J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wegner, C.
Right arrow Articles by Kretzschmar, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wegner, C.
Right arrow Articles by Kretzschmar, H. A.
Agricola
Right arrow Articles by Wegner, C.
Right arrow Articles by Kretzschmar, H. A.
Journal of General Virology (2002), 83, 1237-1245.
© 2002 Society for General Microbiology


Other Agents

Mutant prion protein acquires resistance to protease in mouse neuroblastoma cells

C. Wegnerb,1, A. Römer1, R. Schmalzbauer2, H. Lorenz2, O. Windl2 and H. A. Kretzschmar2

Institut für Neuropathologie, Universität Göttingen, Robert-Koch-Str. 40, D-37075 Göttingen, Germany1
Institut für Neuropathologie, Ludwig-Maximilians-Universität München, Marchioninistr. 17, D-81377 München, Germany2

Authors for correspondence: Hans Kretzschmar and Otto Windl. Fax +49 89 70954903. e-mail Hans.Kretzschmar{at}inp.med.uni-muenchen.de, Otto.Windl@inp.med.uni-muenchen.de


   Abstract
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Conversion of the cellular isoform of the prion protein (PrPC) into the pathogenic isoform (PrPSc) is thought to be the causative event in prion diseases. Biochemically, PrPSc differs from PrPC in its partial resistance to proteinase K (PK). The amino acid sequence AGAAAAGA, comprising residues 112–119 of the murine PrPC, has been shown to be amyloidogenic and evolutionarily conserved. To assess the effect of mutations at and around this hydrophobic sequence on protease resistance, the sequence was replaced either by alanines or by glycines and, in a third mutant, a large part surrounding this region was removed. The PrP mutant carrying substitutions of glycines for alanines showed PK resistance and aberrant proteolytic processing. Tetracycline-induced expression of this mutant indicated that resistance to protease is acquired concurrent with the synthesis of the protein. These findings indicate that mutations in the central hydrophobic region lead to immediate alterations in PrP structure and processing.


   Introduction
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Prion diseases (transmissible spongiform encephalopathies) are fatal neurodegenerative diseases that include Creutzfeldt–Jakob disease, kuru, Gerstmann–Sträussler–Scheinker syndrome and fatal familial insomnia in humans, scrapie in sheep and bovine spongiform encephalopathy in cattle (Prusiner et al., 1996Down ). Prion diseases can be acquired or inherited or are of idiopathic origin. Inherited forms show an autosomal dominant trait and are linked to point or insertional mutations in the PrP gene (PRNP in humans, Prnp in mice) encoding the prion protein (PrP) (Prusiner & DeArmond, 1994Down ). Prion diseases are characterized by the accumulation of a proteinase K (PK)-resistant isoform (PrPSc) of the cellular protease-sensitive prion protein (PrPC).

PrPC, a neuronal glycoprotein, is anchored to the plasma membrane by a glycosylphosphatidylinositol (GPI) moiety. The function of PrPC, which is a copper-binding protein (Brown et al., 1997aDown ), is still not clearly understood. Recent data point to a function in synaptic interaction (Herms et al., 1999Down ), resistance of neurons to oxidative stress (Brown et al., 1997bDown ) or signal transduction (Mouillet-Richard et al., 2000Down ).

Studies investigating PrPC metabolism have demonstrated that PrPC turns over with a half-life of 3–6 h in mouse neuroblastoma cells (Borchelt et al., 1990Down ; Caughey et al., 1989Down ). Chicken PrPC has been shown to recycle between the plasma membrane and an endosomal compartment (Shyng et al., 1993Down ). During its normal processing, PrPC is cleaved at the central hydrophobic region, yielding a C-terminal, GPI-anchored fragment that can be identified in brain tissue and in cultured cells (Chen et al., 1995Down ; Harris et al., 1993Down ; Jiménez-Huete et al., 1998Down ; Pan et al., 1992Down ).

PrPSc is derived from PrPC by a post-translational process that seems to involve species-specific molecular interactions between the two isoforms. PrPC is necessary for infectivity and pathology, as demonstrated by experiments showing complete resistance of Prnp-knockout mice to infection with prions (Brandner et al., 1996Down ; Brown et al., 1996Down ; Büeler et al., 1993Down ). PrPC is rich in {alpha}-helices, while PrPSc exhibits a greater content of {beta}-sheets (Caughey et al., 1991Down ; Pan et al., 1993Down ; Safar et al., 1993Down ). The nuclear magnetic resonance structure of full-length recombinant PrPC revealed that the region comprising amino acids 121–231 contains a high level of secondary structure, including three {alpha}-helices and a two-stranded antiparallel {beta}-sheet, whereas the N terminus is highly flexible (Hornemann et al., 1997Down ; Riek et al., 1996Down , 1997Down ). Copper binding seems to confer a distinct structure on the N terminus (Viles et al., 1999Down ). Synthesized peptides that are homologous to residues 109–122 and 106–126 form {beta}-sheets spontaneously (Forloni et al., 1993Down ; Gasset et al., 1992Down ), with the internal sequence AGAAAAGA (residues 112–119) displaying the highest tendency to form amyloid (Gasset et al., 1992Down ). Peptides containing the AGAAAAGA motif are toxic to neurons in culture, whereby the sequence AGAAAAGA was found to be necessary but not sufficient for the neurotoxic effect (Brown, 2000aDown ; Forloni et al., 1993Down ). A recent study using in vitro conversion assays of PrPC to PK-resistant PrPSc indicates that synthetic peptides derived from the central part of PrPC (amino acids 106–141) have an inhibitory effect on this conversion (Chabry et al., 1998Down ). The presence of residues 119 and 120 (the two last residues within the motif AGAAAAGA) seems to be crucial for this inhibitory effect, arguing for their involvement in the intermolecular interaction that leads to PK-resistant PrP. Mutant PrP molecules carrying deletions of amino acids 108–121 or 114–121 are not convertible to PrPSc when overexpressed in scrapie-infected neuroblastoma cells (Hölscher et al., 1998Down ; Muramoto et al., 1996Down ). The central hydrophobic region, spanning all or most of the sequence AGAAAAGA, therefore plays an important role in the conversion process.

For further insight into the function of this region, we decided to establish a cell culture model. To develop such a system, we expressed PrP molecules carrying mutations at and around this hydrophobic sequence in murine neuroblastoma cells and analysed the mutant proteins for proteolytic processing and resistance to protease. We report here that one of these mutant PrP molecules acquired protease resistance in comparison with wild-type PrP.


   Methods
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Reagents and antibodies.
DNA-modifying enzymes were purchased from Promega and dideoxy-sequencing reagents from Amersham. Cell-culture reagents were obtained from Biochrom KG. N-Glycosidase F (PNGase F) was purchased from New England BioLabs. All other reagents were from Sigma. The following PrP-specific antibodies were used: mouse mAb 3B5, directed against amino acids 68–84 of human PrP (Krasemann et al., 1996Down ), mAb 6H4, directed against amino acids 155–163 of bovine PrP (Korth et al., 1997Down ), mAb 13A5, directed against an epitope of Syrian hamster PrP (Rogers et al., 1991Down ), and polyclonal antibody Kan72, directed against amino acids 89–103 of murine PrP (moPrP) (Hölscher et al., 1998Down ). Alkaline phosphatase (AP)-conjugated goat anti-mouse antibody was from Dianova and the AP-conjugated goat anti-rabbit antibody from Dako. TRITC-coupled goat anti-mouse antibody was purchased by Dianova.

{blacksquare} Brain tissues and N2a cells.
Tissues were obtained from brain hemispheres of tg81 mice (Scott et al., 1989Down ), hamster and hamster infected with the scrapie strain 263K. The murine neuroblastoma cell line N(euro-)2a (Klebe & Ruddle, 1969Down ) was obtained from the ATCC. N2a cells were grown in DMEM containing 10% foetal calf serum and penicillin/streptomycin in an atmosphere of 10% CO2.

{blacksquare} Mutant Prnp genes.
The generation of the plasmid pCI-Prnp has been described previously (Windl et al., 1999Down ). The hamster-specific 13A5 epitope was inserted into the wild-type Prnpa allele via overlap-extension (OE)-PCR (Higuchi et al., 1988Down ) by using the outer primers T3 (5' AATTAACCCTCACTAAAGGG 3') and T7neo (5' TAATACGACTCACTATAGG 3') and the overlapping primers 13A5up (5' CCAAAATGCATCATGGGCC 3') and 13A5do (5' CCCATGATGCATTTTGGCA 3'). After cleavage with XbaI and XhoI, the PCR product was cloned into the corresponding restriction sites of pCI-neo (Promega) to give pCI-Prnp13A5. Based on pCI-Prnp13A5, plasmid pCI-Prnp{Delta}SmaI, containing a Prnp gene without its original SmaI site, was established. The following primers were used in an OE-PCR: {Delta}SmaIup (5' CCCTGCCCAGGATACCGGC 3') and {Delta}SmaIdo (5' CGGTATCCTGGGCAGGGAAG 3').

Plasmid pCI-Prnp{Delta}SmaI was the starting point for pCI-Prnp{Delta}105–125, pCI-PrnpA112–119 and pCI-PrnpG112–119. Plasmid pCI-Prnp{Delta}105–125 was generated via OE-PCR by using the following overlapping primers: {Delta}105–125up (5' CCAGCATGTACCCGGGTTTGCTGGGCTTGT 3') and {Delta}105–125do (5' CAGCAAACCCGGGTACATGCTGGGGAGCG 3'). In addition to the deletion (codons 105–125), this construct carried a new SmaI restriction site by changing codons 104 and 126 silently from CCA to CCC and from GGC to GGG. Constructs pCI-PrnpA112–119 and pCI-PrnpG112–119 were generated based on pCI-Prnp{Delta}105–125. The primers A112–119up (5'ACCAAGGCCCCCCACTACTGCCGCAGCTGCCG CAGCCGCTGCCACATGCTTGAGGTTGGTTTT3') and A112–119do (5' AAAACCAACCTCAAGCATGTGGCAGCGGCTGCGGCA GCTGCGGCAGTAGTGGGGGGCCTTGGT3') or G112–119up (5' ACCAAGGCCCCCCACTACTCCCCCACCTCCCCCACC CCCTCCCACATGCTTGAGGTTGGTTTT3') and G112–119do (5' AAAACCAACCTCAAGCATGTGGGAGGGGGTGGGGGAGGTGGGGGAGTAGTGGGGGGCCT-TGGT 3') were hybridized with each other and the resulting fragments were cloned into the SmaI site of pCI-Prnp{Delta}105–125 to give pCI-PrnpA112–119 and pCI-PrnpG112–119, respectively. The sequences of all modified Prnp genes were verified by DNA sequence analysis.

The plasmid pHA58 carries the hygromycin-resistance gene under the control of the murine pgk-1 promoter. The construction of the vector phCMV*-Prnp has been described previously (Windl et al., 1999Down ). This plasmid was originally derived from the plasmid pUHD 10-3 and carries the wild-type Prnpa allele under the control of the transactivator-responsive promoter (PhCMV*-1). The plasmids pCI-Prnp13A5 and pCI-PrnpG112–119 were cleaved with XhoI and the plasmid pUHD 10-3 was cleaved with EcoRI. After blunting the 5' protruding ends of the three constructs with the Klenow fragment of DNA polymerase, these constructs were cleaved with XbaI. The inserts excised from pCI-Prnp13A5 and pCI-PrnpG112–119 were cloned between the Klenow-treated EcoRI site and the XbaI site of pUHD 10-3 to produce phCMV*-Prnp 13A5 and phCMV*-PrnpG112–119.

{blacksquare} Construction of recombinant cell lines.
N2a cells were stably transfected with the different pCI-Prnp constructs using Effectene or Superfect (both from Qiagen) as transfection reagents according to the manufacturer’s instructions. After transfection, antibiotic-resistant cells were selected in 400 µg/ml geniticin (G418) and polyclonal cell lines were obtained after 4 weeks. The level of PrP overexpression in the different cell lines was assayed by Western blot analysis (see below).

The use of the tetracycline-inducible expression system required stably double-transfected N2a cell lines carrying the reverse transactivator as a first component and wild-type and G112–119 moPrP genes under the control of the transactivator-responsive promoter as a second component. N2a clones expressing the first component, the reverse tetracycline-controlled transactivator (rtTA), have been established previously (Windl et al., 1999Down ). One of the resulting N2a–rtTA clones (clone 1) was subjected to a second round of transfection, a co-transfection with either phCMV*-Prnp13A5 or phCMV*-PrnpG112–119 combined with pHA58 (Prnp plasmid and hygromycin-resistance plasmid in a 19:1 mixture) using Effectene as the transfection reagent. Cells were selected in the presence of hygromycin (200 µg/ml) and geniticin (200 µg/ml).

{blacksquare} Immunocytochemistry.
Cells were grown in 24-well plates and were fixed with 10% paraformaldehyde in PBS for 10 min or with methanol for 30 min at 4 °C. After rinsing with PBS, the cells were incubated with mouse mAb 3B5 at a dilution of 1:5 for 1 h at room temperature. Cells were rinsed and then incubated with TRITC-conjugated secondary antibody at a dilution of 1:200 for 30 min at room temperature. After rinsing, the cells were embedded in PBS and examined with a fluorescence microscope (Olympus).

{blacksquare} Western blot analysis.
Cells grown in 75 cm2 tissue culture flasks were lysed in 500 µl ice-cold lysis buffer containing 50 mM Tris–HCl, pH 7·5, 150 mM sodium chloride, 0·5% NP-40 and 0·5% sodium deoxycholate supplemented with 1 mM PMSF. Brain tissue was homogenized in 9 vols ice-cold lysis buffer. Where indicated, lysates or brain homogenates were treated with PNGase F according to the manufacturer’s instructions. Proteins were separated by SDS–PAGE (12·5 or 15% acrylamide), transferred to a PVDF membrane and processed further as described elsewhere (LeGendre, 1990Down ). For detection of PrP and its fragments, the membrane was incubated with one of various primary antibodies at a dilution of either 1:2000 (13A5, 6H4 and Kan72) or 1:50 (3B5). This was followed by incubation with AP-conjugated goat anti-mouse or goat anti-rabbit antibody (diluted 1:1000). Immunopositive signals were detected by using the chemiluminescent substrate CDP-Star (Tropix) according to the manufacturer’s instructions. The light signals were monitored, documented and quantified with a CCD camera system (raytest) and the accompanying software (DIANA, TINA; raytest).

{blacksquare} Assay of protease resistance.
Cell lysates were treated with PK at different concentrations (3·3, 10, 20 or 50 µg/ml) for 10 min at 37 °C or they were digested with 3·3 µg/ml PK at 37 °C for 0, 10, 20, 40 or 60 min, as described previously (Lehmann & Harris, 1996Down ). Proteolytic digestions were terminated by adding 2 mM PMSF and analysed directly by Western blot. The protease resistance of PrP in brain tissue from scrapie-infected hamster was analysed by digesting the homogenized brain with PK at a concentration of 20 µg/ml for 1 h at 37 °C. Digestion was terminated by the addition of 2 mM PMSF. Proteins in the brain homogenate were methanol-precipitated, denatured in 7 M guanidine hydrochloride and methanol-precipitated again. The resulting pellet was resuspended in lysis buffer.


   Results
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Overexpression of wild-type and mutant moPrPs in N2a cells
The wild-type moPrP contains the highly amyloidogenic sequence AGAAAAGA (positions 112–119) in the central region comprising residues 105–125 (Fig. 1Down). We generated several mutations in this sequence motif of PrP to study the fate of these mutant prion proteins at the cellular level. Two mutant moPrPs carried exclusively either glycine or alanine residues instead of the AGAAAAGA sequence (designated G112–119 or A112–119). A third mutant form of moPrP (designated {Delta}105–125) had a deletion in the central region including AGAAAAGA. Wild-type and mutant moPrPs were epitopically tagged by substituting a methionine residue for an isoleucine at position 138 (Fig. 1Down). The introduction of this epitope into moPrP allowed the detection of the protein by the mAb 13A5 (Rogers et al., 1991Down ). The wild-type and mutant moPrP genes were positioned under the control of the strong hCMV promoter and stably transfected into N2a cells.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Scheme of wild-type and mutant moPrPs. The coding regions of the normal (moPrP) and mutant Prnp genes [WT (13A5-tagged), A112–119, G112–119 and {Delta}105–125] are depicted by bars. Numbers indicate amino acid positions, CHO indicates N-glycosylation sites and GPI indicates the attachment site of the glycolipid anchor. The signal sequence and the octapeptide repeat region are highlighted by shaded bars. The replacement of an isoleucine (I) by a methionine (M) at position 138 creates an epitope for the hamster-PrP-specific mAb 13A5 (Rogers et al., 1991Down ). The hatched box depicts the highly amyloidogenic region AGAAAAGA, and the amino acid changes in A112–119 and G112–119 are recorded.

 
In order to determine whether the mutant PrP molecules were expressed and delivered to the cell surface, we performed immunofluorescence microscopy with stably transfected polyclonal lines of N2a cells. Only overexpressed exogenous PrP (Fig. 2a–dDown), and not endogenous PrP of untransfected N2a cells (Fig. 2eDown), was detectable. Overexpressed wild-type, {Delta}105–125, G112–119 and A112–119 moPrPs were all detected on the surface of intact cells. The staining pattern around the cell periphery was similar before and after permeabilization (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. Overexpression of wild-type, {Delta}105–125, G112–119 and A112–119 moPrPs. (a)–(e) N2a cell lines overexpressing wild-type (WT) (a), A112–119 (b), G112–119 (c) and {Delta}105–125 moPrP (d) as well as normal N2a cells (e) were labelled with mouse mAb 3B5 and stained with a fluorescein-coupled secondary antibody. Cells were observed by immunofluorescence microscopy. The exposure time was chosen to detect only overexpressed exogenous PrP. (f) Lysates of stably transfected N2a cell lines overexpressing wild-type (lane 1) and mutant (lanes 2–4) moPrPs were analysed by immunoblotting with mouse mAb 3B5. Equal amounts (100 µg) of protein were loaded in all lanes of the polyacrylamide gel. Positions of marker proteins are indicated.

 
The size and glycosylation pattern of the mutant proteins were examined by Western blot (Fig. 2fUp). All four recombinant PrP molecules migrated as a series of three bands, which represent the un-, mono- and diglycosylated forms of the proteins. Wild-type, G112–119 and A112–119 moPrPs (Fig. 2fUp, lanes 1–3) were the same size as PrPC from other sources, whereas the {Delta}105–125 protein bands were shifted to a lower molecular mass (Fig. 2fUp, lane 4; also see Fig. 3Down). The levels of expression of A112–119, G112–119, {Delta}105–125 and wild-type moPrPs in stably transfected N2a cell lines were comparable, but were much higher than the expression of endogenous moPrP in normal N2a cells (see Fig. 3bDown).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3. Characterization of proteolytic fragments of wild-type (WT), {Delta}105–125, G112–119 and A112–119 moPrPs. (a)–(b) Brain homogenates of normal hamster and tg81 mice (a, lanes 1 and 2) and lysates of N2a cell lines overexpressing recombinant moPrP (a, lanes 3–6; b, lanes 1–4) as well as normal N2a cells (a, lane 7; b, lane 5) were treated with PNGase F for 3 h. Equal amounts (100 µg) of deglycosylated proteins were subjected to immunoblotting with the monoclonal antibodies 13A5 (a) and 6H4 (b). The positions of full-length PrP and the C-terminal fragment (C1) are indicated to the left and positions of marker proteins are indicated to the right. (c) Quantification of the immunopositive signals of the C-terminal fragment (C1) compared with the amount of full-length PrP in the different mutants following staining with antibody 6H4. The ratio between the C1 fragment and full-length PrP was determined for each lane and means were calculated. Bars indicate standard deviations based on three experiments.

 
Examination of PrP-specific fragments following deglycosylation
The sugar moieties of wild-type PrPC are N-linked and can be cleaved from their respective asparagines by PNGase F, giving rise to a protein of 27 kDa (Haraguchi et al., 1989Down ). In order to study the PrP-specific fragments of the mutant moPrPs following deglycosylation, we performed Western blot analysis with different antibodies. Mouse mAb 13A5 immunoreacted with the 13A5-tagged wild-type, {Delta}105–125, G112–119 and A112–119 moPrPs (Fig. 3aUp, lanes 3–6) as well as with hamster PrP in normal hamster or tg81 mice (Fig. 3aUp, lanes 1 and 2), but could not detect untagged endogenous PrP of normal N2a cells (Fig. 3aUp, lane 7). mAb 6H4, which reacted with normal moPrP, also failed to detect endogenous PrP (Fig. 3bUp, lane 5) due to the low level of expression.

Treatment of cell lysates with PNGase F reduced the heterogeneity of the PrP-specific bands in 13A5-tagged wild-type, G112–119 and A112–119 moPrPs to a fragment of 27 kDa [indicated by PrP in Fig. 3aUp (lanes 3–5) and b (lanes 1–3)], which is consistent with the molecular mass of full-length deglycosylated PrP containing the GPI anchor. {Delta}105–125 moPrP showed the expected difference in molecular mass of about 2·3 kDa in comparison with wild-type moPrP (Fig. 3aUp, lane 6; b, lane 4). A prominent band of 18 kDa (designated C1) was recognized by mAbs 13A5 and 6H4 in blots of wild-type and A112–119 moPrPs [Fig. 3aUp (13A5), lanes 3 and 4; b (6H4), lanes 1 and 2]. It corresponded in size with the major C-terminal fragment of PrPC in hamster and tg81 mice (Fig. 3aUp, lanes 1 and 2). The PrP-specific fragment of 18 kDa was not detectable or was only weakly detectable with both antibodies in blots of {Delta}105–125 and G112–119 moPrPs [Fig. 3aUp (lanes 5 and 6), b (lanes 3 and 4) and c]. This finding was highly significant and reproducible. These experiments showed that, while all mutants carried N-linked glycosylation, the amount of the potentially proteolytic fragment C1 was dependent on the mutation introduced.

G112–119 moPrP is resistant to protease
In order to test the mutant moPrPs for protease resistance, the lysates were digested for 10 min with 3·3 µg/ml PK and treated with PNGase F to simplify the evaluation. Wild-type, A112–119 and endogenous moPrPs, as well as PrP of tg81 mice, were completely degraded under these conditions (Fig. 4aDown, lanes 2, 8, 10 and 12), but the mutant G112–119 moPrP gave a clear protease-resistant signal that migrated in the 22 kDa range (Fig. 4aDown, lane 6).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4. Protease resistance of mutant moPrPs. (a) Protein lysates of N2a cell lines overexpressing recombinant moPrP (lanes 1–8), lysate from normal N2a cells (lanes 9 and 10) or lysate from brain homogenate of tg81 mice (lanes 11 and 12) were treated with PK (3·3 µg/ml) at 37 °C for 10 min (+) or left undigested (-). All lysates were incubated with PNGase F for 3 h and equal amounts of protein (100 µg) were analysed by Western blot using the rabbit polyclonal antiserum Kan72. (b) Equal amounts (100 µg) of lysates of N2a cells overexpressing wild-type moPrP (lanes 1–5) or G112–119 moPrP (lanes 6–10) were digested at 37 °C for 0, 10, 20, 40 or 60 min with PK (3·3 µg/ml). An equivalent amount of brain homogenate from hamster scrapie was left undigested (lane 11) or treated with PK (20 µg/ml) at 37 °C for 60 min (lane 12). Positions of marker proteins are indicated.

 
To assess the extent of protease-resistance of G112–119, we subjected lysates of G112–119 and wild-type moPrPs to digestion with 3·3 µg/ml PK for 10, 20, 40 and 60 min at 37 °C. In contrast to the complete degradation of wild-type moPrP (Fig. 4bUp, lanes 2–5), significant amounts of immunoreactive G112–119 moPrP remained after 10 and 20 min (Fig. 4bUp, lanes 7 and 8). Comparison with the protease-resistant core of hamster PrPSc (Fig. 4bUp, lane 12) showed that the fragments of both hamster PrPSc and G112–119 moPrP remaining after proteinase digestion migrated at a similar size range and faster than respective untreated samples (Fig. 4bUp; compare lanes 6 and 7 as well as lanes 11 and 12).

Doxycycline-induced expression of wild-type and G112–119 moPrPs
The protease resistance of G112–119 moPrP was examined further with the reverse tetracycline-inducible expression system. The two stably transfected cell lines rtTA–wild-type and rtTA–G112–119 displayed inducibility (Fig. 5aDown; compare lane 2 with lane 3 and lane 4 with lane 5) when tested for background expression before induction and overexpression after induction with doxycycline. The level of expression increased about 2- to 3-fold after induction with 2 µg/ml doxycycline in the medium for 20 h. Comparison of the amount of wild-type or G112–119 moPrP in the uninduced state with the level of endogenous PrP in untransfected N2a cells shows a background of wild-type and G112–119 moPrPs (Fig. 5aDown, lanes 2 and 4).



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 5. Doxycycline-induced overexpression of wild-type and G112–119 moPrPs. (a) Stably double-transfected N2a cell lines were tested before (-) and after (+) induction with doxycycline (2 µg/ml medium) for 20 h. Expression of wild-type (lanes 2 and 3) and G112–119 (lanes 4 and 5) moPrPs was analysed by Western blot with the mAb 3B5. A cell lysate from normal N2a cells was added as a control (lane 1). Equal amounts (100 µg) of protein were loaded in all lanes. (b) Protein lysates of stably double-transfected N2a cell lines expressing wild-type (lanes 7–10) or G112–119 (lanes 1–4) and protein lysates of normal N2a cells (endogenous; lanes 5 and 6) were treated with PK (3·3 µg/ml) at 37 °C for 10 min or left untreated as indicated before (lanes 1, 2, 7 and 8) or after (lanes 3, 4, 9 and 10) induction with doxycycline (Dox; 2 µg/ml medium) for 20 h. Equal amounts (100 µg) of protein were then subjected to immunoblotting using Kan72 antiserum. (c) Proteins in lysates of cells expressing wild-type (lanes 6–8) or G112–119 (lanes 1–5) moPrPs after induction with doxycycline (2 µg/ml medium) were treated with PK at different concentrations (3·3, 10, 20, 50 µg/ml) at 37 °C for 10 min (lanes 2–5, 7 and 8) or left undigested (lanes 1 and 6). Equal amounts (100 µg) of protein were analysed by Western blot and the rabbit polyclonal antiserum Kan72. Positions of marker proteins are indicated.

 
In order to examine whether G112–119 became protease-resistant in the tetracycline-inducible system, we performed a digestion with 3·3 µg/ml PK for 10 min with lysates of cells before and after induction for 20 h with 2 µg/ml doxycycline. In contrast with the complete degradation of wild-type (Fig. 5bUp, lanes 8 and 10) and endogenous (Fig. 5bUp, lane 6) moPrP, we found protease-resistant G112–119 moPrP in the induced as well as in the uninduced state (Fig. 5bUp, lanes 2 and 4). The amount of protease-resistant G112–119 moPrP correlated with the amount of total G112–119 moPrP before induction (Fig. 5bUp, lanes 1 and 2) as well as after induction (Fig. 5bUp, lanes 3 and 4) and was about 50% of the total G112–119 moPrP in both expression states. The clear increase in the amount of protease-resistant PrP was therefore acquired within 20 h after induction. In the induced state, G112–119 moPrP showed a clear shift of the diglycosylated, monoglycosylated and unglycosylated bands after digestion with PK (Fig. 5bUp, lane 4) compared with the three full-length bands before digestion (Fig. 5bUp, lane 3). Treatment of G112–119 moPrP in the induced state with 3·3 µg/ml PK for different lengths of time yielded protease-resistant G112–119 moPrP after digestion for 10 and 20 min (data not shown), which corresponded to our results with the permanently expressed mutant moPrPs under the control of the hCMV promoter.

The high level of expression of wild-type and G112–119 moPrPs in the induced state gave us reason to test the extent of resistance to PK at higher concentrations. After induction for 20 h with 2 µg/ml doxycycline, we treated lysates of the N2a cell lines rtTA–G112–119 and rtTA–wild-type with PK at concentrations of 3·3, 10, 20 and 50 µg/ml for 10 min (Fig. 5cUp). Wild-type moPrP was degraded completely (Fig. 5cUp, lanes 7 and 8), whereas immunoreactive G112–119 moPrP still remained after digestion with 10 µg/ml PK (Fig. 5cUp, lane 3). The amount was still about 12% of full-length G112–119 moPrP (Fig. 5cUp, compare lane 3 with lane 1).

By employing both a permanent and an inducible expression system, we could show that the acquisition of protease resistance is an intrinsic property of G112–119 moPrP in N2a cells.


   Discussion
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Three different mutants of PrP were overexpressed in N2a cells and analysed alongside normal N2a cells and N2a cells overexpressing wild-type PrP. The three mutations were positioned in the central, evolutionarily highly conserved domain of the protein in order to reveal any consequences of changing or deleting the highly amyloidogenic ‘palindrome’ AGAAAAGA (residues 112–119 in moPrP) (Gasset et al., 1992Down ). By immunofluorescence analysis, we showed that all mutant prion proteins were transported to a large extent to the cell surface, as was the wild-type protein. Most mutant PrPs that have so far been stably overexpressed in cells reach the cell surface, with the notable exception of proteins mutated at the first N-glycosylation site (Lehmann & Harris, 1997Down ). In all mutant proteins presented here, both glycosylation sites were used. Therefore, we did not find any indication of a defect in the post-translational transport of the mutant PrPs to the cell surface, whereas a few pathogenic human mutations, such as P102L, D178N and F197, as well as an insertional mutation with nine additional octapeptides, were shown to have an effect on the delivery of the molecules to the cell surface (Ivanova et al., 2001Down ).

A certain amount of normal PrPC is cleaved physiologically, which is identifiable by the presence of a C-terminal fragment (Chen et al., 1995Down ; Harris et al., 1993Down ; Jiménez-Huete et al., 1998Down ; Pan et al., 1992Down ). It is the amount of this C-terminal fragment relative to the full-length PrP that is altered substantially in two of the mutant PrPs presented here. It is easily conceivable why this might be a consequence of the extensive deletion in mutant {Delta}105–125 moPrP, in which all residues N- and C-terminal to the putative cleavage site (residue 110 or 111) have been removed (Chen et al., 1995Down ). The strongly inhibitory effect of the mutant G112–119 on the efficacy of cellular cleavage is probably determined directly by a mutation-induced alteration in protein conformation, but there are several possible explanations for how proteolytic processing is influenced by the altered structure of G112–119 moPrP: (i) the mutated residues might themselves be a poor substrate for the putative cleaving enzyme; (ii) the structure of the whole protein might be changed and the cleavage site might be less accessible; or (iii) due to the mutation introduced, the protein might be distributed on the cell surface in a different manner and therefore be in infrequent contact with the processing enzyme.

Analysis of the protease resistance of the various PrP mutants showed that G112–119 moPrP displayed resistance against PK digestion at a concentration of 3·3 µg/ml for 10 min at 37 °C. These conditions are much milder than those used in the detection of PrPSc in brain homogenates of diseased animals and humans (e.g. 20 µg/ml for 30 min at 37 °C; Büeler et al., 1994Down ), but were used by Lehmann & Harris (1997)Down in the analysis of Prnp genes carrying human-pathogenic mutations. In the latter study, the authors found that, under such conditions, the introduction of the human-pathogenic mutations P102L, D178N, T183A and E200K and an insertion of six additional octapeptides in the ORF of Prnp at the respective locations (P101L, D177N, T183A and E199K) rendered the mutated proteins resistant to PK at the above concentration. The PK resistance was always accompanied by enhanced detergent-insolubility of the mutated proteins (Daude et al., 1997Down ; Lehmann & Harris, 1997Down ). Similar PK resistance was reported for pathogenic mutations by other groups (Priola & Chesebro, 1998Down ; Singh et al., 1997Down ) but, by and large, the low concentration of PK, the dependence of these results on the cell type used (Petersen et al., 1996Down ; Priola & Chesebro, 1998Down ) and the lack of demonstrable infectivity resulting from this type of protease resistance leave it open whether the generated protease-resistant PrP is low-concentration PrPSc or unrelated to infectivity. We could show that the extent of protease resistance of the mutant G112–119 moPrP was slightly higher than under the standard conditions of 3·3 µg/ml for 10 min at 37 °C, but still much lower than the resistance of PrPSc in infected animals or in infected tissue culture (Hölscher et al., 1998Down ). Yet, protease resistance is an intrinsic property of G112–119 moPrP in N2a cells and was not a chance event in a particular N2a cell clone, as we confirmed the protease resistance of this particular mutant by expressing it in a different expression system, the doxycycline-inducible expression system. So far, this system has only been used to express wild-type PrP genes in transgenic animals and N2a cells (Tremblay et al., 1998Down ; Windl et al., 1999Down ). The mutant G112–119 moPrP showed a concurrent increase in the amount of protease-resistant PrP after induction of expression by doxycycline, indicating that the acquisition of protease resistance occurs soon after the biosynthesis of this mutant protein.

These findings have two general meanings for the conversion of certain mutant PrP molecules to protease-resistant isoforms. (i) The acquisition of a mild form of protease resistance of mutant prion proteins in tissue culture is not restricted to mutations known to cause inherited prion diseases in humans. This might point to the fact that there are many more (and probably more devastating) pathogenic mutations possible in PrP that might not exist in living animals because they interfere with the evolutionary success of the respective carrier. A recent study using peptides randomized in this hydrophobic domain supports this argument, as the author showed that these peptides are more toxic than the neurotoxic fragment 106–126 (Brown, 2000aDown ). (ii) Changes in the central hydrophobic region have immediate consequences for the structure or the processing of PrP. This is in line with studies on other mutants in this domain that have used different experimental set-ups (Hegde et al., 1998Down ; Hölscher et al., 1998Down ; Muramoto et al., 1996Down ). Recently, an alternative topological variant of PrP called CtmPrP has been proposed as a key factor in the development of neurodegeneration in prion diseases (Hegde et al., 1998Down , 1999Down ). The fragment size generated from CtmPrP by mild PK digestion was found to be smaller than PK-resistant PrPSc. The general importance of CtmPrP for the pathogenesis of prion diseases remains controversial (Stewart & Harris, 2001Down ).

Structural data on full-length recombinant PrP define the N-terminal half of the protein (residues 23–120 in moPrP and residues 23–124 in hamster PrP) as flexibly disordered or random-coil (Donne et al., 1997Down ; Riek et al., 1997Down ). Copper binding seems to confer a distinctive structure on the N-terminal octapeptide repeats (Viles et al., 1999Down ), but the motif AGAAAAGA is positioned at the hydrophobic C terminus of this unstructured part of PrP, and a recent refinement of the structure by Liu et al. (1999)Down has confirmed that it does not adopt regular secondary structure. Yet, the latter authors found indications of multiple discrete conformations in this hydrophobic domain, which might imply that this region is metastable and could therefore play an essential role in the formation of PrPSc. It was suggested that PrPSc interacts with recombinant PrPC at amino acid residues 112–119 of the mouse sequence (Brown, 2000bDown ), which might indicate that the sequence encompassing residues 112–119 is of special importance to the conversion of PrPC to PrPSc. Copper ions reversibly induce PrPC to become protease-resistant (Quaglio et al., 2001Down ), but it remains to be seen in what way the binding of copper to the N-terminal repeats and the concomitant adoption of structure influences the structural transitions that potentially take place in this more C-terminal hydrophobic domain of the N terminus. Our data demonstrate that a certain mutation in the hydrophobic region induces the ready formation of PK-resistant PrP. Therefore, it can be hypothesized that this mutation stabilizes a conformation that shares features with the infectious form of PrP. Whether prion infectivity was generated de novo in tissue culture will be tested in future by using infectivity assays and transgenic animals.


   Acknowledgments
 
We thank Stanley B. Prusiner for antibody 13A5 and the tg81 mice, Bruno Oesch for antibody 6H4 and Alexander Buerkle for antibody Kan72. We also thank Martin Groschup for providing brain from hamsters and hamsters infected with scrapie strain 263K, B. Zevnik for his gift of plasmid pHA58 and H. Bujard for his generous gifts of plasmids pUHG 172-1 and pUHD 10-3. We are indebted to Connex GmbH (Martinsried, Germany) for the use of their S2 facility. This work was supported by grants from the European Commission (grants no. BMH4-CT98-6040 and ERBFMH4 CT98 6040).


   Footnotes
 
b Present address: Department of Neuropathology, Oxford, UK. Back


   References
TOP
Abstract
Introduction
Methods
Results
Discussion
References
 
Borchelt, D. R., Scott, D., Taraboulos, A., Stahl, N. & Prusiner, S. B. (1990). Scrapie and cellular prion proteins differ in their kinetics of synthesis and topology in cultured cells. Journal of Cell Biology 110, 743-752.[Abstract/Free Full Text]

Brandner, S., Isenmann, S., Raeber, A., Fischer, M., Sailer, A., Kobayashi, Y., Marino, S., Weissmann, C. & Aguzzi, A. (1996). Normal host prion protein necessary for scrapie-induced neurotoxicity. Nature 379, 339-343.[Medline]

Brown, D. R. (2000a). Prion protein peptides: optimal toxicity and peptide blockade of toxicity. Molecular and Cellular Neurosciences 15, 66-78.[Medline]

Brown, D. R. (2000b). PrPSc-like prion protein peptide inhibits the function of cellular prion protein. Biochemical Journal 352, 511-518.

Brown, D. R., Schmidt, B. & Kretzschmar, H. A. (1996). Role of microglia and host prion protein in neurotoxicity of prion protein fragment. Nature 380, 345-347.[Medline]

Brown, D. R., Qin, K., Herms, J. W., Madlung, A., Manson, J., Strome, R., Fraser, P. E., Kruck, T., von Bohlen, A., Schulz-Schaeffer, W., Giese, A., Westaway, D. & Kretzschmar, H. (1997a). The cellular prion protein binds copper in vivo. Nature 390, 684-687.[Medline]

Brown, D. R., Schulz-Schaeffer, W. J., Schmidt, B. & Kretzschmar, H. A. (1997b). Prion protein-deficient cells show altered response to oxidative stress due to decreased SOD-1 activity. Experimental Neurology 146, 104-112.[Medline]

Büeler, H., Aguzzi, A., Sailer, A., Greiner, R. A., Autenried, P., Aguet, M. & Weissmann, C. (1993). Mice devoid of PrP are resistant to scrapie. Cell 73, 1339-1347.[Medline]

Büeler, H., Raeber, A., Sailer, A., Fischer, M., Aguzzi, A. & Weissmann, C. (1994). High prion and PrPSc levels but delayed onset of disease in scrapie-inoculated mice heterozygous for a disrupted PrP gene. Molecular Medicine 1, 19-30.[Medline]

Caughey, B., Race, R. E., Ernst, D., Buchmeier, M. J. & Chesebro, B. (1989). Prion protein biosynthesis in scrapie-infected and uninfected neuroblastoma cells. Journal of Virology 63, 175-181.[Abstract/Free Full Text]

Caughey, B. W., Dong, A., Bhat, K. S., Ernst, D., Hayes, S. F. & Caughey, W. S. (1991). Secondary structure analysis of the scrapie-associated protein PrP27–30 in water by infrared spectroscopy. Biochemistry 30, 7672-7680.[Medline]

Chabry, J., Caughey, B. & Chesebro, B. (1998). Specific inhibition of in vitro formation of protease-resistant prion protein by synthetic peptides. Journal of Biological Chemistry 273, 13203-13207.[Abstract/Free Full Text]

Chen, S. G., Teplow, D. B., Parchi, P., Teller, J. K., Gambetti, P. & Autilio-Gambetti, L. (1995). Truncated forms of the human prion protein in normal brain and in prion diseases. Journal of Biological Chemistry 270, 19173-19180.[Abstract/Free Full Text]

Daude, N., Lehmann, S. & Harris, D. A. (1997). Identification of intermediate steps in the conversion of a mutant prion protein to a scrapie-like form in cultured cells. Journal of Biological Chemistry 272, 11604-11612.[Abstract/Free Full Text]

Donne, D. G., Viles, J. H., Groth, D., Mehlhorn, I., James, T. L., Cohen, F. E., Prusiner, S. B., Wright, P. E. & Dyson, H. J. (1997). Structure of recombinant full-length hamster prion protein PrP(29–231): the N terminus is highly flexible. Proceedings of the National Academy of Sciences, USA 94, 13452-13457.[Abstract/Free Full Text]

Forloni, G., Angeretti, N., Chiesa, R., Monzani, E., Salmona, M., Bugiani, O. & Tagliavini, F. (1993). Neurotoxicity of a prion protein fragment. Nature 362, 543-546.[Medline]

Gasset, M., Baldwin, M. A., Lloyd, D. H., Gabriel, J.-M., Holtzman, D. M., Cohen, F., Fletterick, R. & Prusiner, S. B. (1992). Predicted {alpha}-helical regions of the prion protein when synthesized as peptides form amyloid. Proceedings of the National Academy of Sciences, USA 89, 10940-10944.[Abstract/Free Full Text]

Haraguchi, T., Fisher, S., Olofsson, S., Endo, T., Groth, D., Tarentino, A., Borchelt, D. R., Teplow, D., Hood, L., Burlingame, A., Lycke, E., Kobata, A. & Prusiner, S. B. (1989). Asparagine-linked glycosylation of the scrapie and cellular prion proteins. Archives of Biochemistry and Biophysics 274, 1-13.[Medline]

Harris, D. A., Huber, M. T., van Dijken, P., Shyng, S. L., Chait, B. T. & Wang, R. (1993). Processing of a cellular prion protein: identification of N- and C-terminal cleavage sites. Biochemistry 32, 1009-1016.[Medline]

Hegde, R. S., Mastrianni, J. A., Scott, M. R., DeFea, K. A., Tremblay, P., Torchia, M., DeArmond, S. J., Prusiner, S. B. & Lingappa, V. R. (1998). A transmembrane form of the prion protein in neurodegenerative disease. Science 279, 827-834.[Abstract/Free Full Text]

Hegde, R. S., Tremblay, P., Groth, D., DeArmond, S. J., Prusiner, S. B. & Lingappa, V. R. (1999). Transmissible and genetic prion diseases share a common pathway of neurodegeneration. Nature 402, 822-826.[Medline]

Herms, J., Tings, T., Gall, S., Madlung, A., Giese, A., Siebert, H., Schürmann, P., Windl, O., Brose, N. & Kretzschmar, H. (1999). Evidence of presynaptic location and function of the prion protein. Journal of Neuroscience 19, 8866-8875.[Abstract/Free Full Text]

Higuchi, R., Krummel, B. & Saiki, R. K. (1988). A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Research 16, 7351-7367.[Abstract/Free Full Text]

Hölscher, C., Delius, H. & Bürkle, A. (1998). Overexpression of nonconvertible PrPc{Delta}114–121 in scrapie-infected mouse neuroblastoma cells leads to trans-dominant inhibition of wild-type PrPSc accumulation. Journal of Virology 72, 1153-1159.[Abstract/Free Full Text]

Hornemann, S., Korth, C., Oesch, B., Riek, R., Wider, G., Wüthrich, K. & Glockshuber, R. (1997). Recombinant full-length murine prion protein, mPrP(23–231): purification and spectroscopic characterization. FEBS Letters 413, 277-281.[Medline]

Ivanova, L., Barmada, S., Kummer, T. & Harris, D. A. (2001). Mutant prion proteins are partially retained in the endoplasmic reticulum. Journal of Biological Chemistry 276, 42409-42421.[Abstract/Free Full Text]

Jiménez-Huete, A., Lievens, P. M. J., Vidal, R., Piccardo, P., Ghetti, B., Tagliavini, F., Frangione, B. & Prelli, F. (1998). Endogenous proteolytic cleavage of normal and disease-associated isoforms of the human prion protein in neural and non-neural tissues. American Journal of Pathology 153, 1561-1572.[Abstract/Free Full Text]

Klebe, R. J. & Ruddle, F. H. (1969). Neuroblastoma: cell culture analysis of a differentiating stem cell system. Journal of Cell Biology 43, 69a.

Korth, C., Stierli, B., Streit, P., Moser, M., Schaller, O., Fischer, R., Schulz-Schaeffer, W., Kretzschmar, H., Raeber, A., Braun, U., Ehrensperger, F., Hornemann, S., Glockshuber, R., Riek, R., Billeter, M., Wüthrich, K. & Oesch, B. (1997). Prion (PrPSc)-specific epitope defined by a monoclonal antibody. Nature 390, 74-77.[Medline]

Krasemann, S., Groschup, M. H., Harmeyer, S., Hunsmann, G. & Bodemer, W. (1996). Generation of monoclonal antibodies against human prion proteins in PrP0/0 mice. Molecular Medicine 2, 725-734.[Medline]

LeGendre, N. (1990). Immobilon-P transfer membrane: applications and utility in protein biochemical analysis. Biotechniques 9, 788-805.[Medline]

Lehmann, S. & Harris, D. A. (1996). Mutant and infectious prion proteins display common biochemical properties in cultured cells. Journal of Biological Chemistry 271, 1633-1637.[Abstract/Free Full Text]

Lehmann, S. & Harris, D. A. (1997). Blockade of glycosylation promotes acquisition of scrapie-like properties by the prion protein in cultured cells. Journal of Biological Chemistry 272, 21479-21487.[Abstract/Free Full Text]

Liu, H., Farr-Jones, S., Ulyanov, N. B., Llinas, M., Marqusee, S., Groth, D., Cohen, F. E., Prusiner, S. B. & James, T. L. (1999). Solution structure of Syrian hamster prion protein rPrP(90–231). Biochemistry 38, 5362-5377.[Medline]

Mouillet-Richard, S., Ermonval, M., Chebassier, C., Laplanche, J. L., Lehmann, S., Launay, J. M. & Kellermann, O. (2000). Signal transduction through prion protein. Science 289, 1925-1928.[Abstract/Free Full Text]

Muramoto, T., Scott, M., Cohen, F. E. & Prusiner, S. B. (1996). Recombinant scrapie-like prion protein of 106 amino acids is soluble. Proceedings of the National Academy of Sciences, USA 93, 15457-15462.[Abstract/Free Full Text]

Pan, K. M., Stahl, N. & Prusiner, S. B. (1992). Purification and properties of the cellular prion protein from Syrian hamster brain. Protein Science 1, 1343-1352.[Medline]

Pan, K.-M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A., Groth, D., Mehlhorn, I., Huang, Z., Fletterick, R. J., Cohen, F. E. & Prusiner, S. B. (1993). Conversion of {alpha}-helices into {beta}-sheets features in the formation of the scrapie prion proteins. Proceedings of the National Academy of Sciences, USA 90, 10962-10966.[Abstract/Free Full Text]

Petersen, R. B., Parchi, P., Richardson, S. L., Urig, C. B. & Gambetti, P. (1996). Effect of the D178N mutation and the codon 129 polymorphism on the metabolism of the prion protein. Journal of Biological Chemistry 271, 12661-12668.[Abstract/Free Full Text]

Priola, S. A. & Chesebro, B. (1998). Abnormal properties of prion protein with insertional mutations in different cell types. Journal of Biological Chemistry 273, 11980-11985.[Abstract/Free Full Text]

Prusiner, S. B. & DeArmond, S. J. (1994). Prion diseases and neurodegeneration. Annual Review of Neuroscience 17, 311-339.[Medline]

Prusiner, S. B., Telling, G., Cohen, F. E. & DeArmond, S. J. (1996). Prion diseases of humans and animals. Seminars in Virology 7, 159-173.

Quaglio, E., Chiesa, R. & Harris, D. A. (2001). Copper converts the cellular prion protein into a protease-resistant species that is distinct from the scrapie isoform. Journal of Biological Chemistry 276, 11432-11438.[Abstract/Free Full Text]

Riek, R., Hornemann, S., Wider, G., Billeter, M., Glockshuber, R. & Wüthrich, K. (1996). NMR structure of the mouse prion protein domain PrP(121–231). Nature 382, 180-182.[Medline]

Riek, R., Hornemann, S., Wider, G., Glockshuber, R. & Wüthrich, K. (1997). NMR characterization of the full-length recombinant murine prion protein, mPrP(23–231). FEBS Letters 413, 282-288.[Medline]

Rogers, M., Serban, D., Gyuris, T., Scott, M., Torchia, T. & Prusiner, S. B. (1991). Epitope mapping of the Syrian hamster prion protein utilizing chimeric and mutant genes in a vaccinia virus expression system. Journal of Immunology 147, 3568-3574.[Abstract]

Safar, J., Roller, P. P., Gadjusek, D. C. & Gibbs, C. J.Jr(1993). Conformational transitions, dissociation, and unfolding of scrapie amyloid (prion) protein. Journal of Biological Chemistry 268, 20276-20284.[Abstract/Free Full Text]

Scott, M., Foster, D., Mirenda, C., Serban, D., Coufal, F., Wälchli, M., Torchia, M., Groth, D., Carlson, G., DeArmond, S. J., Westaway, D. & Prusiner, S. B. (1989). Transgenic mice expressing hamster prion protein produce species-specific scrapie infectivity and amyloid plaques. Cell 59, 847-857.[Medline]

Shyng, S. L., Huber, M. T. & Harris, D. A. (1993). A prion protein cycles between the cell surface and an endocytic compartment in cultured neuroblastoma cells. Journal of Biological Chemistry 268, 15922-15928.[Abstract/Free Full Text]

Singh, N., Zanusso, G., Chen, S. G., Fujioka, H., Richardson, S., Gambetti, P. & Petersen, R. B. (1997). Prion protein aggregation reverted by low temperature in transfected cells carrying a prion protein gene mutation. Journal of Biological Chemistry 272, 28461-28470.[Abstract/Free Full Text]

Stewart, R. S. & Harris, D. A. (2001). Most pathogenic mutations do not alter the membrane topology of the prion protein. Journal of Biological Chemistry 276, 2212-2220.[Abstract/Free Full Text]

Tremblay, P., Meiner, Z., Galou, M., Heinrich, C., Petromilli, C., Lisse, T., Cayetano, J., Torchia, M., Mobley, W., Bujard, H., DeArmond, S. J. & Prusiner, S. B. (1998). Doxycycline control of prion protein transgene expression modulates prion disease in mice. Proceedings of the National Academy of Sciences, USA 95, 12580-12585.[Abstract/Free Full Text]

Viles, J. H., Cohen, F. E., Prusiner, S. B., Goodin, D. B., Wright, P. E. & Dyson, H. J. (1999). Copper binding to the prion protein: structural implications of four identical cooperative binding sites. Proceedings of the National Academy of Sciences, USA 96, 2042-2047.[Abstract/Free Full Text]

Windl, O., Lorenz, H., Behrens, C., Römer, A. & Kretzschmar, H. A. (1999). Construction and characterization of murine neuroblastoma cell clones allowing inducible and high expression of the prion protein. Journal of General Virology 80, 15-21.[Abstract]

Received 10 August 2001; accepted 14 December 2001.



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wegner, C.
Right arrow Articles by Kretzschmar, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wegner, C.
Right arrow Articles by Kretzschmar, H. A.
Agricola
Right arrow Articles by Wegner, C.
Right arrow Articles by Kretzschmar, H. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS