibition of wild-type PrPSc accumulation. Journal of Virology 72, 1153-1159.
Hornemann, S., Korth, C., Oesch, B., Riek, R., Wider, G., Wüthrich, K. & Glockshuber, R. (1997). Recombinant full-length murine prion protein, mPrP(23231): purification and spectroscopic characterization. FEBS Letters 413, 277-281.[Medline]
Ivanova, L., Barmada, S., Kummer, T. & Harris, D. A. (2001). Mutant prion proteins are partially retained in the endoplasmic reticulum. Journal of Biological Chemistry 276, 42409-42421.
Jiménez-Huete, A., Lievens, P. M. J., Vidal, R., Piccardo, P., Ghetti, B., Tagliavini, F., Frangione, B. & Prelli, F. (1998). Endogenous proteolytic cleavage of normal and disease-associated isoforms of the human prion protein in neural and non-neural tissues. American Journal of Pathology 153, 1561-1572.
Klebe, R. J. & Ruddle, F. H. (1969). Neuroblastoma: cell culture analysis of a differentiating stem cell system. Journal of Cell Biology 43, 69a.
Korth, C., Stierli, B., Streit, P., Moser, M., Schaller, O., Fischer, R., Schulz-Schaeffer, W., Kretzschmar, H., Raeber, A., Braun, U., Ehrensperger, F., Hornemann, S., Glockshuber, R., Riek, R., Billeter, M., Wüthrich, K. & Oesch, B. (1997). Prion (PrPSc)-specific epitope defined by a monoclonal antibody. Nature 390, 74-77.[Medline]
Krasemann, S., Groschup, M. H., Harmeyer, S., Hunsmann, G. & Bodemer, W. (1996). Generation of monoclonal antibodies against human prion proteins in PrP0/0 mice. Molecular Medicine 2, 725-734.[Medline]
LeGendre, N. (1990). Immobilon-P transfer membrane: applications and utility in protein biochemical analysis. Biotechniques 9, 788-805.[Medline]
Lehmann, S. & Harris, D. A. (1996). Mutant and infectious prion proteins display common biochemical properties in cultured cells. Journal of Biological Chemistry 271, 1633-1637.
Lehmann, S. & Harris, D. A. (1997). Blockade of glycosylation promotes acquisition of scrapie-like properties by the prion protein in cultured cells. Journal of Biological Chemistry 272, 21479-21487.
Liu, H., Farr-Jones, S., Ulyanov, N. B., Llinas, M., Marqusee, S., Groth, D., Cohen, F. E., Prusiner, S. B. & James, T. L. (1999). Solution structure of Syrian hamster prion protein rPrP(90231). Biochemistry 38, 5362-5377.[Medline]
Mouillet-Richard, S., Ermonval, M., Chebassier, C., Laplanche, J. L., Lehmann, S., Launay, J. M. & Kellermann, O. (2000). Signal transduction through prion protein. Science 289, 1925-1928.
Muramoto, T., Scott, M., Cohen, F. E. & Prusiner, S. B. (1996). Recombinant scrapie-like prion protein of 106 amino acids is soluble. Proceedings of the National Academy of Sciences, USA 93, 15457-15462.
Pan, K. M., Stahl, N. & Prusiner, S. B. (1992). Purification and properties of the cellular prion protein from Syrian hamster brain. Protein Science 1, 1343-1352.[Medline]
Pan, K.-M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A., Groth, D., Mehlhorn, I., Huang, Z., Fletterick, R. J., Cohen, F. E. & Prusiner, S. B. (1993). Conversion of
-helices into
-sheets features in the formation of the scrapie prion proteins. Proceedings of the National Academy of Sciences, USA 90, 10962-10966.
Petersen, R. B., Parchi, P., Richardson, S. L., Urig, C. B. & Gambetti, P. (1996). Effect of the D178N mutation and the codon 129 polymorphism on the metabolism of the prion protein. Journal of Biological Chemistry 271, 12661-12668.
Priola, S. A. & Chesebro, B. (1998). Abnormal properties of prion protein with insertional mutations in different cell types. Journal of Biological Chemistry 273, 11980-11985.
Prusiner, S. B. & DeArmond, S. J. (1994). Prion diseases and neurodegeneration. Annual Review of Neuroscience 17, 311-339.[Medline]
Prusiner, S. B., Telling, G., Cohen, F. E. & DeArmond, S. J. (1996). Prion diseases of humans and animals. Seminars in Virology 7, 159-173.
Quaglio, E., Chiesa, R. & Harris, D. A. (2001). Copper converts the cellular prion protein into a protease-resistant species that is distinct from the scrapie isoform. Journal of Biological Chemistry 276, 11432-11438.
Riek, R., Hornemann, S., Wider, G., Billeter, M., Glockshuber, R. & Wüthrich, K. (1996). NMR structure of the mouse prion protein domain PrP(121231). Nature 382, 180-182.[Medline]
Riek, R., Hornemann, S., Wider, G., Glockshuber, R. & Wüthrich, K. (1997). NMR characterization of the full-length recombinant murine prion protein, mPrP(23231). FEBS Letters 413, 282-288.[Medline]
Rogers, M., Serban, D., Gyuris, T., Scott, M., Torchia, T. & Prusiner, S. B. (1991). Epitope mapping of the Syrian hamster prion protein utilizing chimeric and mutant genes in a vaccinia virus expression system. Journal of Immunology 147, 3568-3574.[Abstract]
Safar, J., Roller, P. P., Gadjusek, D. C. & Gibbs, C. J.Jr(1993). Conformational transitions, dissociation, and unfolding of scrapie amyloid (prion) protein. Journal of Biological Chemistry 268, 20276-20284.
Scott, M., Foster, D., Mirenda, C., Serban, D., Coufal, F., Wälchli, M., Torchia, M., Groth, D., Carlson, G., DeArmond, S. J., Westaway, D. & Prusiner, S. B. (1989). Transgenic mice expressing hamster prion protein produce species-specific scrapie infectivity and amyloid plaques. Cell 59, 847-857.[Medline]
Shyng, S. L., Huber, M. T. & Harris, D. A. (1993). A prion protein cycles between the cell surface and an endocytic compartment in cultured neuroblastoma cells. Journal of Biological Chemistry 268, 15922-15928.
Singh, N., Zanusso, G., Chen, S. G., Fujioka, H., Richardson, S., Gambetti, P. & Petersen, R. B. (1997). Prion protein aggregation reverted by low temperature in transfected cells carrying a prion protein gene mutation. Journal of Biological Chemistry 272, 28461-28470.
Stewart, R. S. & Harris, D. A. (2001). Most pathogenic mutations do not alter the membrane topology of the prion protein. Journal of Biological Chemistry 276, 2212-2220.
Tremblay, P., Meiner, Z., Galou, M., Heinrich, C., Petromilli, C., Lisse, T., Cayetano, J., Torchia, M., Mobley, W., Bujard, H., DeArmond, S. J. & Prusiner, S. B. (1998). Doxycycline control of prion protein transgene expression modulates prion disease in mice. Proceedings of the National Academy of Sciences, USA 95, 12580-12585.
Viles, J. H., Cohen, F. E., Prusiner, S. B., Goodin, D. B., Wright, P. E. & Dyson, H. J. (1999). Copper binding to the prion protein: structural implications of four identical cooperative binding sites. Proceedings of the National Academy of Sciences, USA 96, 2042-2047.
Windl, O., Lorenz, H., Behrens, C., Römer, A. & Kretzschmar, H. A. (1999). Construction and characterization of murine neuroblastoma cell clones allowing inducible and high expression of the prion protein. Journal of General Virology 80, 15-21.[Abstract]
Received 10 August 2001;
accepted 14 December 2001.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |