J Gen Virol Faster Access
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Carner, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Carner, G. R.
Agricola
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Carner, G. R.
Journal of General Virology (2002), 83, 1477-1482.
© 2002 Society for General Microbiology


Animal: RNA Viruses

Nucleotide sequences of segments 1, 3 and 4 of the genome of Bombyx mori cypovirus 1 encoding putative capsid proteins VP1, VP3 and VP4, respectively

Kyoji Hagiwara1, Shujing Rao2, Simon W. Scott3 and Gerald R. Carner2

Laboratory of Virology, National Agricultural Research Center, Tsukuba, Ibaraki 305-8666, Japan1
Department of Entomology, Clemson University, 113 Long Hall, Box 340365, Clemson, SC 29634-0365, USA2
Department of Plant Pathology, Clemson University, Clemson, SC 29634-0377, USA3

Author for correspondence: Gerald Carner. Fax +1 864 656 5065. e-mail gcarner{at}clemson.edu


   Abstract
TOP
Abstract
Main text
References
 
The complete nucleotide sequences of genomic segments S1, S3 and S4 from Bombyx mori cypovirus 1 (BmCPV-1) have been determined. The segments consisted of 4190, 3846 and 3262 nucleotides encoding putative proteins of 1333, 1239 and 1058 amino acids with molecular masses of approximately 148, 140 and 120 kDa (p148, p140 and p120, respectively). All segments possess a single open reading frame. Homology searches showed that all three proteins have homologies to proteins of Rice ragged stunt virus, a member of the genus Oryzavirus within the family Reoviridae. Partial homologies of p140 to structural proteins in other viruses were also found. The predicted molecular masses and the homologies with structural proteins in other viruses lead us to suggest that S1, S3 and S4 encode the capsid proteins VP1, VP3, and VP4, respectively, of BmCPV-1.


   Main text
TOP
Abstract
Main text
References
 
Cytoplasmic polyhedrosis viruses (CPVs) are members of the genus Cypovirus in the family Reoviridae (Holmes et al., 1995Down ). CPVs possess a double-stranded (ds) RNA genome comprising 10 segments (S1-S10) (Fujii-Kawata et al., 1970Down ) and are classified into 14 distinct electropherotypes on the basis of variations in the migration patterns of the genome segments (Payne & Rivers, 1976Down ; Payne & Mertens, 1983Down ; Fouillaud & Morel, 1994Down ; Belloncik et al., 1996Down ). Bombyx mori CPVs, members of type species Cypovirus 1, can be divided into nine strains (I, H, P, A, B, B1, B2, C1 and C2) distinguished by the shapes and/or the intracellular localization of the inclusion bodies (Hukuhara & Midorikawa, 1983Down ). Sequences for the complete genomes of members of other genera within the family Reoviridae have been reported, whereas no systematic analysis of the Cypovirus genome has been carried out. Therefore, we attempted to complete the nucleotide sequences of 10 genomic segments of Bombyx mori cypovirus 1 (BmCPV-1), one member of this type species. The complete nucleotide sequences of S5, S6, S7, S8, S9 and S10 (Hagiwara et al., 1998aDown , bDown , 2001Down ; Hagiwara & Matsumoto, 2000Down ; Miyajima et al., 1998Down ) have already been determined. In the present study, we report the complete nucleotide sequences of S1, S3 and S4 of strain I. The sequence for S2, which encodes the RNA-dependent RNA polymerase (RDRP), has also been determined (accession no. AF323782) and will be presented in a separate paper which will compare the RDRPs for four different cypoviruses. Thus, the characterization of one strain of BmCPV-1 has been completed.

Polyhedra of BmCPV-1 strain I were isolated and purified as described previously (Hagiwara et al., 1998bDown ). DsRNA was isolated using a QIAamp Viral RNA Mini Kit (Qiagen). The purified dsRNA was precipitated and washed once with 75% ethanol, and the resulting pellet was dried under a vacuum for 3 min and then suspended in RNase-free water. DsRNA was then ligated to a single-stranded anchor (4-14-pp: 5' p-TCCTCTGAGGATTTTAAACT-p 3') in the presence of T4 RNA ligase (New England Biolabs). The ligation reaction was incubated at 10 °C for 12 h and the product was precipitated at room temperature according to the instructions for PelletPaint (Novagen). First strand cDNA was synthesized by AMV reverse transcriptase from Promega using primer 4-14-1 (5' GAGGGATCCAGTTTAAAATCCTCAGAGGA 3'), which is partially complementary to the anchor 4-14-pp. Another anchor-primer set, 5-15-pp/5-15-1 (5-15-pp: 5' p-GACCTCTGAGGATTCTAAACT-p 3' and 5'-15-1: GAGGGATCCAGTTTAGAATCCTCAGAGGTC 3') was also used for RT-PCR in order to exclude the possibility of mis-priming during either reverse transcription or PCR reaction. Following cDNA synthesis, PCR was completed using an Advantage 2 PCR Kit (Clontech). The reaction was carried out for 30 cycles with the following settings: denaturing at 95 °C for 30 s, annealing at 56 °C for 30 s, extension at 72 °C for 3 min. The cDNA products were excised from a gel upon separation as individual bands and purified by the GeneClean glass bead method (Bio101). After an ‘A’ overhang addition, the DNAs were cloned into pBluescript SK(+) (Stratagene) prepared for T-A cloning. Clones containing full-length segments as inserts were identified by Southern hybridization and by restrictiondigestion of plasmids with BamHI, which cut at the 5' end of primer 4-14-1. Both anchors were found linked to the highly conserved termini of all segments of dsRNA as revealed by some sequences of full-length clones.

Nucleotide sequences of the S1, S3 and S4 cDNAs were determined with a Dye Terminator Cycle Sequencing Ready Reaction Kit and a Dye Primer Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied BioSystems) with an automatic sequencer (model 377, Perkin-Elmer Applied BioSystems).

The 5' AGUAA and GUUAGCC 3' terminal sequences of these segments were identical to those reported in other segments of BmCPV-1 (Hagiwara et al., 1998aDown , bDown , 2001Down ; Hagiwara & Matsumoto, 2000Down ; Miyajima et al., 1998Down ). The sequence of segment S1 consisted of 4190 nucleotides (nt) and contained a single open reading frame (ORF) located between nt 40 and 4041. It encoded a polypeptide of 1333 amino acids (aa) with a molecular mass of 148347 Da (148 kDa), which we designated as p148 and which showed partial homologies to the major capsid protein P3 of RRSV, a member of the genus Oryzavirus. Two regions of p148 at aa 189–773 and 970–1276 showed homologies (approximately 38% similarity) with the P3 of RRSV. Fig. 1(a)Down is from an alignment result of the aa 189–773 region with RRSV aa 171–756 in a homology search using the BLAST program (Altschul et al., 1997Down ). Examination of the putative amino acid sequence of p148 revealed the motif of an active chitinase site ([LIVMFY]-[DN]-G-[LIVMF]-[DN]-[LIVMF]-[DN]-x-E) between aa 138 and 146 (138FNGLDVNTE146).



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1. BLAST program search results for p148 and p140 of BmCPV-1. (a) Homology of BmCPV-1 p148 to major capsid protein P3 of RRSV: top sequence is p148 encoded by segment 1 from BmCPV-1 and the bottom is P3 of RRSV. Plus symbols indicate similar amino acids. (b) Homology of BmCPV-1 p140 to P1 of RRSV: the top sequence is p140 encoded by segment 3 from BmCPV-1 and the bottom is P1 of RRSV. Values for identity and similarity between the two sequences and the number of gaps in the alignments are indicated.

 
The sequence of segment S3 consisted of 3846 nucleotides and contained a single ORF located between nt 41 and 3760. It encoded a polypeptide of 1239 amino acids with a molecular mass of 140025 Da (140 kDa), which we designated p140, and which showed partial homologies to the P1 protein of RRSV (approximately 47% similarity), a minor structural protein of a parvo-like virus (approximately 43% similarity), the capsid protein of bacteriophage WO (approximately 49% similarity), and the capsid protein of Human papillomavirus (approximately 44% similarity). The BLAST result of the alignment to RRSV is shown in Fig. 1(b)Up. S4 consisted of 3846 nucleotides and contained a single ORF located between nt 14 and 3190. It encoded a polypeptide of 1058 amino acids with a molecular mass of 119932 Da (120 kDa), which we designated p120 and which showed overall homology (approximately 39% similarity) to P2 of RRSV (Fig. 2Down).



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 2. BLAST program search results for p120 of BmCPV-1. Top sequence is p120 encoded by segment 4 from BmCPV-1 and bottom is P2 of RRSV. Plus symbols indicate similar amino acids. Values for identity and similarity between the two sequences and the number of gaps in the alignments are displayed.

 
In SDS–PAGE analysis of purified BmCPV-1 virions, two major proteins of about 146 kDa (V1) and 125 kDa (V3) and a minor protein about 138 kDa (V2) have been observed (Hagiwara & Matsumoto, 2000Down ). Other works based on in vitro translation studies (Payne & Mertens, 1983Down ; McCrae & Mertens, 1983Down ) have assigned the encoding of the V1 and V3 proteins to the RNA S1 and S4, respectively, and the encoding of V2 to the RNA S2 or S3. The respective sizes (148, 140 and 120 kDa) of the putative translation products that we have associated with S1, S3 and S4 of this isolate of BmCPV-1 clearly support this assignment. The predicted molecular masses and the homologies with structural proteins in other viruses lead us to suggest that S1, S3 and S4 encode capsid proteins. In BmCPV-1, segment S2 was found to encode RNA-dependent RNA polymerase (RDRP) by sequence analysis. As the RDRP is located inside the capsid in members of the family Reoviridae, our results suggest that BmCPV-1 has six structural proteins encoded by S1, S2, S3, S4, S6 and S7, respectively. To avoid confusion and to distinguish between structural and nonstructural proteins, we have renamed the putative proteins encoded by S1 to S9 as VP1, VP2, VP3, VP4, NSP5 (NSP5a+NSP5b), VP6, VP7, NSP8 and NSP9, respectively (Table 1Down).


View this table:
[in this window]
[in a new window]
 
Table 1. Properties of BmCPV-1 genome segments and their product proteins

 
In this study, we report the complete sequence of the three segments S1, S3 and S4 of BmCPV-1 strain I. The complete sequence of S4 of BmCPV-1 strain H was recently described (Ikeda et al., 2001Down ). Comparisons between the putative translation products of the two S4 sequences show 14 amino acid substitutions with the insertion of Asp at position 386. The predicted secondary structures of the two proteins (Chou & Fasman, 1974Down , 1978Down ) showed some differences. The insertion of Asp caused the structure predicted for strain I to have a domain rich in {beta}-pleated sheets, not the {alpha}-helices seen in the structure of the protein predicted for strain H (data not shown). In infected cells, strain I produces icosahedral polyhedra whereas strain H produces hexahedral polyhedra. Earlier work (Miyajima et al., 1998Down ) suggested the possibility that the difference in the shape of the polyhedra is not because of any difference in the protein coded for in the polyhedrin gene, but the result of the incorporation of a structural protein(s) into the polyhedra. The p120 protein encoded by S4 shows similarity with capsid proteins occurring in the outer regions of other viruses. The significant difference between the predicted structures of the proteins of strains I and H of BmCPV-1 might be explained by the involvement of the two different predicted structures in the respective polyhedra.

In the motif search, the predicted amino acid sequence of S1 showed an active chitinase site. It has been reported that baculoviruses such as Autographa californica nucleopolyhedrovirus (AcMNPV) and Cydia pomonella granulovirus possess a gene encoding a chitinase (Thomas et al., 1998Down ; Kang et al., 1998Down ). In AcMNPV, the chitinase was localized within the endoplasmic reticulum of virus-infected insect cells, and is associated with liquefaction, a pathogenic effect that enhances dispersal of progeny virions (Thomas et al., 1998Down ; Hom & Volkman, 2000Down ). CPVs infect only midgut cells; however, as most baculoviruses and cypoviruses infect larvae of Lepidoptera, capsid proteins with chitnase activity may be required for infection of these insects.

All three of the putative proteins reported in this work show homologies to proteins described for the plant-infecting reovirus RRSV, which suggests both a relationship between the genera Cypovirus and Oryzavirus and that they may have diversified more recently than other viruses in the family Reoviridae. However, further molecular analysis is required to fully elucidate the relationships among genera in the family.


   Footnotes
 
The nucleotide sequence data reported in this paper are deposited in the GenBank/EMBL/DDBJ nucleotide sequence databases under accession numbers AF323781, AF323782, AF323783 and AF323784.


   References
TOP
Abstract
Main text
References
 
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389-3402.[Abstract/Free Full Text]

Belloncik, S., Liu, J., Su, D. & Arella, M. (1996). Identification and characterization of a new Cypovirus, type 14, isolated from Heliothis armigera. Journal of Invertebrate Pathology 67, 41-47.

Chou, P. Y. & Fasman, G. D. (1974). Prediction of protein conformation. Biochemistry 13, 222-245.[Medline]

Chou, P. Y. & Fasman, G. D. (1978). Empirical predictions of protein conformation. Annual Review of Biochemistry 47, 251-276.[Medline]

Fouillaud, M. & Morel, G. (1994). Characterization of cytoplasmic and nuclear polyhedrosis viruses recovered from the nest of Polistes hebraeus F. (Hymenoptera; Vespidae). Journal of Invertebrate Pathology 42, 401-404.

Fujii-Kawata, I., Miura, K.-I. & Fuke, M. (1970). Segments of genome of viruses containing double-stranded ribonucleic acid. Journal of Molecular Biology 51, 247-253.[Medline]

Hagiwara, K. & Matsumoto, T. (2000). Nucleotide sequences of genome segments 6 and 7 of Bombyx mori cypovirus 1, encoding the viral structural proteins V4 and V5, respectively. Journal of General Virology 81, 1143-1147.[Abstract/Free Full Text]

Hagiwara, K., Tomita, M., Kobayashi, J., Miyajima, S. & Yoshimura, T. (1998a). Nucleotide sequence of Bombyx mori cytoplasmic polyhedrosis virus segment 8. Biochemical and Biophysical Research Communications 247, 549-553.[Medline]

Hagiwara, K., Tomita, M., Nakai, K., Kobayashi, J., Miyajima, S. & Yoshimura, T. (1998b). Determination of the nucleotide sequence of Bombyx mori cytoplasmic polyhedrosis virus segment 9 and its expression in BmN4 cells. Journal of Virology 72, 5762-5768.[Abstract/Free Full Text]

Hagiwara, K., Kobayashi, J., Tomita, M. & Yoshimura, T. (2001). Nucleotide sequence of genome segment 5 from Bombyx mori cypovirus 1. Archives of Virology 146, 181-187.[Medline]

Holmes, I. H., Boccardo, G., Estes, M. K., Furuichi, M. K., Hoshino, Y., Joklik, W. K., McCrae, M., Mertens, P. P. C., Milne, G., Samal, K. S. K., Shikata, E., Winton, J. R. & Uyeda, I. (1995). Family Reoviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses , pp. 208-237. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York:Springer-Verlag.

Hom, L. G. & Volkman, L. E. (2000). Autographa californica M nucleopolyhedrovirus chiA is required for processing of V-CATH. Virology 277, 178-183.[Medline]

Hukuhara, T. & Midorikawa, M. (1983). Pathogenesis of cytoplasmic polyhedrosis in the silkworm. In Double-stranded RNA Viruses , pp. 405-414. Edited by R. W. Compans & D. H. L. Bishop. New York:Elsevier Science.

Ikeda, K., Nagaoka, S., Winkler, S., Kotani, K., Yagi, H., Nakanishi, K., Miyajima, S., Kobayashi, J. & Mori, H. (2001). Molecular characterization of Bombyx mori cytoplasmic polyhedrosis virus genome segment 4. Journal of Virology 75, 988-995.[Abstract/Free Full Text]

Kang, W., Tristem, M., Maeda, S., Crook, N. E. & O’Reilly, D. R. (1998). Identification and characterization of the Cydia pomonella granulovirus cathepsin and chitinase genes. Journal of General Virology 79, 2283-2292.[Abstract]

McCrae, M. A. & Mertens, P. P. C. (1983). In vitro translation studies on and RNA coding assignments for cytoplasmic polyhedrosis viruses. In Double-stranded RNA Viruses , pp. 35-41. Edited by R. W. Compans & D. H. L. Bishop. New York:Elsevier Science.

Miyajima, S., Mori, A., Hagiwara, K., Kobayashi, J., Yoshimura, T., Nakai, K., Suzuki, Y. & Tomita, M. (1998). Microheterogeneity in the polyhedrin gene of Bombyx mori, a cytoplasmic polyhedrosis virus. Journal of Sericultural Science of Japan 67, 287-294.

Payne, C. C. & Mertens, P. P. C. (1983). Cytoplasmic polyhedrosis viruses. In The Reoviridae , pp. 425-504. Edited by W. K. Joklik. New York:Academic Press.

Payne, C. C. & Rivers, C. F. (1976). A provisional classification of cytoplasmic polyhedrosis viruses based on the sizes of the RNA genome segments. Journal of General Virology 33, 71-85.[Abstract/Free Full Text]

Thomas, C. J., Brown, H. L., Hawes, C. R., Lee, B. Y., Min, M.-K., King, L. A. & Possee, R. D. (1998). Localization of a baculovirus-induced chitinase in the insect cell endoplasmic reticulum. Journal of Virology 72, 10207-10212.[Abstract/Free Full Text]

Received 27 September 2001; accepted 1 February 2002.


This article has been cited by other articles:


Home page
J. Virol.Home page
N. Miyazaki, T. Uehara-Ichiki, L. Xing, L. Bergman, A. Higashiura, A. Nakagawa, T. Omura, and R. H. Cheng
Structural Evolution of Reoviridae Revealed by Oryzavirus in Acquiring the Second Capsid Shell
J. Virol., November 15, 2008; 82(22): 11344 - 11353.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y. Li, J. Zhang, Y. Li, L. Tan, W. Chen, H. Luo, and Y. Hu
Phylogenetic analysis of Heliothis armigera cytoplasmic polyhedrosis virus type 14 and a series of dwarf segments found in the genome
J. Gen. Virol., March 1, 2007; 88(3): 991 - 997.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y. Li, L. Tan, Y. Li, W. Chen, J. Zhang, and Y. Hu
Identification and genome characterization of Heliothis armigera cypovirus types 5 and 14 and Heliothis assulta cypovirus type 14
J. Gen. Virol., February 1, 2006; 87(2): 387 - 394.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
A. Shapiro, T. Green, S. Rao, S. White, G. Carner, P. P. C. Mertens, and J. J. Becnel
Morphological and Molecular Characterization of a Cypovirus (Reoviridae) from the Mosquito Uranotaenia sapphirina (Diptera: Culicidae)
J. Virol., August 1, 2005; 79(15): 9430 - 9438.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
K. Hagiwara and H. Naitow
Assembly into single-shelled virus-like particles by major capsid protein VP1 encoded by genome segment S1 of Bombyx mori cypovirus 1
J. Gen. Virol., September 1, 2003; 84(9): 2439 - 2441.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Carner, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Carner, G. R.
Agricola
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Carner, G. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS