|
|
||||||||
Animal: RNA Viruses |
Institute of Microbiology and Immunology, School of Life Science, National Yang-Ming University, Taipei 112, Taiwan, Republic of China1
Faculty of Medical Technology and Institute of Biotechnology in Medicine, School of Medical Technology and Engineering, National Yang-Ming University, 155 Li-Nong St Sec. 2, Shih-Pai, Taipei 112, Taiwan, Republic of China2
Division of Clinical Virology, Department of Pathology and Laboratory Medicine, Veterans General Hospital-Taipei, Taipei 112, Taiwan, Republic of China3
Author for correspondence: Wu-Tse Liu at Faculty of Medical Technology. Fax +886 2 2826 4092. e-mail wtliu{at}ym.edu.tw
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
EV71 is a small, nonenveloped, icosahedral RNA virus that possesses a single-stranded RNA genome of approximately 7400 nucleotides of positive polarity (Brown & Pallansch, 1995
). The genome is predicted to comprise a 5' untranslated region (UTR), a long open reading frame that encodes a protein of approximately 2100 amino acids, a short 3' UTR and a polyadenylated tail (Brown & Pallansch, 1995
). Although the replication mechanism of EV71 is largely unknown, studies from members in the Picornaviridae family revealed that the plus-strand RNA genome is translated into a single large polyprotein. Maturation cleavage of the polyprotein to generate functional viral proteins is mainly mediated by virus-encoded proteases, designated 2A (2Apro) and 3C (3Cpro). Most of the proteolytic reactions are accomplished by 3Cpro, whereas 2Apro catalyses only two cleavages on the polyprotein, one between the capsid protein precursor and itself and another on 3CD to generate 3C' and 3D'.
Apoptosis, or programmed cell death, is a genetically determined cell death programme and provides a natural mechanism to remove damaged cells from tissue. The most typical signs involve a series of cellular events that include the nucleolytic internucleosome degradation of chromosomal DNA, compaction and fragmentation of chromatin, membrane blebbing and cellular shrinkage (Martin et al., 1994
; Green, 2000
). Recently, several reports focused on the ability of picornaviruses to affect the apoptosis-inducing activities within infected cells, most evidently exemplified by Theiler's murine encephalomyelitis virus (TMEV) (Jelachich & Lipton, 1999
), coxsackievirus B3 (CVB3) (Carthy et al., 1998
) and poliovirus (PV) (Tolskaya et al., 1995
; Agol et al., 1998
, 2000
; López-Gurrero et al., 2000
). Further investigation revealed that expression of 2Apro as the only PV component results in apoptotic cell death (Goldstaub et al., 2000
). Moreover, infection of mice with TMEV or PV induces apoptosis in the central nervous system (CNS) and is associated with the neurovirulent effect or fatal outcome in infected mice (Tsunoda et al., 1997
; Girard et al., 1999
).
Infection with picornaviruses can cause dramatic inhibition of host protein synthesis (Haller & Semler, 1995
; Sachs et al., 1997
), which is followed by a selective and efficient translation of the viral mRNA. Cellular mRNAs contain a 5'-terminal cap structure that is responsible for initiation of translation (Sonenberg & Gingras, 1998
). In contrast, picornavirus RNAs have in their 5' UTRs a complex structure known as an internal ribosome entry site (IRES) element, which directs a cap-independent mechanism of translation (reviewed by Jackson et al., 1994
; Belsham & Sonenberg, 1996
). An early event occurring during many picornavirus infections is cleavage of the eukaryotic translation initiation factor 4G (eIF4G), either directly or indirectly, by viral 2Apro (Etchison et al., 1982
). There are two related eIF4G species, eIF4GI and eIF4GII, which appear to be functional homologues of each other but share only 46% identity (Gradi et al., 1998
). IRES-directed initiation of virus protein synthesis is maintained following cleavage of the eIF4G species, with concomitant inhibition of capped cellular mRNA translation (Ohlmann et al., 1996
; Borman et al., 1997
; Gradi et al., 1998
; Roberts et al., 1998
).
In this study, we showed that infection with EV71 induces apoptosis, as shown by the data from morphological and biochemical studies. Despite a moderate level of homology to poliovirus 2Apro, EV71 2Apro expression is sufficient to trigger cleavage of eIF4GI and apoptotic cell death.
| Methods |
|---|
|
|
|---|
Cell lines and virus.
Infection with EV71.
Cells were seeded on culture Petri dishes a day before infection with EV71 at an m.o.i. of 0·1. After a 2 h adsorption, the cell layer was rinsed with PBS and MEM containing 2% FBS was added. Cells were then incubated at 37 °C throughout the infection.
Plasmid construction.
Total RNA was extracted from EV71 virus stock with 200 µl RNAzol B solution (TEL-TEST). The cDNA was first synthesized using 100 units of Moloney murine leukaemia virus reverse transcriptase (Promega) at 37 °C for 60 min. One-fifth volume of the product from the reverse transcription reaction was used as a template for PCR for the EV71 (BrCr strain) 2A-coding region (nt 33303779 relative to the predicted transcription initiation site; Brown & Pallansch, 1995
), with the primers forward, 5' CGGATCCATGGGGAAATTCGGTCAGCAGTC 3', and reverse, 5' GCTCGAATTCCTGCTCCATCGCTTCCTCAT 3'. The 5' and 3' primers were engineered to contain BglII and EcoRI restriction sites for cloning. The conditions for PCR were as follows: 94 °C for 3 min, then 35 cycles of a denaturation step at 94 °C for 1 min, an annealing step at 58 °C for 1 min 30 s and an elongation step at 72 °C for 3 min, and 1 cycle of an elongation step at 72 °C for 10 min. The RTPCR product was subsequently digested and directionally cloned into the BglII and EcoRI sites of plasmid pEGFP-N2 (Clontech). This construct contains the 2A-coding sequences fused in frame to the N terminus of the green fluorescent protein (GFP) gene and is referred to as p2A-GFP. Plasmid p2A-IRES-GFP was constructed by inserting the 2A cDNA fragment into pIRES2-EGFP (Clontech), a plasmid harbouring the GFP reporter gene controlled by the IRES from encephalomyocarditis virus (EMCV). This permits both 2A and GFP genes to be translated from a single bicistronic mRNA. The authenticity of each construct was confirmed by automated DNA sequencing.
Immunofluorescence assay and Hoechst staining.
Infected cells were fixed with 3% paraformaldehyde for 30 min and 0·2% Triton X-100 for 5 min and then incubated with a mouse anti-EV71 monoclonal antibody (MAb) (Chemicon, 3324) at 37 °C for 30 min. Following two washes in PBS, cells were incubated with the secondary antibody, a goat anti-mouse IgG conjugated with fluorescein isothiocyanate (FITC) (ICN), at 37 °C for 30 min. Nuclei were counterstained with a DNA-binding dye, Hoechst 33258 (0·5 µg/ml, Sigma). Cell morphology was visualized under a fluorescence microscope equipped with both FITC and UV filters.
DNA analysis.
Cells were incubated in versene and then suspended in the buffer containing 20 mM EDTA and 10 mM TrisHCl (pH 7·4). Next, cells were treated with 0·5% Triton X-100 at 0 °C for 20 min. After centrifugation (12000 r.p.m. for 15 min at 4 °C), the supernatant was first treated with SDS (at a final concentration of 1%) and then with 10 µg RNase A at 37 °C for 30 min. DNA was then isolated by phenol extraction and ethanol precipitation. DNA was fractionated by electrophoresis in a 1·5% agarose gel, stained with ethidium bromide and visualized under UV light.
DNA transfection.
Approximately 70% confluent monolayer of Vero or HeLa-229 cells grown on 100 mm diameter dishes were transfected with 30 µg of plasmid DNA using the calcium phosphate precipitation method (Sambrook et al., 1989
). After incubation at 37 °C in 5% CO2 for the appropriate amount of time, the cells were analysed as indicated for each experiment.
Western blot analysis.
Vero, RD and HeLa-229 cells were harvested at various time-points following the infection of EV71 or transfection of 2A-expressing plasmids. Cell extracts were prepared by washing with cold PBS and scraped into the lysis buffer (50 mM TrisHCl, pH 7·5, 150 mM NaCl, 0·5 mM EDTA and 0·5% NP-40). Cell extracts were then mixed with an equal volume of 2x sample buffer (125 mM TrisHCl, pH 6·8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol and 0·2% bromophenol blue), separated by SDSPAGE and transferred onto nitrocellulose membranes. Blots were incubated with mouse anti-PARP [poly(ADP-ribose) polymerase] MAb (1:500 dilution; BD Transduction Laboratories) or mouse anti-eIF4GI antibody (1:250 dilution; BD Transduction Laboratories). Blots were then incubated with horseradish peroxidase-conjugated goat anti-mouse antibody (Sigma), the secondary antibody. Proteins were detected using the Enhanced Chemiluminescence Western Blotting kit (Amersham).
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Cell death occurs by either necrotic or apoptotic pathways. Necrosis is accidental death characterized by rupture of the plasma membrane and release of cytoplasmic constituents. Apoptosis is an active and energy-dependent process of cell death in response to a wide variety of stimuli (Martin et al., 1994
; Green, 2000
). In vivo, apoptotic cell death is reported to be noninflammatory, while necrotic death is typically accompanied by inflammation (Melcher et al., 1999
). The ability of numerous viruses to elicit apoptosis either directly or indirectly upon infection has been demonstrated (Teodoro & Branton, 1997
; O'Brien, 1998
). This process may represent an important step in the spread of progeny to neighbouring cells, while limiting the inflammatory and immune responses (O'Brien, 1998
), and protecting progeny virus from action of host antibodies. In some cases, specific viral proteins have been identified that are potent apoptosis inducers by themselves, such as E1A of human adenovirus and Tat and Nef of human immunodeficiency virus (Roulston et al., 1999
; Teodoro & Branton, 1997
). In other cases, the presence of viral RNA, rather than viral proteins, is implicated as a trigger. Examples of these are the apoptotic action of the RNA-dependent 2-5A synthetase/RNase L system (Castelli et al., 1997
) and the RNA-dependent protein kinase PKR (Lee & Esteban, 1994
; Lee et al., 1997
). Among human EV, PV was first described as being capable of evoking an apoptotic reaction in several cultured cell lines (Ammendolia et al., 1999
; López-Guerrero et al., 2000
; Tolskaya et al., 1995
), with its 2Apro being implicated in the apoptosis-inducing function (Goldstaub et al., 2000
). In addition, CVB3 was shown to induce apoptosis of HeLa cells (Carthy et al., 1998
). Its capsid protein VP2 was identified to interact with the cellular pro-apoptotic protein Siva and may contribute to the induction of apoptotic events (Henke et al., 2000
). We addressed herein that EV71 2Apro is capable of triggering apoptosis, adding one more to the growing list of pro-apoptotic genes from enteroviruses.
Elucidation of the exact molecular mechanism used by EV71 2Apro to provoke apoptosis must take into account that this protease may cleave a variety of host proteins, including eIF4GI and PARP shown in this report. eIF4GI is a component of the cap-binding complex (eIF4F), which plays a pivotal role in the interaction between capped mRNA and the 40S ribosomal subunit, leading to the initiation of translation (Morley et al., 1997
). Cleavage of eIF4GI results in the disruption of the eIF4F complex and, hence, inhibition of cap-dependent translation. In addition, it was demonstrated that recombinant 2Apro of EV and HRV can cleave eIF4G directly in vitro, albeit to a much lesser extent (Bovee et al., 1998
; Haghighat et al., 1996
; Lamphear et al., 1993
). This could be explained by the finding that eIF4G alone is a relatively poor substrate, as opposed to the eIF4F complex, which is cleaved efficiently by the HRV 2Apro (Haghighat et al., 1996
). It has been proposed that the shut-off of cap-dependent translation is a major mechanism of the execution phase of apoptosis, which leads to rapid cell death (Clemens et al., 1998
; Marissen & Lloyd, 1998
). Furthermore, it has been noted that eIF4GI also serves as a substrate for activated caspases when cells undergo apoptosis (Clemens et al., 1998
; Marissen & Lloyd, 1998
). However, the cleavage products (ca. 150 and 80 kDa) are distinct from those generated in EV71-infected or EV71 2Apro-transfected cells (Fig. 7
), consistent with the data documented previously for picornavirus-infected cells (Roberts et al., 2000
). Also, it was shown that caspase inhibitors did not inhibit the cleavage of eIF4GI during PV infection (Roberts et al., 2000
). These data suggested that apoptosis could be induced as a consequence of cleavage of eIF4GI in a caspases-independent manner.
With regard to PARP, another host protein susceptible to cleavage by 2Apro reported herein, it is proteolytically cleaved by family members of the ICE-like cysteine protease family, in particular by caspase-3 during the process of apoptosis (Lazebnik et al., 1994
). More interestingly, the caspase-3 cleavage products have a molecular mass of 85 and 25 kDa, reminiscent of those seen from EV71-infected (Fig. 3
) or 2Apro-transfected cells (Fig. 6
). Moreover, recent reports showed that caspase-3 is activated after CVB3 infection of HeLa cells (Carthy et al., 1998
) or PV infection of U937 cells (López-Guerrero et al., 2000
). Thus, the mechanism by which EV71 2Apro-induced apoptosis may be a caspase-3-dependent event. In fact, our preliminary study indicated that PARP remained intact in the EV71-infected or EV71 2Apro-transfected MCF-7 cells deficient in caspase-3 (unpublished data). Taken together, it is tempting to assume that the cleavage of PARP and eIF4G isoforms occurs at distinct stages during the apoptotic process. In this case, eIF4G cleavage may be directed toward blocking de novo cap-dependent translation. It may initiate an apoptotic event without the action of caspases, while PARP cleavage is the consequence of caspase-3 activation at the later phase of apoptosis. Nonetheless, it is conceivable that EV71 2Apro induces apoptosis indirectly by activation of other still unidentified cellular substrates pertinent to an endogenous cell suicide program. Further experiments are needed to better delineate the mechanism(s) by which EV71 2Apro induces apoptosis.
Induction of apoptosis by virus infection is emerging as an important aspect of pathogenesis. Cell damage in the CNS that is caused by its response to a virus infection can involve apoptosis (Oberhaus et al., 1997
; Tsunoda et al., 1997
). Virus-induced apoptosis has been shown to be an important component of PV-induced cell death and tissue injury in the CNS of infected mice (Girard et al., 1999
). EV71, like PV, invades the CNS to give rise to several syndromes, notably aseptic meningitis, encephalomyelitis and flaccid paralysis. Therefore, this work represents an initial attempt to unveil the relevance of EV71-induced apoptosis for human diseases. Moreover, discerning the trigger that initiates apoptosis in a virus-infected cell, in this case the EV71 2Apro, should be of benefit to understanding virus pathology as well as the development of effective inhibitors targeted to this viral protein.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Agol, V. I., Belov, G. A., Bienz, K., Egger, D., Kolesnikova, M. S., Romanova, I. L., Sladkova, L. V. & Tolskaya, E. A. (2000). Competing death programs in poliovirus-infected cells: commitment switch in the middle of the infectious cycle. Journal of Virology 74, 5534-5541.
Aldabe, R., Feduchi, E., Novoa, I. & Carrasco, L. (1995). Efficient cleavage of p220 by poliovirus 2Apro expression in mammalian cells: effects on vaccinia virus. Biochemical and Biophysical Research Communications 215, 928-936.[Medline]
Alexander, J. P.Jr, Baden, L., Pallansch, M. A. & Anderson, L. J. (1994). Enterovirus 71 infections and neurologic disease-United States, 19771991. Journal of Infectious Diseases 169, 905-908.[Medline]
Ammendolia, M. G., Tinari, A., Calcabrini, A. & Superti, F. (1999). Poliovirus infection induces apoptosis in CaCo-2 cells. Journal of Medical Virology 59, 122-129.[Medline]
Barco, A., Feduchi, E. & Carrasco, L. (2000). A stable HeLa cell line that inducibly expresses poliovirus 2Apro: effects on cellular and viral gene expression. Journal of Virology 74, 2383-2392.
Bazan, J. F. & Fletterick, R. J. (1988). Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Sciences, USA 85, 7872-7876.
Belsham, G. J. & Sonenberg, N. (1996). RNAprotein interactions in regulation of picornavirus RNA translation. Microbiological Reviews 60, 499-511.
Borman, A. M., Kirchweger, R., Ziegler, E., Rhoads, R. E., Skern, T. & Kean, K. M. (1997). eIF4G and its proteolytic cleavage products: effect on initiation of protein synthesis from capped, uncapped, and IRES-containing mRNAs. RNA 3, 186-196.[Abstract]
Bovee, M. L., Lamphear, B. J., Rhoads, R. E. & Lloyd, R. E. (1998). Direct cleavage of eIF4G by poliovirus 2A protease is inefficient in vitro. Virology 245, 241-249.[Medline]
Brown, B. A. & Pallansch, M. A. (1995). Complete nucleotide sequence of enterovirus 71 is distinct from poliovirus. Virus Research 39, 195-205.[Medline]
Carthy, C. M., Granville, D. J., Watson, K. A., Anderson, D. R., Wilson, J. E., Yang, D., Hunt, D. W. & McManus, B. M. (1998). Caspase activation and specific cleavage of substrates after coxsackievirus B3-induced cytopathic effect in HeLa cells. Journal of Virology 72, 7669-7675.
Castelli, J. C., Hassel, B. A., Wood, K. A., Li, X. L., Amemiya, K., Dalakas, M. C., Torrence, P. F. & Youle, R. J. (1997). A study of the interferon antiviral mechanism: apoptosis activation by the 2-5A system. Journal of Experimental Medicine 186, 967-972.
Chang, L.-Y., Huang, Y.-C. & Lin, T.-Y. (1998). Fulminant neurogenic pulmonary oedema with hand, foot, and mouth disease. Lancet 352, 367-368.[Medline]
Chumakov, M., Voroshilova, M., Shindarov, L., Lavrova, I., Gracheva, L., Koroleva, G., Vasilenko, S., Brodvarova, I., Nikolova, M., Gyurova, S., Gacheva, M., Mitov, G., Ninov, N., Tsylka, E., Robinson, I., Frolova, M., Bashkirtsev, V., Martiyanova, L. & Rodin, V. (1979). Enterovirus 71 isolated from cases of epidemic poliomyelitis-like disease in Bulgaria. Archives of Virology 60, 329-340.[Medline]
Clemens, M. J., Bushell, M. & Morley, S. J. (1998). Degradation of eukaryotic polypeptide chain initiation factor (eIF) 4G in response to induction of apoptosis in human lymphoma cell lines. Oncogene 17, 2921-2931.[Medline]
Etchison, D., Milburn, S. C., Edery, I., Sonenberg, N. & Hershey, J. W. (1982). Inhibition of HeLa cell protein synthesis following poliovirus infection correlates with the proteolysis of a 220,000-dalton polypeptide associated with eucaryotic initiation factor 3 and a cap binding protein complex. Journal of Biological Chemistry 257, 14806-14810.
Gilbert, G. L., Dickson, K. E., Waters, M. J., Kennett, M. L., Land, S. A. & Sneddon, M. (1988). Outbreak of enterovirus 71 infection in Victoria, Australia, with a high incidence of neurologic involvement. Pediatric Infectious Disease Journal 7, 484-488.[Medline]
Girard, S., Couderc, T., Destombes, J., Thiesson, D., Delpeyroux, F. & Blondel, B. (1999). Poliovirus induces apoptosis in the mouse central nervous system. Journal of Virology 73, 6066-6072.
Goldstaub, D., Gradi, A., Bercovitch, Z., Grosmann, Z., Nophar, Y., Luria, S., Sonenberg, N. & Kahana, C. (2000). Poliovirus 2A protease induces apoptotic cell death. Molecular and Cellular Biology 20, 1271-1277.
Gradi, A., Imataka, H., Svitkin, Y. V., Rom, E., Raught, B., Morino, S. & Sonenberg, N. (1998). A novel functional human eukaryotic translation initiation factor 4G. Molecular and Cellular Biology 18, 334-342.
Green, D. R. (2000). Apoptotic pathways: paper wraps stone blunts scissors. Cell 102, 1-4.[Medline]
Haghighat, A., Svitkin, Y., Novoa, I., Kuechler, E., Skern, T. & Sonenberg, N. (1996). The eIF4GeIF4E complex is the target for direct cleavage by the rhinovirus 2A proteinase. Journal of Virology 70, 8444-8450.[Abstract]
Hagiwara, A., Tagaya, I. & Yoneyama, T. (1978). Epidemic of hand, foot and mouth disease associated with enterovirus 71 infection. Intervirology 9, 60-63.[Medline]
Haller, A. A. & Semler, B. L. (1995). Translation and host cell shutoff. In Human Enterovirus Infection , pp. 113-133. Edited by Harley A. Rotbart. Washington, DC:ASM.
Hayward, J. C., Gillespie, S. M., Kaplan, K. M., Packer, R., Pallansch, M., Plotkin, S. & Schonberger, L. B. (1989). Outbreak of poliomyelitis-like paralysis associated with enterovirus 71. Pediatric Infectious Disease Journal 8, 611-616.[Medline]
Henke, A., Launhardt, H., Klement, K., Stelzner, A., Zell, R. & Munder, T. (2000). Apoptosis in coxsackievirus B3-caused diseases: interaction between the capsid protein VP2 and the proapoptotic protein siva. Journal of Virology 74, 4284-4290.
Ho, M., Chen, E.-R., Hsu, K.-H., Twu, S.-J., Chen, K.-T., Tsai, S.-F., Wang, J.-R. & Shih, S.-R. (1999). An epidemic of enterovirus 71 infection in Taiwan. New England Journal of Medicine 341, 929-935.
Iizuka, N., Kuge, S. & Nomoto, A. (1987). Complete nucleotide sequence of the genome of coxsackievirus B1. Virology 156, 64-73.[Medline]
Ishimaru, Y., Nakano, S., Yamaoka, K. & Takami, S. (1980). Outbreaks of hand, foot, and mouth disease by enterovirus 71. High incidence of complication disorders of central nervous system. Archives of Disease in Childhood 55, 583-588.
Jackson, R. J., Hunt, S. L., Gibbs, C. L. & Kaminski, A. (1994). Internal initiation of translation of picornavirus RNAs. Molecular Biology Reports 19, 147-159.[Medline]
Jelachich, M. L. & Lipton, H. L. (1999). Restricted Theiler's murine encephalomyelitis virus infection in murine macrophages induces apoptosis. Journal of General Virology 80, 1701-1705.[Abstract]
Jenkins, O., Booth, J. D., Minor, P. D. & Almond, J. W. (1987). The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the Picornaviridae. Journal of General Virology 68, 1835-1848.
Kaufmann, S. H., Desnoyers, S., Ottaviano, Y., Davidson, N. E. & Poirier, G. G. (1993). Specific proteolytic cleavage of poly(ADP-ribose) polymerase: an early marker of chemotherapy-induced apoptosis. Cancer Research 53, 3976-3985.
Kitamura, N., Semler, B. L., Rothberg, P. G., Larsen, G. R., Adler, C. J., Dorner, A. J., Emini, E. A., Hanecak, R., Lee, J. J., van der Werf, S., Anderson, C. W. & Wimmer, E. (1981). Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature 291, 547-553.[Medline]
Krausslich, H.-G., Nicklin, M. J. H., Toyoda, H., Etchison, D. & Wimmer, E. (1987). Poliovirus proteinase 2A induces cleavage of the eucaryotic initiation factor 4F polyprotein p220. Journal of Virology 61, 2711-2718.
Lamphear, B. J., Yan, R., Yang, F., Waters, D., Liebig, H.-D., Klump, H., Kuechler, E., Skern, T. & Rhoads, R. E. (1993). Mapping the cleavage site in protein synthesis initiation factor eIF-4
of the 2A proteases from human coxsackievirus and rhinovirus. Journal of Biological Chemistry 268, 19200-19203.
Lazebnik, Y. A., Kaufmann, S. H., Desnoyers, S., Poirier, G. G. & Earnshaw, W. C. (1994). Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 371, 346-347.[Medline]
Lee, S. B. & Esteban, M. (1994). The interferon-induced double-stranded RNA-activated protein kinase induces apoptosis. Virology 199, 491-496.[Medline]
Lee, S. B., Rodriguez, D., Rodriguez, J. R. & Esteban, M. (1997). The apoptosis pathway triggered by the interferon-induced protein kinase PKR requires the third basic domain, initiates upstream of Bcl-2, and involves ICE-like proteases. Virology 231, 81-88.[Medline]
Liebig, H.-D., Ziegler, E., Yan, R., Hartmuth, K., Klump, H., Kowalski, H., Blaas, D., Sommergruber, W., Frasel, L., Lamphear, B., Rhoads, R., Kuechler, E. & Skern, T. (1993). Purification of two picornaviral 2A proteinases: interaction with eIF-4
and influence on in vitro translation. Biochemistry 32, 7581-7588.[Medline]
Lindberg, A. M., Stalhandske, P. O. & Pettersson, U. (1987). Genome of coxsackievirus B3. Virology 156, 50-63.[Medline]
Liu, C. C., Tseng, H. W., Wang, S. M., Wang, J. R. & Su, I. J. (2000). An outbreak of enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical manifestations. Journal of Clinical Virology 17, 23-30.[Medline]
Lloyd, R. E., Grubman, M. J. & Ehrenfeld, E. (1988). Relationship of p220 cleavage during picornavirus infection to 2A proteinase sequencing. Journal of Virology 62, 4216-4223.
López-Guerrero, J. A., Alonso, M., Martin-Belmonte, F. & Carrasco, L. (2000). Poliovirus induces apoptosis in the human U937 promonocytic cell line. Virology 272, 250-256.[Medline]
Lum, L. C. S., Wong, K. T., Lam, S. K., Chua, K. B., Goh, A. Y. T., Lim, W. L., Ong, B. B., Paul, G., AbuBakar, S. & Lambert, M. (1998). Fatal enterovirus 71 encephalomyelitis. Journal of Pediatrics 133, 795-798.[Medline]
Marissen, W. E. & Lloyd, R. E. (1998). Eukaryotic translation initiation factor 4G is targeted for proteolytic cleavage by caspase 3 during inhibition of translation in apoptotic cells. Molecular and Cellular Biology 18, 7565-7574.
Martin, S. J., Green, D. R. & Cotter, T. G. (1994). Dicing with death: dissecting the components of the apoptosis machinery. Trends in Biochemical Sciences 19, 26-30.[Medline]
Melcher, A., Gough, M., Todryk, S. & Vile, R. (1999). Apoptosis or necrosis for tumor immunotherapy: whats in a name? Journal of Molecular Medicine 77, 824-833.[Medline]
Morley, S. J., Curtis, P. S. & Pain, V. M. (1997). eIF4G: translations mystery factor begins to yield its secrets. RNA 3, 1085-1104.[Medline]
Nagy, G., Takatsy, S., Kukan, E., Mihaly, I. & Domok, I. (1982). Virological diagnosis of enterovirus type 71 infections: experiences gained during an epidemic of acute CNS diseases in Hungary in 1978. Archives of Virology 71, 217-227.[Medline]
Oberhaus, S. M., Smith, R. L., Clayton, G. H., Dermody, T. S. & Tyler, K. L. (1997). Reovirus infection and tissue injury in the mouse central nervous system are associated with apoptosis. Journal of Virology 71, 2100-2106.[Abstract]
O'Brien, V. (1998). Viruses and apoptosis. Journal of General Virology 79, 1833-1845.[Medline]
Ohlmann, T., Rau, M., Pain, V. M. & Morley, S. J. (1996). The C-terminal domain of eukaryotic protein synthesis initiation factor (eIF) 4G is sufficient to support cap-independent translation in the absence of eIF4E. EMBO Journal 15, 1371-1382.[Medline]
Pérez, L. & Carrasco, L. (1992). Lack of direct correlation between p220 cleavage and the shut-off of host translation after poliovirus infection. Virology 189, 178-186.[Medline]
Roberts, L. O., Seamons, R. A. & Belsham, G. L. (1998). Recognition of picornavirus internal ribosome entry sites within cells; influence of cellular and viral proteins. RNA 4, 520-529.[Abstract]
Roberts, L. O., Boxall, A. J., Lewis, L. J., Belsham, G. J. & Kass, G. E. N. (2000). Caspases are not involved in the cleavage of translation initiation factor eIF4GI during picornavirus infection. Journal of General Virology 81, 1703-1707.
Roulston, A., Marcellus, R. C. & Branton, P. E. (1999). Virus and apoptosis. Annual Review of Microbiology 53, 577-628.[Medline]
Ryan, M. D. & Flint, M. (1997). Virus-encoded proteinases of the picornavirus super-group. Journal of General Virology 78, 699-723.[Medline]
Sachs, A. B., Sarnow, P. & Hentze, M. W. (1997). Starting at the beginning, middle, and end: translation initiation in eukaryotes. Cell 89, 831-838.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schmidt, N. J., Lennette, E. H. & Ho, H. H. (1974). An apparently new enterovirus isolated from patients with disease of the central nervous system. Journal of Infectious Diseases 129, 304-309.[Medline]
Shimizu, H., Utama, A., Yoshii, K., Yoshida, H., Yoneyama, T., Sinniah, M., Yusof, M. A. B., Okuno, Y., Okabe, N., Shih, S. R., Chen, H. Y., Wang, G. R., Kao, C. L., Chang, K. S. S., Miyamura, T. & Hagiwara, A. (1999). Enterovirus 71 from fatal and nonfatal cases of hand, foot and mouth disease epidemics in Malaysia, Japan and Taiwan in 19971998. Japanese Journal of Infectious Diseases 52, 12-15.[Medline]
Skern, T., Sommergruber, W., Blaas, D., Gruendler, P., Fraundorfer, F., Pieler, C., Fogy, I. & Kuechler, E. (1985). Human rhinovirus 2: complete nucleotide sequence and proteolytic processing signals in the capsid protein region. Nucleic Acids Research 13, 2111-2126.
Sonenberg, N. & Gingras, A. C. (1998). The mRNA 5' cap-binding protein eIF4E and control of cell growth. Current Opinion in Cell Biology 10, 268-275.[Medline]
Stanway, G., Hughes, P. J., Mountford, R. C., Minor, P. D. & Almond, J. W. (1984). The complete nucleotide sequence of a common cold virus: human rhinovirus 14. Nucleic Acids Research 12, 7859-7875.
Teodoro, J. G. & Branton, P. E. (1997). Regulation of apoptosis by viral gene products. Journal of Virology 71, 1739-1746.[Medline]
Tolskaya, E. A., Romanova, L. I., Kolesnikova, M. S., Ivannikova, T. A., Smirnova, E. A., Raikhlin, N. T. & Agol, V. I. (1995). Apoptosis-inducing and apoptosis-preventing functions of poliovirus. Journal of Virology 69, 1181-1189.[Abstract]
Tsunoda, I., Kurtz, C. I. B. & Fujinami, R. S. (1997). Apoptosis in acute and chronic central nervous system disease induced by Theiler's murine encephalomyelitis virus. Virology 228, 388-393.[Medline]
Wang, S. M., Liu, C. C., Tseng, H. W., Wang, J. R., Huang, C. C., Chen, Y. J., Yang, Y. J., Lin, S. J. & Yeh, T. F. (1999). Clinical spectrum of enterovirus 71 infection in children in southern Taiwan, with an emphasis on neurological complications. Clinical Infectious Diseases 29, 184-190.[Medline]
Yu, S. F. & Lloyd, R. E. (1991). Identification of essential amino acid residues in the functional activity of poliovirus 2A protease. Virology 182, 615-625.[Medline]
Yu, S. F. & Lloyd, R. E. (1992). Characterization of the roles of conserved cysteine and histidine residues in poliovirus 2A protease. Virology 186, 725-735.[Medline]
Received 23 November 2001;
accepted 30 January 2002.
This article has been cited by other articles:
![]() |
L. I. Romanova, P. V. Lidsky, M. S. Kolesnikova, K. V. Fominykh, A. P. Gmyl, E. V. Sheval, S. V. Hato, F. J. M. van Kuppeveld, and V. I. Agol Antiapoptotic Activity of the Cardiovirus Leader Protein, a Viral "Security" Protein J. Virol., July 15, 2009; 83(14): 7273 - 7284. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fan, K.-N. Son, S. Y. Arslan, Z. Liang, and H. L. Lipton Theiler's Murine Encephalomyelitis Virus Leader Protein Is the Only Nonstructural Protein Tested That Induces Apoptosis When Transfected into Mammalian Cells J. Virol., July 1, 2009; 83(13): 6546 - 6553. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-T. Tsai, Y.-H. Cheng, Y.-N. Liu, N.-C. Liao, W.-W. Lu, and S.-H. Kung Real-Time Monitoring of Human Enterovirus (HEV)-Infected Cells and Anti-HEV 3C Protease Potency by Fluorescence Resonance Energy Transfer Antimicrob. Agents Chemother., February 1, 2009; 53(2): 748 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zaragoza, M. Saura, E. Y. Padalko, E. Lopez-Rivera, T. R. Lizarbe, S. Lamas, and C. J. Lowenstein Viral protease cleavage of inhibitor of {kappa}B{alpha} triggers host cell apoptosis PNAS, December 12, 2006; 103(50): 19051 - 19056. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Deszcz, E. Gaudernak, E. Kuechler, and J. Seipelt Apoptotic events induced by human rhinovirus infection J. Gen. Virol., May 1, 2005; 86(5): 1379 - 1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arita, H. Shimizu, N. Nagata, Y. Ami, Y. Suzaki, T. Sata, T. Iwasaki, and T. Miyamura Temperature-sensitive mutants of enterovirus 71 show attenuation in cynomolgus monkeys J. Gen. Virol., May 1, 2005; 86(5): 1391 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Wang, C.-T. Chou, H.-Y. Lei, C.-C. Liu, S.-M. Wang, J.-J. Yan, I.-J. Su, J.-R. Wang, T.-M. Yeh, S.-H. Chen, et al. A Mouse-Adapted Enterovirus 71 Strain Causes Neurological Disease in Mice after Oral Infection J. Virol., August 1, 2004; 78(15): 7916 - 7924. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |