|
|
||||||||
Animal: RNA Viruses |
Laboratory of Virology, National Agricultural Research Center, Tsukuba, Ibaraki 305-8666, Japan1
Department of Entomology, Clemson University, 113 Long Hall, Box 340365, Clemson, SC 29634-0365, USA2
Department of Plant Pathology, Clemson University, Clemson, SC 29634-0377, USA3
Author for correspondence: Gerald Carner. Fax +1 864 656 5065. e-mail gcarner{at}clemson.edu
| Abstract |
|---|
|
|
|---|
| Main text |
|---|
|
|
|---|
Polyhedra of BmCPV-1 strain I were isolated and purified as described previously (Hagiwara et al., 1998b
). DsRNA was isolated using a QIAamp Viral RNA Mini Kit (Qiagen). The purified dsRNA was precipitated and washed once with 75% ethanol, and the resulting pellet was dried under a vacuum for 3 min and then suspended in RNase-free water. DsRNA was then ligated to a single-stranded anchor (4-14-pp: 5' p-TCCTCTGAGGATTTTAAACT-p 3') in the presence of T4 RNA ligase (New England Biolabs). The ligation reaction was incubated at 10 °C for 12 h and the product was precipitated at room temperature according to the instructions for PelletPaint (Novagen). First strand cDNA was synthesized by AMV reverse transcriptase from Promega using primer 4-14-1 (5' GAGGGATCCAGTTTAAAATCCTCAGAGGA 3'), which is partially complementary to the anchor 4-14-pp. Another anchor-primer set, 5-15-pp/5-15-1 (5-15-pp: 5' p-GACCTCTGAGGATTCTAAACT-p 3' and 5'-15-1: GAGGGATCCAGTTTAGAATCCTCAGAGGTC 3') was also used for RT-PCR in order to exclude the possibility of mis-priming during either reverse transcription or PCR reaction. Following cDNA synthesis, PCR was completed using an Advantage 2 PCR Kit (Clontech). The reaction was carried out for 30 cycles with the following settings: denaturing at 95 °C for 30 s, annealing at 56 °C for 30 s, extension at 72 °C for 3 min. The cDNA products were excised from a gel upon separation as individual bands and purified by the GeneClean glass bead method (Bio101). After an A overhang addition, the DNAs were cloned into pBluescript SK(+) (Stratagene) prepared for T-A cloning. Clones containing full-length segments as inserts were identified by Southern hybridization and by restrictiondigestion of plasmids with BamHI, which cut at the 5' end of primer 4-14-1. Both anchors were found linked to the highly conserved termini of all segments of dsRNA as revealed by some sequences of full-length clones.
Nucleotide sequences of the S1, S3 and S4 cDNAs were determined with a Dye Terminator Cycle Sequencing Ready Reaction Kit and a Dye Primer Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied BioSystems) with an automatic sequencer (model 377, Perkin-Elmer Applied BioSystems).
The 5' AGUAA and GUUAGCC 3' terminal sequences of these segments were identical to those reported in other segments of BmCPV-1 (Hagiwara et al., 1998a
, b
, 2001
; Hagiwara & Matsumoto, 2000
; Miyajima et al., 1998
). The sequence of segment S1 consisted of 4190 nucleotides (nt) and contained a single open reading frame (ORF) located between nt 40 and 4041. It encoded a polypeptide of 1333 amino acids (aa) with a molecular mass of 148347 Da (148 kDa), which we designated as p148 and which showed partial homologies to the major capsid protein P3 of RRSV, a member of the genus Oryzavirus. Two regions of p148 at aa 189773 and 9701276 showed homologies (approximately 38% similarity) with the P3 of RRSV. Fig. 1(a)
is from an alignment result of the aa 189773 region with RRSV aa 171756 in a homology search using the BLAST program (Altschul et al., 1997
). Examination of the putative amino acid sequence of p148 revealed the motif of an active chitinase site ([LIVMFY]-[DN]-G-[LIVMF]-[DN]-[LIVMF]-[DN]-x-E) between aa 138 and 146 (138FNGLDVNTE146).
|
|
|
-pleated sheets, not the
-helices seen in the structure of the protein predicted for strain H (data not shown). In infected cells, strain I produces icosahedral polyhedra whereas strain H produces hexahedral polyhedra. Earlier work (Miyajima et al., 1998
In the motif search, the predicted amino acid sequence of S1 showed an active chitinase site. It has been reported that baculoviruses such as Autographa californica nucleopolyhedrovirus (AcMNPV) and Cydia pomonella granulovirus possess a gene encoding a chitinase (Thomas et al., 1998
; Kang et al., 1998
). In AcMNPV, the chitinase was localized within the endoplasmic reticulum of virus-infected insect cells, and is associated with liquefaction, a pathogenic effect that enhances dispersal of progeny virions (Thomas et al., 1998
; Hom & Volkman, 2000
). CPVs infect only midgut cells; however, as most baculoviruses and cypoviruses infect larvae of Lepidoptera, capsid proteins with chitnase activity may be required for infection of these insects.
All three of the putative proteins reported in this work show homologies to proteins described for the plant-infecting reovirus RRSV, which suggests both a relationship between the genera Cypovirus and Oryzavirus and that they may have diversified more recently than other viruses in the family Reoviridae. However, further molecular analysis is required to fully elucidate the relationships among genera in the family.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Belloncik, S., Liu, J., Su, D. & Arella, M. (1996). Identification and characterization of a new Cypovirus, type 14, isolated from Heliothis armigera. Journal of Invertebrate Pathology 67, 41-47.
Chou, P. Y. & Fasman, G. D. (1974). Prediction of protein conformation. Biochemistry 13, 222-245.[Medline]
Chou, P. Y. & Fasman, G. D. (1978). Empirical predictions of protein conformation. Annual Review of Biochemistry 47, 251-276.[Medline]
Fouillaud, M. & Morel, G. (1994). Characterization of cytoplasmic and nuclear polyhedrosis viruses recovered from the nest of Polistes hebraeus F. (Hymenoptera; Vespidae). Journal of Invertebrate Pathology 42, 401-404.
Fujii-Kawata, I., Miura, K.-I. & Fuke, M. (1970). Segments of genome of viruses containing double-stranded ribonucleic acid. Journal of Molecular Biology 51, 247-253.[Medline]
Hagiwara, K. & Matsumoto, T. (2000). Nucleotide sequences of genome segments 6 and 7 of Bombyx mori cypovirus 1, encoding the viral structural proteins V4 and V5, respectively. Journal of General Virology 81, 1143-1147.
Hagiwara, K., Tomita, M., Kobayashi, J., Miyajima, S. & Yoshimura, T. (1998a). Nucleotide sequence of Bombyx mori cytoplasmic polyhedrosis virus segment 8. Biochemical and Biophysical Research Communications 247, 549-553.[Medline]
Hagiwara, K., Tomita, M., Nakai, K., Kobayashi, J., Miyajima, S. & Yoshimura, T. (1998b). Determination of the nucleotide sequence of Bombyx mori cytoplasmic polyhedrosis virus segment 9 and its expression in BmN4 cells. Journal of Virology 72, 5762-5768.
Hagiwara, K., Kobayashi, J., Tomita, M. & Yoshimura, T. (2001). Nucleotide sequence of genome segment 5 from Bombyx mori cypovirus 1. Archives of Virology 146, 181-187.[Medline]
Holmes, I. H., Boccardo, G., Estes, M. K., Furuichi, M. K., Hoshino, Y., Joklik, W. K., McCrae, M., Mertens, P. P. C., Milne, G., Samal, K. S. K., Shikata, E., Winton, J. R. & Uyeda, I. (1995). Family Reoviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses , pp. 208-237. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York:Springer-Verlag.
Hom, L. G. & Volkman, L. E. (2000). Autographa californica M nucleopolyhedrovirus chiA is required for processing of V-CATH. Virology 277, 178-183.[Medline]
Hukuhara, T. & Midorikawa, M. (1983). Pathogenesis of cytoplasmic polyhedrosis in the silkworm. In Double-stranded RNA Viruses , pp. 405-414. Edited by R. W. Compans & D. H. L. Bishop. New York:Elsevier Science.
Ikeda, K., Nagaoka, S., Winkler, S., Kotani, K., Yagi, H., Nakanishi, K., Miyajima, S., Kobayashi, J. & Mori, H. (2001). Molecular characterization of Bombyx mori cytoplasmic polyhedrosis virus genome segment 4. Journal of Virology 75, 988-995.
Kang, W., Tristem, M., Maeda, S., Crook, N. E. & OReilly, D. R. (1998). Identification and characterization of the Cydia pomonella granulovirus cathepsin and chitinase genes. Journal of General Virology 79, 2283-2292.[Abstract]
McCrae, M. A. & Mertens, P. P. C. (1983). In vitro translation studies on and RNA coding assignments for cytoplasmic polyhedrosis viruses. In Double-stranded RNA Viruses , pp. 35-41. Edited by R. W. Compans & D. H. L. Bishop. New York:Elsevier Science.
Miyajima, S., Mori, A., Hagiwara, K., Kobayashi, J., Yoshimura, T., Nakai, K., Suzuki, Y. & Tomita, M. (1998). Microheterogeneity in the polyhedrin gene of Bombyx mori, a cytoplasmic polyhedrosis virus. Journal of Sericultural Science of Japan 67, 287-294.
Payne, C. C. & Mertens, P. P. C. (1983). Cytoplasmic polyhedrosis viruses. In The Reoviridae , pp. 425-504. Edited by W. K. Joklik. New York:Academic Press.
Payne, C. C. & Rivers, C. F. (1976). A provisional classification of cytoplasmic polyhedrosis viruses based on the sizes of the RNA genome segments. Journal of General Virology 33, 71-85.
Thomas, C. J., Brown, H. L., Hawes, C. R., Lee, B. Y., Min, M.-K., King, L. A. & Possee, R. D. (1998). Localization of a baculovirus-induced chitinase in the insect cell endoplasmic reticulum. Journal of Virology 72, 10207-10212.
Received 27 September 2001;
accepted 1 February 2002.
This article has been cited by other articles:
![]() |
N. Miyazaki, T. Uehara-Ichiki, L. Xing, L. Bergman, A. Higashiura, A. Nakagawa, T. Omura, and R. H. Cheng Structural Evolution of Reoviridae Revealed by Oryzavirus in Acquiring the Second Capsid Shell J. Virol., November 15, 2008; 82(22): 11344 - 11353. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, J. Zhang, Y. Li, L. Tan, W. Chen, H. Luo, and Y. Hu Phylogenetic analysis of Heliothis armigera cytoplasmic polyhedrosis virus type 14 and a series of dwarf segments found in the genome J. Gen. Virol., March 1, 2007; 88(3): 991 - 997. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, L. Tan, Y. Li, W. Chen, J. Zhang, and Y. Hu Identification and genome characterization of Heliothis armigera cypovirus types 5 and 14 and Heliothis assulta cypovirus type 14 J. Gen. Virol., February 1, 2006; 87(2): 387 - 394. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shapiro, T. Green, S. Rao, S. White, G. Carner, P. P. C. Mertens, and J. J. Becnel Morphological and Molecular Characterization of a Cypovirus (Reoviridae) from the Mosquito Uranotaenia sapphirina (Diptera: Culicidae) J. Virol., August 1, 2005; 79(15): 9430 - 9438. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hagiwara and H. Naitow Assembly into single-shelled virus-like particles by major capsid protein VP1 encoded by genome segment S1 of Bombyx mori cypovirus 1 J. Gen. Virol., September 1, 2003; 84(9): 2439 - 2441. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |